ID: 1103821786

View in Genome Browser
Species Human (GRCh38)
Location 12:123704545-123704567
Sequence TGATCCAGGTGCAGACCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103821786 Original CRISPR TGATCCAGGTGCAGACCCGC TGG Exonic
900735528 1:4297364-4297386 TGATCCATAGGCAGACCCTCAGG + Intergenic
901163117 1:7195533-7195555 TGATGCAGGTGGATACCAGCAGG + Intronic
901318857 1:8327054-8327076 TGATCCAGCTGAGGCCCCGCAGG - Intronic
901805561 1:11736410-11736432 TGATCCAGGCACAGGCCAGCAGG + Intronic
902956235 1:19925732-19925754 TGCTACAGGTGTAGACCTGCAGG - Intergenic
902984913 1:20149351-20149373 TGTTCCAGGTGCAGGCCAGGAGG - Exonic
904402804 1:30267764-30267786 TGAACCAGGTGGAGACACGTGGG + Intergenic
906052843 1:42888645-42888667 TCATCCAAGAGCAGAGCCGCTGG - Intergenic
906544232 1:46610160-46610182 GGATCTTGGTGCAGACCTGCTGG + Exonic
913975128 1:143449868-143449890 TCGCCCAGGTGCAGATCCGCAGG - Intergenic
914069520 1:144275484-144275506 TCGCCCAGGTGCAGATCCGCAGG - Intergenic
914109635 1:144690870-144690892 TCGCCCAGGTGCAGATCCGCAGG + Intergenic
914509322 1:148317564-148317586 TGATCACGTTGCACACCCGCGGG + Intergenic
915076319 1:153310811-153310833 TGAGCCAGGTGCTGGCCCTCAGG - Intergenic
915338231 1:155160622-155160644 TGATCCTGGTGCTGCCCCTCAGG + Intergenic
916548903 1:165830976-165830998 TTATCCAGGTGCAGTGCTGCAGG + Intronic
916991640 1:170251025-170251047 TGCTCCAAGTGCAGGGCCGCGGG + Intergenic
918983577 1:191595437-191595459 TGGTCCAGCTGCAGACTCACAGG - Intergenic
919879771 1:201893836-201893858 TGATCCAGGGGCAGACATGTGGG - Intergenic
920052031 1:203170179-203170201 TGTTCCAGGGGCAGACGCCCAGG + Intronic
920270746 1:204761920-204761942 TCATCCAGTTGGAGACCCTCTGG + Intergenic
1071416739 10:85448695-85448717 TGACCCAGGTACAGATCCTCTGG + Intergenic
1074870495 10:117572157-117572179 TGATTCAGTTGCAGACCCCATGG + Intergenic
1076482458 10:130793420-130793442 TGGTTCAGGTGCTGACACGCGGG - Intergenic
1083261282 11:61524393-61524415 TGACCCAGATGCAGACCTTCTGG - Exonic
1084065372 11:66700958-66700980 TGAGAGAGGTGCAGACCGGCTGG - Exonic
1087210952 11:95446215-95446237 TGGTCCAGCTGCAGCCTCGCAGG - Intergenic
1090077751 11:123590245-123590267 TGATCCAGTTTCAGACACGCTGG - Intronic
1091297974 11:134487013-134487035 TGATCGAGGAGCAGCCCCACAGG - Intergenic
1102016456 12:109651048-109651070 TGAAGCAGGTGCAGACCCTGGGG - Intergenic
1103821786 12:123704545-123704567 TGATCCAGGTGCAGACCCGCTGG + Exonic
1105535512 13:21260752-21260774 CGATCCAGGCGCACTCCCGCAGG - Intergenic
1107636234 13:42395249-42395271 TGATCCAGGTGGAGCCCAGAGGG + Intergenic
1112362986 13:98733757-98733779 TGATCAAGGTGCTTACCCTCTGG + Intronic
1120872800 14:89353073-89353095 TGATCCAGATGCAGAGAGGCAGG + Intronic
1122903960 14:104793446-104793468 TGAACCAGATTCAGACCGGCAGG - Exonic
1124419823 15:29511149-29511171 GGATACATGTGCAGACCTGCAGG - Intronic
1129887342 15:79047903-79047925 TTGTCCAGGGGCAGACCTGCTGG + Intronic
1130229692 15:82087176-82087198 TGACCCAAGTGCTGACCCGAGGG - Intergenic
1131056567 15:89378610-89378632 GGATCCAGCTCCAGGCCCGCGGG - Intergenic
1132376217 15:101329944-101329966 TGCTACAGGTGCAGACCCCCAGG + Intronic
1132803566 16:1765674-1765696 TGATCCTGTGGCAGACCCTCAGG - Intronic
1134104594 16:11476820-11476842 GGATCCAGGTGCAGAAGGGCCGG - Exonic
1141292944 16:82737252-82737274 TCATCCAGGTGGAGACCTGAGGG + Intronic
1142347733 16:89564855-89564877 TACTCCAGGTGCGGCCCCGCAGG - Exonic
1145045761 17:19614325-19614347 TGATCCAAGGGCAGAAACGCAGG - Intergenic
1146359286 17:32160672-32160694 TGGTCCAGTTGCAGCCTCGCAGG + Intronic
1151367778 17:73628524-73628546 TGATCCGGGAGCTGACCTGCAGG + Intronic
1151929006 17:77219106-77219128 GGCTCCAGGTGCAGCCCAGCTGG - Intergenic
1152864100 17:82711998-82712020 TGGTCCAGCTGCAGCCTCGCAGG - Intergenic
1157776736 18:50402055-50402077 TAAGCCAGGTGCAGATACGCTGG - Intergenic
1160787357 19:907270-907292 TGATCCAGCTTCAGAGACGCTGG - Intronic
1161837859 19:6660016-6660038 TGAGCCGGGTGCGGACGCGCCGG + Intergenic
1164155718 19:22595953-22595975 TGCTCCAGGGGCAGAACGGCGGG - Intergenic
1166406126 19:42523104-42523126 TGTTCCAGGTGAGGACCCACAGG - Intronic
929014674 2:37482343-37482365 TGGTCCAGCTGCAGCCTCGCAGG + Intergenic
933593343 2:84257883-84257905 TGATACAGCTGCAGAGCAGCAGG - Intergenic
934290121 2:91685102-91685124 TCGCCCAGGTGCAGATCCGCAGG - Intergenic
942386713 2:175450663-175450685 GGATCCAGGTACAGACCAGAAGG - Intergenic
942519808 2:176791599-176791621 TGATCCAGGTTCAGTTCAGCTGG + Intergenic
948395750 2:237643647-237643669 TGTGCCAAGTGCAGACCCACCGG - Intronic
1172392609 20:34575913-34575935 TGATCCAGAGGCAGACAGGCTGG + Intronic
1175138662 20:56843479-56843501 TGGTCCAGCTGCAGCCTCGCAGG + Intergenic
1175810199 20:61853641-61853663 TGAAGCAGTTGCAGACCCTCAGG + Intronic
1176673532 21:9755852-9755874 TGATCCAGGTGCTGACTAGATGG + Intergenic
1184785685 22:46670563-46670585 AGACCCAGGTGCACACCCCCAGG - Intronic
1185173467 22:49306358-49306380 CGATGTAGGTACAGACCCGCTGG - Intergenic
953398283 3:42590247-42590269 TGCTCCAGATGCAGACCTGGAGG + Intronic
958177763 3:90018372-90018394 TGACCCTGGTGCAGAACCACTGG - Intergenic
961059618 3:123817444-123817466 TGATCCAGATGCAGGCCCAGAGG - Intronic
962211907 3:133486539-133486561 TGGTCCAGCTGCAGACTCGCAGG - Intergenic
964041732 3:152269142-152269164 TCAGCCACGGGCAGACCCGCCGG - Intronic
968264810 3:197354939-197354961 TAATCCAGGGCCAGGCCCGCAGG + Intergenic
969829449 4:9782781-9782803 TCGCCCAGGTGCAGATCCGCAGG + Exonic
978149249 4:105414520-105414542 TGGTCCAGCTGCAGCCTCGCAGG - Intronic
978183892 4:105835452-105835474 TGGTCCAGCTGCAGCCTCGCAGG - Intronic
985401184 4:189595819-189595841 TGATCCAGGTGCTGACTAGATGG - Intergenic
985924552 5:3005653-3005675 TGAGGCTGCTGCAGACCCGCAGG - Intergenic
986169770 5:5305952-5305974 TGCTCCAGTTGCAGACACCCTGG - Intronic
991588033 5:68219468-68219490 TGATCCTGGGGCAGAACCCCAGG - Intronic
998168719 5:139859566-139859588 TGAGCTGAGTGCAGACCCGCAGG - Intronic
1002170549 5:177371888-177371910 TGAACCGGGTGCAGAGCAGCGGG + Exonic
1002254050 5:177945746-177945768 AGGCCCAGGTGCAGACACGCAGG - Intergenic
1002289294 5:178188746-178188768 TGACCCAGGCCCAGACCCGGAGG + Intergenic
1003496294 6:6666441-6666463 TGATCCATGTACAGACCCAGTGG + Intergenic
1003559636 6:7170150-7170172 TGCTCCAGGTCAAGACCAGCGGG + Intronic
1004411734 6:15387400-15387422 AGATCAAGGTGCAGGCCAGCTGG + Intronic
1006635463 6:35458350-35458372 GCAGCCAGGTGCAGAGCCGCAGG - Exonic
1009241615 6:61192810-61192832 TGGTCCAGCTGCAGCCTCGCAGG - Intergenic
1012375616 6:98558454-98558476 TGATCAAGGTGTACACCCTCTGG - Intergenic
1018057133 6:160061883-160061905 TGATCCTGGTGGAGAAGCGCTGG - Exonic
1019014033 6:168866943-168866965 TGAGCCTGGTGCAGACCCCTTGG + Intergenic
1019404437 7:876384-876406 TGACCCAGGGGCGGGCCCGCAGG - Intronic
1019543316 7:1560999-1561021 TGGTCCAGGCTCACACCCGCTGG - Intergenic
1024769862 7:52709161-52709183 AGATCCACGTGCAGACCTGTTGG - Intergenic
1025117994 7:56274937-56274959 GGATACAGGTGCACACCCCCAGG - Intergenic
1045348810 8:101318930-101318952 TGTTCCAGCTGCAGCCCAGCTGG + Intergenic
1045516461 8:102864349-102864371 TCATGCAGGTGCAGACTGGCCGG + Exonic
1046660001 8:116938621-116938643 TCCTCCAGCTGCAGAGCCGCTGG + Intronic
1049820289 8:144629356-144629378 GGCTCCAAGAGCAGACCCGCAGG + Intergenic
1061225986 9:129281271-129281293 TCCTCCAGGTGGAGACCAGCTGG - Intergenic
1062555516 9:137112014-137112036 TGATCTCGGTGCAGGCCTGCAGG + Exonic
1185464152 X:345432-345454 AGAGGCAGCTGCAGACCCGCAGG + Intronic