ID: 1103793146

View in Genome Browser
Species Human (GRCh38)
Location 12:123485719-123485741
Sequence CAGGGTGAACCGGGGGCGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103793138_1103793146 -10 Left 1103793138 12:123485706-123485728 CCCGCAGCTCCTGCAGGGTGAAC 0: 1
1: 0
2: 0
3: 35
4: 329
Right 1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 116
1103793134_1103793146 26 Left 1103793134 12:123485670-123485692 CCTTGGACTTGAGCTCGTTCCTC 0: 1
1: 1
2: 0
3: 4
4: 100
Right 1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 116
1103793135_1103793146 7 Left 1103793135 12:123485689-123485711 CCTCTCGTGCAGCACGTCCCGCA 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103793146 Original CRISPR CAGGGTGAACCGGGGGCGGT TGG Exonic
900164839 1:1240551-1240573 CAGGGTGAATGGGGGGCGTGGGG - Intergenic
900164851 1:1240576-1240598 CAGGGTGAATGGGGGGGGCTGGG - Intergenic
900973734 1:6005373-6005395 GAGGGTGAACTGGGGGATGTGGG + Intronic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
903068810 1:20716548-20716570 CAGGGAGAACTGGGGGAGCTGGG + Intronic
903171742 1:21558682-21558704 GAGGGTGGACCTGGGGCTGTCGG + Intronic
904598350 1:31660619-31660641 CAGGGTGAACCTGGTGCCATGGG - Exonic
905731962 1:40303953-40303975 CAGGGTGACCCAGGGGTGGCCGG - Exonic
906662006 1:47589678-47589700 CAGGGTGAAAAGGAGGTGGTAGG + Intergenic
906666731 1:47627385-47627407 GAGGGTGAAGCGGTGGTGGTGGG + Intergenic
906688887 1:47779760-47779782 CAGGATGAACAGGGAGCAGTAGG - Intronic
907320666 1:53600141-53600163 GGGGGTGAGCCCGGGGCGGTGGG + Exonic
907438659 1:54465043-54465065 GAGGGTGAGCCGGAGGTGGTGGG + Intergenic
907547532 1:55275070-55275092 CAGGGAGCACGTGGGGCGGTGGG + Intergenic
907771498 1:57469511-57469533 CAGAGTGGACCTGGGGCTGTTGG - Intronic
919649185 1:200128693-200128715 CAGGGTGGAGTGGGGGTGGTGGG + Intronic
920694328 1:208170414-208170436 CAGGGGGAAGCAGGGGCGGGTGG + Intronic
921699206 1:218248110-218248132 GAGGGTGAGCAGGGGGAGGTTGG + Intergenic
922753499 1:228082056-228082078 CGGGGTGAGGCGGGGGCCGTGGG - Intergenic
1062932600 10:1362986-1363008 CAGGGGGAACGGGCGGCGCTGGG - Intronic
1063353069 10:5374064-5374086 CAGGGTGAACTTGGTGCGGTGGG - Exonic
1065207431 10:23370433-23370455 CAGGGTGCAGGGGGGACGGTGGG + Intergenic
1069359175 10:67622415-67622437 CAGAGTGAACTGGGGTTGGTTGG + Intronic
1070751790 10:78968211-78968233 CAGGGCGCACCAGGGGCAGTAGG + Intergenic
1073489845 10:103845914-103845936 CAGGGTGTACCAGGTGGGGTAGG - Intronic
1073533645 10:104255083-104255105 CAGTGGGACGCGGGGGCGGTGGG + Intronic
1076196073 10:128519310-128519332 CGGGGTGAAGTGGGGGCTGTAGG - Intergenic
1076444249 10:130500929-130500951 CAGGGTGCTCCAGGGGCCGTTGG + Intergenic
1077063310 11:627014-627036 CAGGGCGCACTGGGGGCGGGTGG + Intronic
1077244155 11:1527905-1527927 CAGGGAGAGCCGGGGGCCGGGGG - Intergenic
1078316210 11:10294747-10294769 CCGGGTGGGCCGGGGGCGGTCGG + Intergenic
1083261769 11:61526974-61526996 CTGGTTGAACCGGGGGCCATTGG + Intronic
1083663712 11:64263792-64263814 CAGGGTGAGCTGGGGGTGGGCGG + Exonic
1084153549 11:67302183-67302205 CTGGGTGGACCGGGGGCTGGGGG - Exonic
1089198744 11:116710779-116710801 CAGGATGAACCTGGGGCAGTGGG - Intergenic
1091740927 12:2959825-2959847 CTGGGCGCACCGGGGCCGGTCGG + Intronic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1094464944 12:30743123-30743145 CAGGTAGAAGCGGGGGCGGGGGG - Intronic
1096862766 12:54541929-54541951 GAGGGTGAAGAGGGGGAGGTGGG - Intronic
1101826740 12:108226201-108226223 CAGGGAGAACTAGGGGTGGTGGG + Intronic
1102462153 12:113106492-113106514 AAGAGTGAACTGGGGGCAGTGGG - Intronic
1102490835 12:113288718-113288740 CAGGGTGACGCGGGGCCGGCAGG - Intronic
1103785599 12:123430594-123430616 CAGAGTGAAGCGGGGTCGGTTGG + Exonic
1103793146 12:123485719-123485741 CAGGGTGAACCGGGGGCGGTTGG + Exonic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1110546598 13:76763021-76763043 CTGGATGAACCGGTGGAGGTTGG - Intergenic
1113926734 13:113945958-113945980 CACAGTGAACGGGCGGCGGTGGG - Intergenic
1113926749 13:113946030-113946052 CACGGTGAACGGGCAGCGGTGGG - Intergenic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1119508952 14:75196369-75196391 CAGGGTCACCTGGGGGCTGTGGG - Intergenic
1123180289 14:106463177-106463199 CAGGGCCAACTGGGGGCGCTCGG - Intergenic
1202946610 14_KI270726v1_random:33476-33498 CAGGGCCAACTGGGGGCGCTCGG + Intergenic
1127843060 15:62846967-62846989 CAGGCTGACCTGGGGGTGGTGGG + Intergenic
1128632837 15:69282845-69282867 CTGGGTGAACCTGGGGTGGGTGG - Intergenic
1130965704 15:88695967-88695989 GCGGGTGAGCCAGGGGCGGTGGG - Intergenic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1133136810 16:3717775-3717797 CAGCGTGGGCCGGGGGCGGCGGG - Intergenic
1140626086 16:76796028-76796050 TAGCCAGAACCGGGGGCGGTGGG - Intergenic
1141675129 16:85513777-85513799 CAGTGTGCACCGGGGGTGGGGGG - Intergenic
1142076567 16:88121217-88121239 CATGGTGAAGGGGGGGAGGTTGG + Intergenic
1142126289 16:88412168-88412190 CAGGGTGGGCCTGGGACGGTGGG - Intergenic
1142232215 16:88905336-88905358 CAGAGGGAACGAGGGGCGGTGGG - Intronic
1142642567 17:1292930-1292952 CAGTGTGAATCGGGGGCGTGGGG + Intronic
1143516854 17:7423752-7423774 CATGGTGAACTGGGGAAGGTGGG - Intergenic
1146646782 17:34581482-34581504 CAGGGAGAGACGGGGGCGGGGGG - Intronic
1147266702 17:39238607-39238629 CAGGGTGAGCTGGAGGTGGTAGG + Intergenic
1151765324 17:76130769-76130791 CAGGGTGAACCGGAGGGTGTGGG - Intergenic
1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG + Intronic
1152539126 17:80966121-80966143 CAGGGTGGAGCGGGGGCGGGGGG - Exonic
1160965327 19:1744781-1744803 CAGGGTGGACCGGTGGGGGAGGG - Intergenic
1162318980 19:9959803-9959825 CAAGGTGAGCCTGGGGAGGTGGG + Exonic
1165065789 19:33227013-33227035 CAGGGTGGACCGGGGTGGGACGG + Intergenic
1168337730 19:55605762-55605784 CCGGGTGCAGCGGGGGCGGGGGG + Intronic
1168700688 19:58437663-58437685 CAGTGTGAACAGGGAGGGGTTGG - Intronic
926634566 2:15165966-15165988 CAGAGTGACCGGGGGGCCGTTGG - Intergenic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
930034934 2:47079417-47079439 CAGAGGGAAGCGGGGGCGGGGGG + Intronic
931229407 2:60361501-60361523 CTGGGTGAACCCTGGGCTGTAGG - Intergenic
933653001 2:84864372-84864394 CAGGGTGATCCAGTGGCAGTGGG - Intronic
936110720 2:109662256-109662278 CAGGGTGAACCAGAGAAGGTGGG - Intergenic
947727661 2:232410002-232410024 CAGGGTGCACCGGGAGGGGAAGG - Exonic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174573911 20:51523782-51523804 CAGGGTGAACCTCGGGCTGGCGG + Exonic
1175229451 20:57464429-57464451 CAGGCTGAAGCGGGGGAGGCTGG + Intergenic
1177014994 21:15775749-15775771 CAGAGTGCAGCGGGGGCGGGGGG - Intronic
1177275523 21:18908166-18908188 GAGGCTGAACTGGGGGCAGTGGG + Intergenic
1180083902 21:45498882-45498904 CAGGATGAACCTGGGGCTGAAGG + Intronic
1181057566 22:20267440-20267462 CTGGGGGAATCAGGGGCGGTGGG - Intronic
1181102844 22:20552916-20552938 CAGGGTCAACCTGGGGCCTTAGG - Intronic
956290462 3:67654793-67654815 CAAAGTGAACCGGGGCCGGGTGG - Intergenic
968512663 4:1002482-1002504 CTGGGTGAGCCGGGGCCGCTGGG + Exonic
978453540 4:108863368-108863390 CAGGGTGAACGGGGGGAAGCAGG - Exonic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
985827359 5:2202657-2202679 CAGGGTGAACCCTGGCAGGTGGG - Intergenic
986721367 5:10563666-10563688 CACTCTGAACTGGGGGCGGTCGG - Intergenic
992625863 5:78635373-78635395 CTGGGGGAAGAGGGGGCGGTGGG - Intronic
993565585 5:89470891-89470913 CATAGTGAACCGGGGGAAGTGGG + Intergenic
1001831757 5:174794888-174794910 CAGGGGGGACGGGGGGGGGTGGG - Intergenic
1002478978 5:179486825-179486847 CACGGTGAAGAGGGGGCGGCAGG - Intergenic
1003974714 6:11331368-11331390 CAGGGTGAGGCGGGGGTGGGGGG + Intronic
1006387178 6:33737770-33737792 CTGGGTGAACCGGGGCTGCTCGG + Intronic
1007305053 6:40897342-40897364 AAGGGTGGATGGGGGGCGGTGGG - Intergenic
1007991658 6:46262331-46262353 CAGGGTGAACAGGGGGCTGATGG - Intronic
1011314531 6:86016798-86016820 CAGGGAGGAAGGGGGGCGGTGGG + Intergenic
1018653151 6:166007853-166007875 AAGGGGGAAGCGGGGGCGGGGGG + Intergenic
1019665988 7:2252617-2252639 CAGGGTGAAGGGGGGGCTGGAGG - Exonic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020445461 7:8262402-8262424 CAGGGTGACCGGGGGAAGGTGGG + Intronic
1028754284 7:94417721-94417743 AAGGGTGAACCTGGTGTGGTTGG + Exonic
1035172160 7:157022799-157022821 CAGGGTGGACCAGGGGCTGCTGG - Intergenic
1037858671 8:22389447-22389469 CAGGAGGACCCGGGGGAGGTGGG + Intronic
1038273222 8:26094349-26094371 CAGGGGGCACCGTGGGAGGTGGG - Intergenic
1039445146 8:37625161-37625183 CATTGTGAAGCTGGGGCGGTGGG - Intergenic
1040548715 8:48422264-48422286 CAGGGAGAACAGGGCGCTGTAGG + Intergenic
1042143856 8:65707062-65707084 CAGGGGGAGGCAGGGGCGGTGGG - Exonic
1049684151 8:143932601-143932623 CAGGGCCAGCCGGGGGAGGTGGG - Intronic
1052988717 9:34506115-34506137 CAGGCTGAACCTGGGACTGTGGG + Intronic
1053055773 9:34992293-34992315 CAGGGTGGACTGGGGGCGTAGGG + Intronic
1056628411 9:88273170-88273192 CAGGGTGACCAGGAGGCCGTCGG + Intergenic
1058612909 9:106794209-106794231 CAGGGGGGATCGGGGGCGGGGGG + Intergenic
1062107955 9:134765955-134765977 CAGGGTGAAGCGGAGGCGTGAGG - Intronic
1188404279 X:29787221-29787243 CAGGGTGAATGAGGGGTGGTGGG + Intronic
1192192243 X:68998158-68998180 AAGGGTGGAGGGGGGGCGGTGGG + Intergenic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1201076708 Y:10195219-10195241 AAGGGGGAGCCGGGCGCGGTAGG - Intergenic