ID: 1103800195

View in Genome Browser
Species Human (GRCh38)
Location 12:123533128-123533150
Sequence CGTCCGGGCAGTGGGACCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103800195_1103800204 7 Left 1103800195 12:123533128-123533150 CCCGCGGTCCCACTGCCCGGACG 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1103800204 12:123533158-123533180 CGAGGCCGCCGCCCACCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103800195 Original CRISPR CGTCCGGGCAGTGGGACCGC GGG (reversed) Intronic
900103013 1:970872-970894 GGTGCGGGCAGTGGGCCTGCGGG - Exonic
901011800 1:6206458-6206480 CGCCCGGGCAGAGGGGCCGCGGG + Intronic
901022599 1:6262692-6262714 GGTCCAGGCAGTGGGTCAGCTGG - Intergenic
902221603 1:14969466-14969488 CGTCAGGGCTGTGGGACCGAGGG - Intronic
902375204 1:16027191-16027213 TGTCCGGGCTGTAGGACAGCAGG + Intronic
903296949 1:22350052-22350074 CCTCTGGGCAGTGGGAGGGCAGG + Intergenic
907450373 1:54542351-54542373 CGTCCGGGGAGCGAGTCCGCGGG - Intronic
923783056 1:237042631-237042653 GGTCCGGGCAGAGTGACAGCGGG + Intronic
1067497754 10:46774859-46774881 CGTCCGGGCAGGGCGAGGGCAGG + Intergenic
1067596895 10:47565555-47565577 CGTCCGGGCAGGGCGAGGGCAGG - Intergenic
1070642480 10:78179746-78179768 CTTCCTGGCAGTGTGACCTCGGG - Intergenic
1071328958 10:84541883-84541905 GCTTCGGGCAGTGGGACTGCAGG - Intergenic
1073423900 10:103444677-103444699 CGTCCGGTGAGTGGGGCAGCTGG + Exonic
1076666342 10:132095103-132095125 CTTCCAGGCAGTGGGCCAGCAGG + Intergenic
1077365514 11:2159986-2160008 CGTCCTGGCAGTGGGGCAGGTGG - Exonic
1078175090 11:8964324-8964346 GCTCCGGGCTGTGGGACCGCTGG - Exonic
1079126248 11:17720385-17720407 CGTCGGAGCAGTTGGAGCGCGGG - Exonic
1084881280 11:72173273-72173295 CTTGTGGGCAGTGGCACCGCTGG - Intergenic
1089606674 11:119645353-119645375 CCTCCCAGCAGTGAGACCGCTGG - Intronic
1094565023 12:31591161-31591183 CGCTCGGGCTGTGGGAGCGCGGG + Intergenic
1102969564 12:117155545-117155567 TGTCCGGGCTGTGGGAGCGGAGG + Intronic
1103800195 12:123533128-123533150 CGTCCGGGCAGTGGGACCGCGGG - Intronic
1112580639 13:100674395-100674417 CGCCCGGGCCGAGGGAGCGCCGG + Intronic
1113505226 13:110812136-110812158 CGGCCAGGCAGTGGGGCGGCAGG - Intergenic
1113958208 13:114110745-114110767 GGTCCGGGCTGTGGGGACGCGGG - Intronic
1132544708 16:527881-527903 CGTCCGGGCAGCGCGGCCGGCGG + Exonic
1134070526 16:11256922-11256944 CAGCCGGGTAGTGGGAGCGCAGG - Intronic
1134147009 16:11773300-11773322 CTTCCAAGCAGTGGGACCACAGG + Intronic
1138651739 16:58464670-58464692 CGTCCGGGCTGCGGGAGCACCGG + Intronic
1140097008 16:71883952-71883974 CCTCCGGACAGACGGACCGCCGG + Exonic
1141683328 16:85556459-85556481 GGTCGGGGCATTGGGTCCGCCGG + Intergenic
1141689099 16:85586558-85586580 CGGCCTGGCAGTGGGACAGCTGG - Intergenic
1142169720 16:88615230-88615252 CGTCCGGGCAGAGGGAACGGAGG - Intronic
1147184254 17:38705193-38705215 CGGCCGGGCAGGGGGGCCGGGGG + Intergenic
1152245700 17:79183547-79183569 CGCCCGGGCAGGGGGAACACCGG - Intronic
1152576771 17:81144525-81144547 GGGCCGGGCAGGGGGCCCGCAGG + Intronic
1159898311 18:74018343-74018365 CATCCTGGCAGTAGGACCCCAGG + Intergenic
1160858473 19:1227726-1227748 GGGCCGGGCAGGGGGACAGCAGG + Exonic
1161233979 19:3189000-3189022 CCTCCGGGTAGTGGGCCCGGGGG - Intronic
1161242233 19:3228782-3228804 CGGCCTGGCGGGGGGACCGCGGG + Intronic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162352152 19:10157404-10157426 CATCTGGACAGTGGGGCCGCAGG - Intronic
1165242790 19:34481503-34481525 CGCCCGGGCCGTCGGGCCGCTGG - Intergenic
1167080414 19:47273642-47273664 CGTCACGGCACTGGGACGGCTGG + Intergenic
929590555 2:43143038-43143060 TGTCGGGGCAGTGGGGCCGCAGG - Intergenic
931614661 2:64144064-64144086 TGTCCGGTAAGTGTGACCGCGGG - Exonic
931748864 2:65313773-65313795 CGTCCTGGCAGTGGCCCCGGCGG + Exonic
936438454 2:112529080-112529102 CGGCAGGGCACTGGGACCTCTGG + Exonic
937428755 2:121820865-121820887 CCACCGGGCAGTGGGATCCCAGG + Intergenic
943701104 2:190989032-190989054 CTTCTGGGCAGTGGGAACCCAGG - Intronic
946445591 2:219737447-219737469 CTTCCAGGAAGTGGGACAGCTGG + Intergenic
948980964 2:241494539-241494561 GGTCCTGGCAGTGGGTACGCAGG - Exonic
1174298661 20:49567359-49567381 TGTCCAGGCTGTGGGACCTCAGG + Intronic
1179413761 21:41181669-41181691 GGTCAGGGCAGGGGGACAGCAGG + Intronic
1180891514 22:19291950-19291972 CGTCAGGGCAGAGGGCGCGCGGG - Intergenic
1181494589 22:23280843-23280865 GGGCAGGGCAGTGGGACAGCAGG - Intronic
1182036900 22:27205945-27205967 CGTCTGGGCAATGGGACCATGGG + Intergenic
968481638 4:835615-835637 CTTCCTGGCAGTGGCACAGCCGG - Intergenic
971170234 4:24226226-24226248 CGGCCGGGCTGTGGGATCACAGG + Intergenic
976059880 4:81114778-81114800 AGTCAGGGTAGTGGGACCTCTGG - Intronic
985652480 5:1113342-1113364 CCTCCGGGCTGTGGGATCACCGG + Intergenic
985654112 5:1121141-1121163 CTTGCAGGCAGTGGGACAGCTGG + Intergenic
987108726 5:14664968-14664990 CGGCCGAGCAGTGAGTCCGCGGG + Exonic
1001938534 5:175724684-175724706 CCTCCGAGCAGTGGGATTGCAGG + Intergenic
1002299435 5:178248989-178249011 CGGCTGGGCACTGAGACCGCAGG + Intronic
1003139395 6:3457519-3457541 GGCGCGGGCAGCGGGACCGCCGG - Intergenic
1008382512 6:50850469-50850491 GCTCCGGGCACAGGGACCGCGGG + Intergenic
1011817855 6:91213695-91213717 TGTCCAGGCAGTGGGCCAGCAGG + Intergenic
1019389238 7:776506-776528 CGGCCGGGAAGGGGGACCTCAGG + Intronic
1030399525 7:109031159-109031181 CTACCTGGCAGTGGGACTGCTGG + Intergenic
1032391186 7:131556417-131556439 CGTCCGGGCGGTAGGAGCGTGGG + Exonic
1034179393 7:149126102-149126124 CGTCCAGGGAGTGGGGCGGCCGG - Intronic
1034522533 7:151632020-151632042 CGGCCGGGCCGTGGGAGCGCCGG + Intronic
1037605913 8:20437008-20437030 CGTCCAGGCAGGGGGATTGCTGG - Intergenic
1045173757 8:99698043-99698065 CGCCAGGGCAGTGGGGCAGCAGG - Intronic
1057017538 9:91665842-91665864 TGGCCAGGAAGTGGGACCGCAGG - Intronic
1061280964 9:129597467-129597489 CGTCCGAGCGCTGGGGCCGCTGG + Intergenic
1186519110 X:10189683-10189705 CGGCCAGGCAGTGAGACCCCAGG - Intronic
1189260097 X:39672415-39672437 AGTCCTGGCAGTGGGAACTCAGG - Intergenic