ID: 1103818613

View in Genome Browser
Species Human (GRCh38)
Location 12:123679085-123679107
Sequence GCTGAATTATCGGCCAGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 335}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103818613_1103818616 16 Left 1103818613 12:123679085-123679107 CCGCGCCTGGCCGATAATTCAGC 0: 1
1: 0
2: 5
3: 29
4: 335
Right 1103818616 12:123679124-123679146 AAAATGTGACTGTGCTTTGTCGG 0: 1
1: 0
2: 1
3: 31
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103818613 Original CRISPR GCTGAATTATCGGCCAGGCG CGG (reversed) Intronic
901239795 1:7686304-7686326 GCTGCTTTATAGGCCAGGAGAGG + Intronic
901356844 1:8657554-8657576 GATGTATTACTGGCCAGGCGTGG + Intronic
901466983 1:9428329-9428351 AATGAAGTATCGGCCAGGCGTGG - Intergenic
902283808 1:15393351-15393373 AATGAATTTTTGGCCAGGCGCGG - Intronic
903240958 1:21982315-21982337 TGTGAATTATTGGCCAGGCACGG + Intronic
903794793 1:25920538-25920560 TCTGGATAACCGGCCAGGCGCGG + Intergenic
904539464 1:31223084-31223106 GCTCCATAAACGGCCAGGCGCGG + Intronic
904735333 1:32628052-32628074 TTTTAATTATAGGCCAGGCGCGG + Intronic
905413642 1:37789915-37789937 GGTCAATTATTGGCCAGGTGTGG - Intergenic
905830973 1:41067152-41067174 AATGAGCTATCGGCCAGGCGTGG + Intronic
906017412 1:42594216-42594238 ACTTAATTATAGGCCAGGTGTGG + Intronic
906634959 1:47403248-47403270 GCTGAATGTGCGGCCAGGCAGGG - Intergenic
907254948 1:53172016-53172038 GATGCATTATGGACCAGGCGTGG - Intergenic
907769481 1:57446305-57446327 ACTAAATTTTAGGCCAGGCGTGG + Intronic
909753558 1:79194558-79194580 AATGAAATATGGGCCAGGCGCGG + Intergenic
910243526 1:85114301-85114323 GATAAATTGTAGGCCAGGCGTGG - Intronic
910564483 1:88627847-88627869 TCTGGAGTATCGGCCAGGCATGG - Intergenic
910887692 1:91983542-91983564 TTTGAATTCTAGGCCAGGCGTGG - Intronic
910937910 1:92501698-92501720 ATGGAATTATTGGCCAGGCGCGG + Intergenic
911753985 1:101531487-101531509 GATTAATTATCGGCCAGACATGG - Intergenic
913146217 1:115992913-115992935 AATGAACTATAGGCCAGGCGCGG - Intronic
913480694 1:119286424-119286446 GCTGAGCTGTAGGCCAGGCGCGG - Intergenic
915378926 1:155423288-155423310 ACTGCATTTTCGGCCAGGCATGG + Intronic
916055604 1:161067280-161067302 CCTGAACAATCGGCCAGGTGCGG + Intronic
916093261 1:161325908-161325930 GCAGAGTTATCGGCCTGGCACGG + Intronic
916217330 1:162408702-162408724 GCTAAAAAATGGGCCAGGCGTGG - Intronic
916768857 1:167888584-167888606 GCTGATTTTTGGGCCGGGCGCGG + Intronic
917654044 1:177108057-177108079 TCCTAATTATCAGCCAGGCGTGG + Intronic
918223415 1:182456586-182456608 GATTACTTCTCGGCCAGGCGTGG - Intronic
919904893 1:202071676-202071698 GAAGAATTATGGGCCGGGCGTGG + Intergenic
920091930 1:203460564-203460586 TATGAATTGTCGGCCGGGCGCGG + Intergenic
920168824 1:204056803-204056825 ATAGAGTTATCGGCCAGGCGAGG + Intergenic
920454675 1:206090495-206090517 GAGGAATTGTGGGCCAGGCGCGG - Intronic
920789676 1:209077832-209077854 GCAGCATTATTGGCCAGGCGCGG - Intergenic
920991873 1:210947277-210947299 GCTCAATTCTTGGCCAGGCGCGG + Intronic
921015744 1:211188908-211188930 GTTCAATTATAGGCCAGGCGTGG - Intergenic
921472946 1:215569407-215569429 TATTAACTATCGGCCAGGCGCGG - Intronic
922946082 1:229515414-229515436 GATGAATTCCCGGCCAGGCATGG - Intergenic
923352052 1:233117718-233117740 GAAGAATTATAGGCCAGGCGCGG + Intronic
923489445 1:234470904-234470926 GCACAATTTTGGGCCAGGCGTGG - Intronic
923552959 1:234978776-234978798 GCTGAATTATCTGCAGTGCGTGG - Intergenic
923625642 1:235611771-235611793 GATGAAGTATTGGCCAGGTGTGG + Intronic
924006450 1:239617432-239617454 GGTGAATTTTTGGCCAGGCGTGG + Intronic
924238274 1:242017259-242017281 TTTGAATTATAGGCCAGGCACGG + Intergenic
924583006 1:245337470-245337492 GCTAAATGAATGGCCAGGCGTGG - Intronic
1063926605 10:10983853-10983875 ACAGATATATCGGCCAGGCGTGG - Intergenic
1064472228 10:15647750-15647772 ACTGAATAATTGGCCGGGCGCGG - Intronic
1065040713 10:21692458-21692480 GCAGAACAATAGGCCAGGCGCGG - Intronic
1065403077 10:25329144-25329166 GATGCATTTTAGGCCAGGCGCGG + Intronic
1065883184 10:30054957-30054979 GATGCATTTTCGGCCGGGCGCGG - Intronic
1066328727 10:34394123-34394145 GCTGAGGCATAGGCCAGGCGCGG - Intronic
1066479005 10:35777423-35777445 GCTAAAGTATGGGCCCGGCGTGG + Intergenic
1066599035 10:37084289-37084311 GCTGTCCTTTCGGCCAGGCGCGG + Intergenic
1066602266 10:37122288-37122310 ATTGTATTATTGGCCAGGCGCGG - Intergenic
1069042363 10:63709139-63709161 TGTGAATTAAGGGCCAGGCGTGG + Intergenic
1070213974 10:74356306-74356328 TATGAATTATTGGCCGGGCGCGG - Intronic
1074057190 10:109933392-109933414 GAAGAAATTTCGGCCAGGCGCGG + Intergenic
1074812632 10:117121285-117121307 TCTAAATTTTGGGCCAGGCGTGG + Intronic
1075775196 10:124978906-124978928 GAAGAATTATCGGCCGGGCCTGG + Intronic
1076504585 10:130963365-130963387 GATGAATTGTCGGCAGGGCGCGG + Intergenic
1077507470 11:2937306-2937328 CCTGAAAAATTGGCCAGGCGTGG + Intergenic
1078245189 11:9567838-9567860 ACTGAACAATTGGCCAGGCGCGG + Intergenic
1079184908 11:18227968-18227990 TCTAAATAATCGGCCAGCCGCGG + Intronic
1080172772 11:29325715-29325737 AATAAATTACCGGCCAGGCGTGG - Intergenic
1081972746 11:47211274-47211296 GCTGAGATCACGGCCAGGCGTGG - Intergenic
1083182191 11:60994148-60994170 GCTGAATTTCTGGCCGGGCGCGG + Intronic
1085092837 11:73733256-73733278 GCTGTATTTTAGGCCAGGCGCGG + Intronic
1091256887 11:134196351-134196373 ACTAAATTAGTGGCCAGGCGCGG + Intronic
1091350166 11:134887482-134887504 ACTGAAATGACGGCCAGGCGCGG - Intergenic
1091878020 12:3952629-3952651 AAAGAATTATCGGCCGGGCGCGG - Intergenic
1093716583 12:22390231-22390253 ACATAATTAACGGCCAGGCGTGG + Intronic
1095555712 12:43501348-43501370 GATGAATTACTGGCCAGGTGTGG - Intronic
1096483913 12:51963526-51963548 TATGAAATGTCGGCCAGGCGTGG - Intronic
1096927064 12:55159921-55159943 AATGAATTAAAGGCCAGGCGTGG + Intergenic
1097155004 12:57006231-57006253 GCTGAATAAGGGGCCAAGCGAGG + Intronic
1098190736 12:67945720-67945742 GCTGGATTTTTGGCCGGGCGCGG - Intergenic
1098579305 12:72080092-72080114 AAAGAATTATTGGCCAGGCGCGG + Intronic
1099634907 12:85201119-85201141 GCTAAACCATCGGCCAGGCGTGG - Intronic
1102094858 12:110230022-110230044 GCTGCATTACAGGCCGGGCGCGG + Intergenic
1102249581 12:111377182-111377204 GCTGTAATATGGGCCAGGTGTGG + Intergenic
1103628873 12:122242842-122242864 CTTAAAATATCGGCCAGGCGTGG - Intronic
1103818613 12:123679085-123679107 GCTGAATTATCGGCCAGGCGCGG - Intronic
1104202180 12:126600365-126600387 ATTCAATTAACGGCCAGGCGTGG + Intergenic
1106453385 13:29905039-29905061 TATGAATTATCAGCCAGGGGCGG - Intergenic
1107716938 13:43209448-43209470 GCTGAATAATAGGCCAGGCACGG - Intergenic
1109213773 13:59564408-59564430 GCTACATAATCGGCCGGGCGCGG - Intergenic
1110435632 13:75474925-75474947 GTTAAATTATGGGCCGGGCGTGG - Intronic
1110594387 13:77303042-77303064 CATGATTAATCGGCCAGGCGCGG + Intronic
1110859668 13:80334075-80334097 ACTGAATTAGAGGCCGGGCGCGG + Intergenic
1111851028 13:93575001-93575023 GGTGAATTGTTGGCCAGGCACGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114292874 14:21303156-21303178 AAGGAATTATGGGCCAGGCGTGG - Intronic
1114641084 14:24221568-24221590 TTTGTATTATCGGCCAGGCACGG - Intronic
1119040691 14:71271758-71271780 AATGAATTATGGGCCGGGCGTGG + Intergenic
1119080298 14:71686696-71686718 GTTGACTTCTAGGCCAGGCGTGG - Intronic
1119797052 14:77408156-77408178 GGTGAATTATAGGCCAGGCGTGG - Intronic
1120452376 14:84684526-84684548 TAAGAATTATAGGCCAGGCGAGG + Intergenic
1122528752 14:102409587-102409609 GCTGAATTCTTGGCTGGGCGTGG - Intronic
1124472791 15:30003094-30003116 GCAAAATTTTCGGCCGGGCGTGG - Intergenic
1128341951 15:66828600-66828622 TATAAATTATAGGCCAGGCGCGG + Intergenic
1129337515 15:74861961-74861983 ACTAAATTATGGGCCAGGCCCGG + Intronic
1129503860 15:76064611-76064633 TCTGAATTACCCGCCAGGAGAGG + Intronic
1129878285 15:78991308-78991330 GCTGATTTAGGGGACAGGCGTGG - Intronic
1130299676 15:82670398-82670420 AATGAATTCACGGCCAGGCGTGG - Intronic
1130405576 15:83597896-83597918 GCATAATTAAGGGCCAGGCGTGG - Intronic
1131813024 15:96192657-96192679 ACTGAATAATAGGCCGGGCGCGG - Intergenic
1132522027 16:395888-395910 GCTCAATTGTTGGCCAGGCGTGG + Intergenic
1133535914 16:6702261-6702283 TCCAAATTATCGGCCAGCCGTGG + Intronic
1133664839 16:7956379-7956401 GATTAATTACTGGCCAGGCGCGG - Intergenic
1134741247 16:16548834-16548856 AATAAATTATCGGCCGGGCGCGG - Intergenic
1135004167 16:18803144-18803166 GATGAAAAATCGGCCGGGCGCGG - Intergenic
1135560220 16:23470470-23470492 AGAGAATTATCAGCCAGGCGTGG + Intronic
1135879017 16:26235044-26235066 TTTGAATTTTTGGCCAGGCGTGG - Intergenic
1135898117 16:26429080-26429102 GGTAAATTATCGGCCAGATGCGG + Intergenic
1135989825 16:27211274-27211296 GCTGAAGTCTCACCCAGGCGAGG + Intronic
1137621303 16:49878133-49878155 GCTGACTTACTGGCCAGGGGTGG - Intergenic
1138402197 16:56755583-56755605 ACTGAATTGTAGGCCAGGCATGG + Intronic
1138837526 16:60456889-60456911 TGTGTATTATCGGCCGGGCGCGG + Intergenic
1142927557 17:3253917-3253939 GATCAAATATCGGCCGGGCGCGG - Intergenic
1142961198 17:3553474-3553496 GCTGAAGTACCGGCCAGTAGAGG - Intronic
1143097375 17:4485684-4485706 GATGAACTCTGGGCCAGGCGCGG - Intronic
1144539404 17:16125071-16125093 TCTAAAATTTCGGCCAGGCGTGG + Intronic
1144547474 17:16211019-16211041 ACTTAAAAATCGGCCAGGCGCGG - Intronic
1146034336 17:29391924-29391946 GAAGAATTATTGGCCTGGCGCGG + Intronic
1148418379 17:47525918-47525940 ACACAATTATAGGCCAGGCGCGG + Intronic
1149652998 17:58289390-58289412 AGTGAATTTTCGGCCAGGCATGG + Intergenic
1149701890 17:58662129-58662151 ACTGAGTTTTAGGCCAGGCGTGG - Intronic
1149834611 17:59901437-59901459 GATGGAGTCTCGGCCAGGCGCGG - Intronic
1149917281 17:60621895-60621917 AAAAAATTATCGGCCAGGCGTGG + Intronic
1149968611 17:61193465-61193487 ACTGAATTTTTGGCCAGGTGCGG + Intronic
1151331268 17:73410605-73410627 GCAGCATTATCGGCCGGGGGTGG - Intronic
1152187473 17:78866968-78866990 ACTGAATTGTAGGCCGGGCGCGG + Intronic
1152719908 17:81918377-81918399 GCTAAATTATTGTCCAGGAGGGG - Exonic
1153156497 18:2155665-2155687 GTAAAATTCTCGGCCAGGCGCGG + Intergenic
1154010651 18:10571440-10571462 ACAAAATTAACGGCCAGGCGCGG - Intergenic
1155125983 18:22876127-22876149 ACTTAATTCTTGGCCAGGCGCGG + Intronic
1155147597 18:23096978-23097000 GATGAATAATAGGCCAGGCGCGG + Intergenic
1155195693 18:23471940-23471962 TGGGAGTTATCGGCCAGGCGCGG + Intronic
1155343847 18:24839242-24839264 TCTGTATTATCGGCCAGGCGTGG + Intergenic
1155487767 18:26365295-26365317 ACAGAATTATAGGCCAGGTGCGG - Intronic
1156214911 18:34987931-34987953 GTTGACTTATAGGCCAGGTGCGG - Intronic
1156377344 18:36526691-36526713 GCTGAATTATGGGCCAGGCATGG - Intronic
1159969267 18:74628868-74628890 AATGAAGTATCGGCCAGGCACGG - Intronic
1160079290 18:75708044-75708066 ATTGAATTAGTGGCCAGGCGCGG + Intergenic
1160767530 19:815089-815111 GCGGAAGGCTCGGCCAGGCGGGG + Intronic
1161095632 19:2388912-2388934 ACCGAGTTTTCGGCCAGGCGTGG - Intergenic
1161116502 19:2499901-2499923 GAAGAATTCTCAGCCAGGCGCGG - Intergenic
1161239812 19:3216054-3216076 GCTTAATTTGCGGCCGGGCGCGG - Intergenic
1162518624 19:11165842-11165864 GAGAAATTACCGGCCAGGCGTGG - Intronic
1162603918 19:11692651-11692673 GCTGTTTTCTGGGCCAGGCGCGG - Intergenic
1163429272 19:17257319-17257341 GACGGATTCTCGGCCAGGCGCGG - Intronic
1163605487 19:18272898-18272920 GCACAATGCTCGGCCAGGCGCGG - Intronic
1165521517 19:36317940-36317962 AATTAATTATAGGCCAGGCGCGG + Intergenic
1165719393 19:38068317-38068339 TCTGATTTTTCGGCCGGGCGTGG - Intronic
1166362621 19:42260580-42260602 GGTGAAATATTGGCCAGGTGCGG + Intergenic
1166691614 19:44824853-44824875 ACCAAATTATCGGCCAGGCACGG - Intergenic
1166816063 19:45546957-45546979 GCAGAGTTTTAGGCCAGGCGCGG - Intronic
1167129485 19:47574552-47574574 ACTGAGCTATGGGCCAGGCGTGG + Intergenic
1167179675 19:47893173-47893195 ACTAGATTATAGGCCAGGCGCGG + Intergenic
1168167039 19:54555846-54555868 GCTAAATTATCTGCCAGGAGGGG - Intergenic
1168702183 19:58447266-58447288 CCTGCATTGTCGGCCAGGCATGG - Intergenic
926277920 2:11419376-11419398 GCTGATGTATCAGCCAGGCACGG + Intergenic
927158103 2:20233623-20233645 TCTGACTTTTCGGCCAGGTGTGG + Intergenic
927539373 2:23894189-23894211 TATGAAATATCGGCCAGGCACGG + Intronic
928530239 2:32183388-32183410 GATGGCTTTTCGGCCAGGCGCGG + Intronic
929443286 2:41982947-41982969 TCTGACTTCTGGGCCAGGCGTGG + Intergenic
929721979 2:44378780-44378802 ACTTAATTCTAGGCCAGGCGCGG - Intronic
930623681 2:53671467-53671489 ACTGTATGATAGGCCAGGCGCGG + Intronic
930647070 2:53921880-53921902 ACTGAAGTTTGGGCCAGGCGCGG + Intronic
930653792 2:53988714-53988736 ATTGAATTATGGGCCAGGCATGG - Intronic
930653841 2:53989036-53989058 ACTGAATTACAGGCCGGGCGTGG - Intronic
932145462 2:69312008-69312030 GATGATGTTTCGGCCAGGCGTGG + Intergenic
933014767 2:77111415-77111437 AGGGAATTATTGGCCAGGCGCGG - Intronic
935055979 2:99567268-99567290 GTTGCATTATAGGCCAGGCACGG - Intronic
935343726 2:102083653-102083675 GTGGAAATATCGGCCAGGTGTGG + Intronic
935523879 2:104142671-104142693 GTTGAGATATCGGCCGGGCGCGG + Intergenic
936102138 2:109591604-109591626 ACTGAATTACTGGCCAGGTGTGG + Intronic
938002675 2:127756789-127756811 TCTGAATCTTCGGCCAGGCATGG + Intronic
938821277 2:134962627-134962649 GCTGAAGTTTTGGCCAGGCAGGG - Intergenic
939725610 2:145717922-145717944 AATGATTTATTGGCCAGGCGCGG + Intergenic
941814198 2:169784333-169784355 GGTGTATCATGGGCCAGGCGCGG + Intergenic
944087684 2:195868372-195868394 GATGAATAATAGGCCAGGCGTGG - Intronic
944657326 2:201889104-201889126 GCAGAAGTTTAGGCCAGGCGAGG + Intronic
944854254 2:203751379-203751401 ACTGAAAAATAGGCCAGGCGTGG - Intergenic
945706831 2:213245813-213245835 TTTGAAATCTCGGCCAGGCGTGG + Intergenic
945746166 2:213721387-213721409 TTGGAATTATAGGCCAGGCGCGG - Intronic
945924909 2:215793454-215793476 AATAAATTCTCGGCCAGGCGCGG - Intergenic
946953141 2:224898863-224898885 GCTCAATTATCAGCCCGGTGCGG - Intronic
947631148 2:231653966-231653988 ACTGGAATATAGGCCAGGCGTGG + Intergenic
949012333 2:241687812-241687834 ACGGACTTTTCGGCCAGGCGCGG - Intergenic
949078031 2:242073761-242073783 GAGGAAAAATCGGCCAGGCGCGG + Intergenic
1170174937 20:13458629-13458651 GCTTAACTATGGGCCAGGAGTGG - Intronic
1170342916 20:15349464-15349486 GGAAAATTATGGGCCAGGCGTGG + Intronic
1172353448 20:34261820-34261842 AATAAATAATCGGCCAGGCGCGG + Intronic
1172641285 20:36441905-36441927 GCTTATTAATCGGCCAGGCTGGG + Intronic
1173210265 20:41026943-41026965 GGTGCCTTATAGGCCAGGCGCGG - Intergenic
1174093593 20:48069461-48069483 GTTGAAGTACCGGCCAGACGCGG - Intergenic
1175126473 20:56755874-56755896 GCTGAGTAATGGGCCAGGCACGG - Intergenic
1176929292 21:14789052-14789074 GTTTTATTTTCGGCCAGGCGCGG + Intergenic
1177496758 21:21901124-21901146 GCTAAATTTTCAGCCAGGCACGG + Intergenic
1178318818 21:31589377-31589399 ACTGATTTATGGGCCAGGCATGG + Intergenic
1181958763 22:26607845-26607867 GCTGGAGAATCAGCCAGGCGGGG - Intronic
1182894240 22:33845596-33845618 GGTCCATTATAGGCCAGGCGTGG - Intronic
1183568496 22:38633926-38633948 ATTGAATTATTGGCCAGGTGTGG + Intronic
1183998255 22:41652654-41652676 AGTGAATTATTGGCCAGGTGAGG - Intronic
1184598890 22:45531052-45531074 GATCAATTATAGGCCAGGCGTGG - Intronic
1185262603 22:49877581-49877603 GCTGTTTTTTAGGCCAGGCGTGG - Intronic
1185300170 22:50075419-50075441 GCTGAATTCCCAGCCAGGCACGG + Intronic
949183271 3:1160107-1160129 ACTGAATGATTGGCCGGGCGTGG - Intronic
950065898 3:10111528-10111550 GAAGAACTATCGGCCAGGCACGG + Intergenic
950246741 3:11427525-11427547 AATAAATTATCGGCCGGGCGAGG + Intronic
950384486 3:12647004-12647026 TCTTCATTACCGGCCAGGCGTGG + Intronic
950387477 3:12671575-12671597 GCTGATCTATAGGCCAGGTGTGG + Intergenic
950650043 3:14401633-14401655 GAAGAAATACCGGCCAGGCGCGG - Intergenic
950840227 3:15961246-15961268 ATTGAATTGTCGGCCAGGCACGG - Intergenic
950867591 3:16201469-16201491 GACGAATTTTCGGCCAGGCGCGG - Intronic
951210973 3:19974441-19974463 GTAGCATTATAGGCCAGGCGTGG - Intronic
951240544 3:20281338-20281360 TCTCAACTATCGGCCAGGCACGG - Intergenic
951860417 3:27245572-27245594 GCTGAATTATTGGCTTGGCTGGG - Intronic
952375805 3:32766340-32766362 TGTGAATTATAGGCCAGGCACGG + Intronic
954616607 3:51971952-51971974 GAAAAATTATCGGCCAGGCATGG + Intronic
956216579 3:66855483-66855505 GCTGAGCTCTCGGCCAGGCGCGG - Intergenic
956957459 3:74357214-74357236 TTTGAATAATCGGCCAGGCACGG - Intronic
957605126 3:82389027-82389049 ATTGAATCAACGGCCAGGCGCGG + Intergenic
959095613 3:101952309-101952331 CATGAAATAACGGCCAGGCGCGG + Intergenic
963193082 3:142495452-142495474 TCTGGGTTATTGGCCAGGCGCGG + Intronic
963321981 3:143818789-143818811 ACTGGAGGATCGGCCAGGCGCGG + Intronic
964316171 3:155446323-155446345 GCTGGATTATAGGCCTGGCCTGG + Intronic
965754156 3:172008255-172008277 ACCAAATTATGGGCCAGGCGTGG + Intergenic
965970947 3:174555588-174555610 ACTGAATTTTTGGCCAGGCGCGG - Intronic
967145636 3:186603745-186603767 TCTCATTTATCGGCCAGGCGCGG + Intergenic
967722991 3:192835096-192835118 TGTGAACAATCGGCCAGGCGTGG - Intronic
969367050 4:6702009-6702031 TCAGAATTGTTGGCCAGGCGTGG - Intergenic
969933263 4:10654810-10654832 AATGATTTCTCGGCCAGGCGTGG + Intronic
970602167 4:17649292-17649314 GATGAAAAATTGGCCAGGCGTGG + Intronic
970839054 4:20445126-20445148 TCTGAATTAATGGCCAGGAGAGG - Intronic
971849386 4:31964202-31964224 GCTGTAAAATAGGCCAGGCGCGG + Intergenic
972583218 4:40413690-40413712 GATGAATTCTGGGTCAGGCGCGG + Intergenic
972605260 4:40607812-40607834 GGCGAATTTTCAGCCAGGCGCGG + Intronic
972697110 4:41458484-41458506 GATGGATTGTGGGCCAGGCGTGG + Intronic
973609971 4:52626611-52626633 GTTGAAGTATGGGCCAGGCGCGG - Intronic
973760953 4:54115095-54115117 GGTTAATTATGGGCTAGGCGTGG - Intronic
973815572 4:54616259-54616281 GCTTATTTACCGGCCGGGCGCGG + Intergenic
975327801 4:73079822-73079844 GCTTAAATATTGGCCGGGCGCGG + Intronic
976995311 4:91424305-91424327 GCTGAGTTCTTGGCCGGGCGCGG - Intronic
977429162 4:96909556-96909578 TATGAATTATTGGCCGGGCGCGG - Intergenic
977958352 4:103056092-103056114 TCTGCATTATAGGCCAGGTGCGG - Intronic
978629962 4:110732745-110732767 AGTGAATTGTTGGCCAGGCGCGG - Intergenic
978733267 4:112056226-112056248 AATGAATTCTGGGCCAGGCGTGG - Intergenic
978978321 4:114909368-114909390 GCTAAATTATTGGCCGGGCGCGG + Intronic
980736311 4:136894062-136894084 GCTGAATTACCTGGCAGGTGAGG - Intergenic
982037910 4:151364652-151364674 GATGAATTATAGGCCAGGCGCGG + Intergenic
983378419 4:166959322-166959344 ATTGAATTCTCGGCCAGGCGTGG + Intronic
984138723 4:175974972-175974994 GCTGATGTATAGGCCAGGTGCGG - Intronic
984231972 4:177111010-177111032 AGTCAATTATCAGCCAGGCGTGG - Intergenic
984919293 4:184749815-184749837 ACAGAAGTACCGGCCAGGCGCGG + Intergenic
985259314 4:188100430-188100452 GGTGAATTCTAGGCCGGGCGCGG + Intronic
985272130 4:188203614-188203636 GCAGAATTATGGGCCGGGCGCGG - Intergenic
986160165 5:5220446-5220468 GTTAAATTATTGGCCGGGCGCGG - Intronic
989082383 5:37637049-37637071 GAAGAATTTTAGGCCAGGCGTGG + Intronic
992146506 5:73855439-73855461 GTTGAAGTATCGGCTGGGCGTGG + Intronic
992395420 5:76364951-76364973 GCTTGATTCTTGGCCAGGCGTGG - Intergenic
995043971 5:107622729-107622751 GTTGAATACTCGGCCGGGCGCGG + Intronic
995294205 5:110499999-110500021 GTTTAATTATTGGCCAGGCGCGG + Intronic
996980445 5:129486079-129486101 ATTCAATTATAGGCCAGGCGCGG - Intronic
997446533 5:133944282-133944304 GCATGATTATCGGCCAGGCGCGG - Intergenic
997561774 5:134852228-134852250 ACTAGATTATTGGCCAGGCGCGG - Intronic
998843159 5:146277821-146277843 GAAAAATTATTGGCCAGGCGCGG - Intronic
998890993 5:146745664-146745686 GATAAATTGTCGGCCAGGTGTGG + Intronic
999294757 5:150452106-150452128 GTACTATTATCGGCCAGGCGCGG - Intergenic
1000026054 5:157360231-157360253 GCTGAATTCTGGGCTATGCGGGG - Intronic
1001478136 5:172065513-172065535 TATGCATTCTCGGCCAGGCGCGG - Intronic
1001974969 5:175990877-175990899 GCAAAAATATTGGCCAGGCGTGG - Intronic
1002242465 5:177852898-177852920 GCAAAAATATTGGCCAGGCGTGG + Intergenic
1002620198 5:180482757-180482779 CCTGAAATATGGGCCAGGTGCGG - Intergenic
1003353544 6:5343500-5343522 ACTGAAATGTAGGCCAGGCGCGG - Intronic
1003553943 6:7123450-7123472 GTTCAACTTTCGGCCAGGCGTGG - Intronic
1004219384 6:13732644-13732666 TGTTAAATATCGGCCAGGCGCGG + Intergenic
1004223416 6:13766195-13766217 GCTGAATTCACGGCCATGAGGGG - Intergenic
1004362061 6:14979892-14979914 TGTGAATTGTGGGCCAGGCGCGG - Intergenic
1004383940 6:15155921-15155943 ACAGAAATATGGGCCAGGCGCGG - Intergenic
1006484578 6:34328179-34328201 GCTGGATTCTTGGCCGGGCGTGG - Intronic
1006879922 6:37330524-37330546 GTTAAAATATAGGCCAGGCGCGG - Intronic
1007458539 6:41999492-41999514 GAATAATTATCGGCCAGGCACGG - Intronic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1007653907 6:43440470-43440492 AATGAATGATTGGCCAGGCGTGG + Intronic
1009772788 6:68164374-68164396 GATGAATGATAGGCCGGGCGCGG - Intergenic
1010003456 6:70971107-70971129 ACTGAAGTGTAGGCCAGGCGTGG - Intergenic
1010083951 6:71894152-71894174 GAGGTATTATCAGCCAGGCGTGG + Intronic
1010200281 6:73275900-73275922 GCTGATTGACGGGCCAGGCGCGG + Intronic
1012936292 6:105371212-105371234 AGTTAAGTATCGGCCAGGCGTGG + Intronic
1013448384 6:110254342-110254364 ATTGAATTATCAACCAGGCGTGG + Intronic
1015102474 6:129497523-129497545 GCTAAATTCTGGGCCAGGCGTGG - Intronic
1015656244 6:135522392-135522414 GCTTTATTCTTGGCCAGGCGTGG - Intergenic
1017153071 6:151298501-151298523 AATGAATTCTTGGCCAGGCGAGG + Intronic
1017375954 6:153767984-153768006 TCTGAAATGTCGGCCAGGAGCGG - Intergenic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1017689180 6:156946064-156946086 GAAGAATAATGGGCCAGGCGTGG + Intronic
1018753596 6:166829299-166829321 AATGAATTATCGGCCGGGCGCGG + Intronic
1019375557 7:689969-689991 ACTGTGTTCTCGGCCAGGCGCGG - Intronic
1019983709 7:4640290-4640312 GCTGGATTACAGGCCACGCGAGG - Intergenic
1021315068 7:19138222-19138244 CCTGAAATATCGGCCGGGCATGG - Intergenic
1024896116 7:54264152-54264174 GATTAAAAATCGGCCAGGCGCGG + Intergenic
1025145706 7:56500821-56500843 ATTGAAGTATCGGCCGGGCGCGG - Intergenic
1026826829 7:73587706-73587728 CCAGAATTCTCGGCCAGGCTCGG - Intergenic
1027024924 7:74844299-74844321 AAAGAATTTTCGGCCAGGCGTGG - Intronic
1027062840 7:75099820-75099842 AAAGAATTTTCGGCCAGGCGTGG + Intronic
1027651337 7:80872511-80872533 GCTGAATTCTCGGCCGGGCGTGG + Intronic
1027673134 7:81127004-81127026 GAGGAACTCTCGGCCAGGCGTGG - Intergenic
1028545281 7:91992371-91992393 ACTCAATTGTAGGCCAGGCGTGG + Intronic
1029455210 7:100666709-100666731 ACTCAAATAACGGCCAGGCGCGG + Intergenic
1029859362 7:103552788-103552810 GTTCTATTATCAGCCAGGCGTGG - Intronic
1031337561 7:120554696-120554718 TGTAAATTCTCGGCCAGGCGCGG - Intronic
1032575551 7:133050054-133050076 GCAGAATGAAGGGCCAGGCGTGG + Intronic
1032827219 7:135582748-135582770 TCTGCATTATCAGCCAGGTGTGG - Intronic
1033960176 7:146904759-146904781 GATGAATTCTCGGCCGGACGCGG - Intronic
1034171481 7:149066201-149066223 ACTGTGTTATCGGCCGGGCGCGG + Intergenic
1034719549 7:153277913-153277935 ATTGAATTATAGGCCAGGCGCGG + Intergenic
1034817094 7:154182040-154182062 GATGCATTTTCGGCCAGGCACGG - Intronic
1037711525 8:21359110-21359132 GCTGAAGAAGCGGCCAGTCGTGG - Intergenic
1037781430 8:21871893-21871915 GATAACTTCTCGGCCAGGCGCGG + Intergenic
1037866326 8:22446531-22446553 GCTAATTTTTAGGCCAGGCGTGG + Intronic
1041036656 8:53798233-53798255 CCTCAGTTATCGGCCAGGCAAGG + Intronic
1041633169 8:60111043-60111065 GCATAATTATAGGCCGGGCGTGG - Intergenic
1042599317 8:70482377-70482399 TCATAATTATAGGCCAGGCGCGG - Intergenic
1042916881 8:73884148-73884170 GCTGGATTTTAGGCCAGGCATGG + Intergenic
1043525006 8:81087052-81087074 GCTGTAGAAGCGGCCAGGCGTGG + Intronic
1043889440 8:85640315-85640337 CCTCAATTATCTGCCAGGCTTGG - Intergenic
1044323555 8:90833870-90833892 TCAGAATTCTCAGCCAGGCGTGG + Intronic
1046503403 8:115107984-115108006 GCTGAATTTTAGGCCAGGCACGG + Intergenic
1047239676 8:123074308-123074330 ACTGATTTGTCGGCCAGGCGCGG - Intronic
1047598305 8:126401060-126401082 CATGAATTTTTGGCCAGGCGCGG + Intergenic
1048921685 8:139237218-139237240 AAAGAATTATAGGCCAGGCGTGG - Intergenic
1051586982 9:18737026-18737048 GGTGAAGTACAGGCCAGGCGTGG + Intronic
1052806844 9:33020837-33020859 ATTGAGTTATTGGCCAGGCGTGG + Intronic
1052962897 9:34316059-34316081 GTTCCATTATCGGCCGGGCGTGG + Intronic
1053586395 9:39463565-39463587 TCAGAATTTTTGGCCAGGCGCGG - Intergenic
1054715348 9:68551858-68551880 ATTGCATTATGGGCCAGGCGTGG - Intergenic
1054788547 9:69233480-69233502 ACAGAACTATGGGCCAGGCGTGG + Intronic
1055444390 9:76368251-76368273 GTTGTATTAGTGGCCAGGCGCGG - Intergenic
1056440625 9:86617655-86617677 GCTTAATAATGGCCCAGGCGTGG + Intergenic
1056447047 9:86676260-86676282 GCTGAATTAATGGCTAAGCGAGG + Intergenic
1057150048 9:92788456-92788478 AAAGAATTATAGGCCAGGCGTGG + Intergenic
1057610569 9:96539477-96539499 TCTGAATTTTCAGCCAGGGGTGG - Intronic
1057641043 9:96821952-96821974 AGTGAACTATTGGCCAGGCGCGG - Intronic
1058339598 9:103878219-103878241 TCAGAATTATTGGCCGGGCGCGG - Intergenic
1058368986 9:104242501-104242523 GATAAAATATCGGCCGGGCGCGG - Intergenic
1060770600 9:126329071-126329093 ACTAAATAATAGGCCAGGCGTGG - Intronic
1061109686 9:128560023-128560045 TCAAAATTATCGGCCAGGCAGGG - Intronic
1185774531 X:2791990-2792012 GCTGTTTTAGAGGCCAGGCGTGG + Intronic
1186892306 X:13971252-13971274 AGTGAATTTTTGGCCAGGCGCGG + Intergenic
1187512001 X:19928290-19928312 TAAGAGTTATCGGCCAGGCGTGG + Intronic
1189762690 X:44338898-44338920 GCAGAAAGAGCGGCCAGGCGCGG + Intronic
1189842922 X:45100974-45100996 ACTGAAATATTGGCCAGGCATGG - Intronic
1190561354 X:51688626-51688648 TATAAATTATAGGCCAGGCGCGG - Intergenic
1190562937 X:51704691-51704713 TATAAATTATAGGCCAGGCGCGG + Intergenic
1190849112 X:54221541-54221563 ACTGAACTAGAGGCCAGGCGAGG + Intronic
1192586720 X:72325010-72325032 GCTGAATCTTGGGCCAGGCATGG - Intergenic
1193868717 X:86769869-86769891 GTGCAATTATAGGCCAGGCGTGG + Intronic
1194701095 X:97115243-97115265 GATGCAGTATTGGCCAGGCGCGG + Intronic
1196118197 X:112019723-112019745 GCGGAGTTATTGGCCAGGCACGG - Intronic
1196287726 X:113901490-113901512 GATTAATTATAGGCCAGGTGTGG - Intergenic
1196674687 X:118407208-118407230 AGTGACTTATCGGCCAGGTGCGG + Intronic
1196854882 X:119973444-119973466 GCTTAATTGTGGGCCGGGCGGGG - Intergenic
1197194441 X:123683888-123683910 ACTGTCTTATGGGCCAGGCGTGG - Intronic
1198374348 X:136023099-136023121 GGAGTATTATAGGCCAGGCGTGG - Intronic
1198522699 X:137468949-137468971 ACTGGATTATCGGCCGGGTGAGG - Intergenic
1199042083 X:143126106-143126128 GGGGCATTATGGGCCAGGCGCGG - Intergenic
1200112320 X:153747390-153747412 GAAGTATTAGCGGCCAGGCGCGG + Intergenic
1202193938 Y:22276204-22276226 GCTGAATATTCAGCCGGGCGTGG + Intergenic