ID: 1103814716

View in Genome Browser
Species Human (GRCh38)
Location 12:123645161-123645183
Sequence TGGCAGGATCGCTTAAGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104712
Summary {0: 2, 1: 262, 2: 5229, 3: 31152, 4: 68067}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103814716_1103814721 8 Left 1103814716 12:123645161-123645183 CCAGGGCTTAAGCGATCCTGCCA 0: 2
1: 262
2: 5229
3: 31152
4: 68067
Right 1103814721 12:123645192-123645214 TTCAGAGTAGCTAAGACTACAGG 0: 2
1: 77
2: 1526
3: 20327
4: 151372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103814716 Original CRISPR TGGCAGGATCGCTTAAGCCC TGG (reversed) Intronic
Too many off-targets to display for this crispr