ID: 1103821786

View in Genome Browser
Species Human (GRCh38)
Location 12:123704545-123704567
Sequence TGATCCAGGTGCAGACCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103821786 Original CRISPR TGATCCAGGTGCAGACCCGC TGG Exonic