ID: 1103802552

View in Genome Browser
Species Human (GRCh38)
Location 12:123548793-123548815
Sequence TGGTGATCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103802552_1103802560 19 Left 1103802552 12:123548793-123548815 CCATCCACCACTGCTGATCACCA No data
Right 1103802560 12:123548835-123548857 GACTTCCACCCCTCCGGATCTGG 0: 31
1: 87
2: 117
3: 65
4: 76
1103802552_1103802563 24 Left 1103802552 12:123548793-123548815 CCATCCACCACTGCTGATCACCA No data
Right 1103802563 12:123548840-123548862 CCACCCCTCCGGATCTGGCAGGG 0: 13
1: 54
2: 111
3: 168
4: 227
1103802552_1103802559 13 Left 1103802552 12:123548793-123548815 CCATCCACCACTGCTGATCACCA No data
Right 1103802559 12:123548829-123548851 GTCACTGACTTCCACCCCTCCGG No data
1103802552_1103802561 23 Left 1103802552 12:123548793-123548815 CCATCCACCACTGCTGATCACCA No data
Right 1103802561 12:123548839-123548861 TCCACCCCTCCGGATCTGGCAGG 0: 15
1: 49
2: 110
3: 147
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103802552 Original CRISPR TGGTGATCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr