ID: 1103824195

View in Genome Browser
Species Human (GRCh38)
Location 12:123723045-123723067
Sequence CCTCACCCTGTGAAGTAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1546
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 1478}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103824192_1103824195 -7 Left 1103824192 12:123723029-123723051 CCTCGGTGAATTCGTTCCTCACC 0: 1
1: 0
2: 1
3: 6
4: 62
Right 1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG 0: 1
1: 0
2: 1
3: 66
4: 1478
1103824189_1103824195 29 Left 1103824189 12:123722993-123723015 CCGGTGAGAACACTCACCTGTGC 0: 1
1: 0
2: 1
3: 15
4: 130
Right 1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG 0: 1
1: 0
2: 1
3: 66
4: 1478
1103824190_1103824195 13 Left 1103824190 12:123723009-123723031 CCTGTGCTGCTTATTAGCATCCT 0: 1
1: 0
2: 0
3: 20
4: 134
Right 1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG 0: 1
1: 0
2: 1
3: 66
4: 1478
1103824188_1103824195 30 Left 1103824188 12:123722992-123723014 CCCGGTGAGAACACTCACCTGTG 0: 1
1: 0
2: 2
3: 12
4: 138
Right 1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG 0: 1
1: 0
2: 1
3: 66
4: 1478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103824195 Original CRISPR CCTCACCCTGTGAAGTAGGC TGG Intronic
900253010 1:1681311-1681333 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
900519185 1:3097520-3097542 CATCACCGTGTGATGTTGGCTGG - Intronic
900969090 1:5979636-5979658 CCTCATCCTGTCAAGTAGCTGGG + Intronic
901265479 1:7907138-7907160 CCTCAGCCTCTGAAGTAGCGGGG - Intergenic
901352668 1:8611472-8611494 TCTCACCCTGTCATGCAGGCTGG - Intronic
901482050 1:9531985-9532007 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
901482501 1:9535171-9535193 CCTCAGCCTCTCAAGTAGCCAGG + Intergenic
901521461 1:9788138-9788160 CCTCACCCTCCCAAGTAGGCGGG - Intronic
901724815 1:11232757-11232779 CCTCACCCTCCCAAGTAGCCGGG - Intronic
901948567 1:12723505-12723527 TCTCACCCTGTCACCTAGGCTGG + Intronic
902120878 1:14164654-14164676 CCTCAGCCTCCGAAGTAGCCAGG + Intergenic
902174961 1:14642282-14642304 CCTCAGCCTGCCAAGTAGGTGGG - Intronic
902343912 1:15801900-15801922 CCTCAGCCTCTTGAGTAGGCTGG + Intergenic
902441964 1:16436355-16436377 TCTCACCCTGTCATCTAGGCTGG - Intronic
902506271 1:16940500-16940522 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
903074409 1:20751604-20751626 CCTCACCCTTTCATGTAGGTAGG - Intronic
903381402 1:22899383-22899405 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
903423553 1:23236315-23236337 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
903476378 1:23621845-23621867 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
903494421 1:23755662-23755684 CCTCAGCCTCTCAAGTAGCCAGG - Intronic
903545112 1:24119102-24119124 TCTCACCCTGTGGCCTAGGCTGG - Intergenic
903611280 1:24615249-24615271 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
903831687 1:26178936-26178958 CCTCCCCCAGTGAAGGAGCCTGG + Intronic
903885929 1:26541145-26541167 CCTCAGCCTATGGAGTAAGCTGG - Intronic
904104614 1:28068920-28068942 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
904188029 1:28721258-28721280 CCTCAGCCTCCCAAGTAGGCGGG + Intergenic
904244737 1:29179473-29179495 CCTCATCCTCTGAAGTAGCTAGG + Intronic
904729559 1:32578827-32578849 CCTCAGCTTTTCAAGTAGGCGGG + Intronic
905163807 1:36063862-36063884 CCTCAGCCTCTGAAGTAGCTGGG + Exonic
905374540 1:37510495-37510517 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
905405649 1:37730719-37730741 TCTCACTCTGTGACCTAGGCTGG + Intronic
905628274 1:39503250-39503272 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
906163764 1:43670506-43670528 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
906268000 1:44449441-44449463 CCTCACCCTGTCACCCAGGCTGG + Intronic
906474020 1:46155203-46155225 CCTCAGCTTCTGGAGTAGGCGGG - Intronic
906551917 1:46672358-46672380 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
907342269 1:53744018-53744040 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
907415658 1:54312257-54312279 TCTCACCCTGTCACCTAGGCTGG - Intronic
907690468 1:56659379-56659401 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
907864629 1:58387840-58387862 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
908141284 1:61187880-61187902 CCCCACCCTGTGGAGAAGGAGGG - Intronic
908156148 1:61355694-61355716 CCTCAGCCTTTGAAGTAGCTAGG + Intronic
908242546 1:62199466-62199488 TCTCACTCTGTGGATTAGGCTGG - Intronic
908265150 1:62371564-62371586 CCTCAGCCTCTGGAGTAGCCAGG + Intergenic
908441281 1:64157251-64157273 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
908754765 1:67459227-67459249 CCTCCCACTGTGAAGTCAGCAGG + Intergenic
909004083 1:70255194-70255216 CCTCAGCCTGCCAAGTAGCCGGG - Intergenic
909024311 1:70464614-70464636 TCTCACTCTGTCAAGCAGGCTGG - Intergenic
909402676 1:75251977-75251999 CAACACTCTGTGAAGTAGGTAGG - Intronic
909573760 1:77148828-77148850 CCTCACCCTCTTAAGTAGCTGGG + Intronic
909843991 1:80367272-80367294 CCTCACCCACTGCAGTAGCCTGG - Intergenic
910284376 1:85537302-85537324 CCTCACTCTGTCACCTAGGCTGG - Intronic
910353025 1:86321333-86321355 CCTCAGCCTGCCAAGTAGGTGGG + Intergenic
910484664 1:87700161-87700183 CCTCAGCTTCTGAAGTAGCCAGG - Intergenic
910546972 1:88429280-88429302 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
910698213 1:90044448-90044470 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
910737249 1:90473322-90473344 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
910786649 1:91006287-91006309 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
910806033 1:91190566-91190588 CCTCAGCCTCTGGAGTAGCCAGG - Intergenic
910957990 1:92728501-92728523 CCTCACCCTCTGGAGTAGCTGGG + Intronic
910972873 1:92873825-92873847 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
911609942 1:99949807-99949829 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
912057736 1:105626606-105626628 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
912343744 1:108944352-108944374 CCTCAGCCTGCTGAGTAGGCAGG - Intronic
912843631 1:113060747-113060769 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
913014800 1:114721995-114722017 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
913046582 1:115078433-115078455 CCTCAACCTGTGAATTTTGCAGG - Intronic
913276197 1:117140577-117140599 TCTCACCCTGTCACCTAGGCTGG + Intergenic
913561322 1:120023319-120023341 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
913636805 1:120770283-120770305 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
913686676 1:121238727-121238749 CCTCAGCCTGTTAAGTAGCAGGG + Intronic
914038529 1:144026367-144026389 CCTCAGCCTGTTAAGTAGCAGGG + Intergenic
914150926 1:145041541-145041563 CCTCAGCCTGTTAAGTAGCAGGG - Intronic
914205646 1:145525413-145525435 CCTCACTCTGTCACCTAGGCTGG + Intergenic
914281906 1:146182728-146182750 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
914542935 1:148633435-148633457 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
914623686 1:149437577-149437599 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
914823571 1:151124275-151124297 CCTCAGCCTCTGAAGTAGCTGGG + Exonic
915017665 1:152750532-152750554 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
915135014 1:153725257-153725279 CCTCACTCTGTCACCTAGGCTGG + Intergenic
915154132 1:153860362-153860384 CCTCACTCTGTCACCTAGGCTGG + Intronic
915154697 1:153865343-153865365 CCTCAGCCTCTTAAGTAGGTGGG - Intronic
915177760 1:154030845-154030867 CCTCAGCCTCTCAAGTAGCCGGG + Intronic
915270887 1:154752584-154752606 CAGCACTCTGTGAAGTAAGCAGG - Intronic
915390946 1:155543478-155543500 TCTCACTCTGTGATGCAGGCTGG - Intronic
915439431 1:155935597-155935619 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
916305308 1:163323601-163323623 CCTCAGCCTCTCAAGTAGCCAGG - Intronic
916388196 1:164300854-164300876 TCTCATCCTATGAAGTAGGCAGG + Intergenic
916502940 1:165401996-165402018 CCTCAGCCTCCCAAGTAGGCGGG + Intronic
916705027 1:167340545-167340567 CCTCAGCCTCTCAAGTAGCCGGG + Intronic
917015756 1:170529633-170529655 TCTCACCCTGTCACGTAGGCTGG - Intergenic
917119286 1:171631689-171631711 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
917304381 1:173612126-173612148 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
917347434 1:174042830-174042852 CCTCACTCTGTCACGCAGGCTGG + Intergenic
917591588 1:176481732-176481754 TCTCACCCTGTCACCTAGGCTGG + Intronic
917866195 1:179198055-179198077 CTTCAGCCTGTCAAGTAGCCGGG - Intronic
917876114 1:179288710-179288732 CCTCAGCCTCCCAAGTAGGCTGG - Intergenic
918249319 1:182687291-182687313 CCTCAGCCTCTGAAGAAGGTGGG + Intergenic
918440495 1:184561731-184561753 CCTCAGCCTCCCAAGTAGGCGGG + Intronic
918514906 1:185352789-185352811 CCTCACCCTCCCAAGTAGCCAGG - Intergenic
918745693 1:188195777-188195799 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
918759929 1:188391186-188391208 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
919427363 1:197449480-197449502 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
919614422 1:199787678-199787700 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
919857419 1:201715274-201715296 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
920014495 1:202895513-202895535 CACCACCCTGGGAGGTAGGCTGG - Exonic
920115256 1:203616162-203616184 TCTCACCCTGTCACCTAGGCTGG - Intergenic
920147574 1:203875188-203875210 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
920159014 1:203981108-203981130 TCTCACCCTGTCACCTAGGCTGG + Intergenic
920271374 1:204767120-204767142 CCCCACCCTGTCAATCAGGCTGG - Intergenic
920278000 1:204822767-204822789 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
920309523 1:205040615-205040637 CCTCACTCTGTCATCTAGGCTGG + Intergenic
920391255 1:205603974-205603996 CCTCACCCTGTCACCCAGGCTGG - Intronic
920419428 1:205821272-205821294 CCTCAGCCTCTCAAGTAGCCAGG + Intergenic
920474000 1:206257285-206257307 CCTCAGCCTGTTAAGTAGCAGGG + Intronic
920633805 1:207679110-207679132 CCTCAGCCTCTTGAGTAGGCTGG + Intronic
920677857 1:208050797-208050819 CCTCACCCTGTCACCTAGGCTGG - Intronic
921021526 1:211239998-211240020 CCTCAGCCTCTGGAGTAGGAGGG - Intergenic
921199127 1:212788295-212788317 CCTCAGCCTTTCAAGTAGCCGGG - Intronic
921676884 1:217986233-217986255 CCTCAGCCTGTCAAGTAGTTGGG + Intergenic
921719439 1:218454165-218454187 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
921858645 1:220016312-220016334 TCTCACCCTGTTACTTAGGCTGG - Intronic
922133070 1:222798196-222798218 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
922169457 1:223142820-223142842 CCCCACCCTGTGGAAGAGGCAGG - Intronic
922220500 1:223554502-223554524 CCTCAGCCTCTGAAGTAGATGGG - Intronic
922277054 1:224088887-224088909 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
922292156 1:224217298-224217320 CCTCACTCTGTCATGTAGGTTGG + Intergenic
922313890 1:224423630-224423652 CCTCACCCTCCTAAGTAGGTAGG - Intronic
922519860 1:226240502-226240524 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
922939155 1:229446377-229446399 CCTCACTCTGTCACCTAGGCTGG - Intronic
923741419 1:236658353-236658375 CCTCAGCCTGTCTAGTAGGCAGG - Intergenic
923744923 1:236691527-236691549 CCTCACCCTCCCAAGTAGGTAGG - Intronic
923813146 1:237343105-237343127 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
923822907 1:237466279-237466301 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
923972239 1:239217520-239217542 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
924224257 1:241907893-241907915 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
924314670 1:242783538-242783560 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
924528502 1:244873260-244873282 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924702535 1:246468523-246468545 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1062781608 10:215671-215693 CCTCACCCTCCGAAGTAGCTGGG + Intronic
1062815513 10:497006-497028 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1062922715 10:1292157-1292179 CCTCACTCTGTGACCCAGGCTGG + Intronic
1063411974 10:5843126-5843148 CCTCAGCCTCCCAAGTAGGCTGG - Intergenic
1063430896 10:5987266-5987288 CCTCAGCCTCCCAAGTAGGCAGG + Intergenic
1063459428 10:6205911-6205933 CCTCAGCCTGTCCAGTAGCCGGG + Intronic
1063495511 10:6503890-6503912 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1063670134 10:8093589-8093611 CCTCAGCCTGTTGAGTAGCCGGG - Intergenic
1063684063 10:8219615-8219637 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1063805235 10:9631490-9631512 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1063992737 10:11583911-11583933 CCTCAGCCTCTGAAGTAGCCGGG - Intronic
1064006217 10:11701264-11701286 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
1064013323 10:11753888-11753910 CCTCAGCCTCCCAAGTAGGCTGG + Intronic
1064017200 10:11781777-11781799 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1064114463 10:12566358-12566380 CCTCACCCCTGGAAGAAGGCCGG - Intronic
1064197388 10:13256984-13257006 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1064310474 10:14208079-14208101 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
1064355804 10:14616807-14616829 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1064417274 10:15160656-15160678 CCTCAGCCTCCCAAGTAGGCAGG - Intronic
1064498103 10:15937264-15937286 TCTCACTCTGTCATGTAGGCTGG + Intergenic
1064657299 10:17568883-17568905 TCTCACCATGTTGAGTAGGCTGG + Intergenic
1064702754 10:18038532-18038554 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1064744883 10:18468713-18468735 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1064880379 10:20045284-20045306 CCTCAGCCTGTCAAGTAGCTGGG + Intronic
1064989454 10:21243420-21243442 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1064996885 10:21303732-21303754 CCTCACTCTGTCACCTAGGCTGG - Intergenic
1065525481 10:26615803-26615825 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1065648292 10:27860335-27860357 CCTCACCCTCCCAAGTAGCCAGG - Intronic
1065817345 10:29494053-29494075 CCTCAGCCTCCCAAGTAGGCGGG - Intronic
1065896120 10:30164508-30164530 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
1065935101 10:30514189-30514211 CCTCAGCCTCTTAAGTAGCCGGG - Intergenic
1066066048 10:31761650-31761672 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1066388325 10:34959273-34959295 CCTCACCCTATGGAGTAGCTGGG - Intergenic
1066421681 10:35269743-35269765 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1066519473 10:36199492-36199514 CCTCAGACTCTGAAGTAGCCGGG - Intergenic
1066680000 10:37929106-37929128 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1066682261 10:37945601-37945623 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1066993784 10:42543116-42543138 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1067399619 10:45958852-45958874 CCTCACCCTCCCAAGTAGCCGGG - Intergenic
1068295612 10:55069011-55069033 CCTCACCCTCCGAAGTAGCTGGG + Intronic
1069111659 10:64454713-64454735 CCTCACTCTGTCACCTAGGCTGG - Intergenic
1069472597 10:68706216-68706238 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1069487078 10:68830456-68830478 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1069647473 10:70012961-70012983 CCTCACCCTCTTAAGTAGCTGGG + Intergenic
1069963438 10:72093212-72093234 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1070073531 10:73113001-73113023 CCTCAGCCTCCCAAGTAGGCAGG + Intronic
1070124873 10:73613162-73613184 TCTCACTCTGTTACGTAGGCTGG + Intronic
1070253490 10:74794056-74794078 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
1070429857 10:76327119-76327141 CCTCACCCTGTCACCCAGGCTGG + Intronic
1070458199 10:76638837-76638859 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1070460232 10:76659785-76659807 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1070756414 10:78996170-78996192 CCTCACTCTGTGTAGCAGGAGGG - Intergenic
1070957225 10:80472106-80472128 CCTCACTCTGTGACCCAGGCTGG - Intronic
1071172194 10:82879586-82879608 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1072052181 10:91716155-91716177 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1072097526 10:92196814-92196836 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1072103305 10:92249904-92249926 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1072133761 10:92523263-92523285 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1072198626 10:93138884-93138906 CCTCAACCTCTGAAGTAGTTGGG + Intergenic
1072229289 10:93399999-93400021 CCTCACTCTGTCACCTAGGCTGG - Intronic
1072354871 10:94598407-94598429 CCTCAGCCTTTGGAGTAAGCTGG + Intronic
1072361547 10:94664199-94664221 CCCCACCCAGTGAAGAAGGATGG + Intergenic
1072466947 10:95672806-95672828 CCTCAGCCTCTGAAGTAGTTGGG + Intronic
1072520289 10:96224811-96224833 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1072616766 10:97055099-97055121 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1072665866 10:97391803-97391825 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1072736550 10:97883115-97883137 CATCACCCTGTGACTGAGGCTGG + Intronic
1072755414 10:98017561-98017583 TCTCACTCTGTCAACTAGGCTGG + Intronic
1072880330 10:99220685-99220707 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1073410791 10:103340059-103340081 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1073510204 10:104038094-104038116 CCACACCCTGGGGAGGAGGCTGG - Intronic
1074113212 10:110437257-110437279 TCCCACCCTCTGAAGCAGGCAGG - Intergenic
1074347589 10:112702699-112702721 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1074426125 10:113353064-113353086 CCTCACCCTGCCAAGTAGCTGGG - Intergenic
1074502737 10:114041679-114041701 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1074605406 10:114959018-114959040 CCTCACCCTGTGGAGTAGCTGGG - Intronic
1074789804 10:116875459-116875481 CCTCACCCTCTCAAGTAGCTGGG + Intronic
1076245804 10:128946417-128946439 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1076560110 10:131357183-131357205 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1076767923 10:132646689-132646711 CCTCATGCTGTGAAGAAGCCAGG - Intronic
1076866618 10:133169539-133169561 CTTCACCCTGGGAGGTGGGCAGG + Intronic
1077065903 11:640839-640861 CCTCACCCTGAGCAGGCGGCCGG - Intergenic
1077078803 11:713572-713594 TCTCACCCTGTCACCTAGGCTGG + Intronic
1077125995 11:937133-937155 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1077252742 11:1567769-1567791 CCCCACCCTGTGGTGGAGGCTGG - Intronic
1077256746 11:1588079-1588101 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1077902922 11:6504563-6504585 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1078157570 11:8811847-8811869 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1078321066 11:10335232-10335254 TCTCACTCTGTCATGTAGGCTGG + Intronic
1078334608 11:10453702-10453724 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1078351184 11:10594952-10594974 TCTCACTCTGTCACGTAGGCTGG + Intronic
1079054033 11:17189781-17189803 CCTCACTCTGTGACCCAGGCTGG - Intronic
1079077355 11:17392400-17392422 CTTCAACCTGTGAATTTGGCAGG - Intergenic
1079882216 11:25942822-25942844 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1079995993 11:27295705-27295727 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1080473970 11:32572620-32572642 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1080476915 11:32604150-32604172 TCTCACCCTGTCACCTAGGCTGG + Exonic
1080601508 11:33825252-33825274 TCTCACTCTGTCAATTAGGCTGG + Intergenic
1081548041 11:44086181-44086203 CCTCAGCCTCTAAAGTAGGTAGG + Intergenic
1081613381 11:44576791-44576813 CAGCACCCTGTGAAATAGGGCGG + Intronic
1081798593 11:45840789-45840811 CCACACGCTGTGCAGGAGGCAGG + Intergenic
1082814319 11:57498323-57498345 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1082884939 11:58071370-58071392 CCTCAGCCTCTGAAGTAGCAGGG - Intronic
1083026263 11:59553673-59553695 CTTAACACTGGGAAGTAGGCCGG - Intergenic
1083042697 11:59702894-59702916 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1083267539 11:61553716-61553738 CCCCTCCCTGAGAAGCAGGCTGG - Intronic
1083283104 11:61639574-61639596 CCTCACTCTGTCATGCAGGCTGG - Intergenic
1083465881 11:62845752-62845774 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1083519101 11:63290826-63290848 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1083558580 11:63653347-63653369 CCTCAACCTCTGGAGTAGGTGGG - Intronic
1083845819 11:65332841-65332863 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
1083881302 11:65549888-65549910 TCTCACCTTGTGACCTAGGCTGG - Intronic
1083906980 11:65679220-65679242 CCTCACCCTTCCAAGTAGCCAGG + Intergenic
1083918715 11:65768044-65768066 CCTCACCCTGTCACCCAGGCTGG + Intergenic
1084008046 11:66333521-66333543 CCTCACCCTCTCCAGTAAGCAGG + Exonic
1084058854 11:66656250-66656272 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1084299783 11:68240723-68240745 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1084305629 11:68281101-68281123 CCTCAGCCTCTGAAGTAGCAGGG - Intergenic
1084399449 11:68935196-68935218 CCTCACGCTGTGAAACAGCCAGG - Intronic
1084799003 11:71528864-71528886 CCTCAGCCTCCGAAGTAGCCAGG - Intronic
1084830007 11:71761538-71761560 CCTCAGCCTGTGAAGTAGCAGGG - Intergenic
1085001993 11:73046104-73046126 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1085124935 11:73993738-73993760 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
1085286627 11:75366690-75366712 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1085492963 11:76938432-76938454 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1085554619 11:77409154-77409176 CCTCAACCTCTGAAGTAGTTGGG - Intronic
1085578249 11:77626607-77626629 TCTCACCCTGTCACCTAGGCTGG - Intronic
1086099733 11:83086558-83086580 CCTCAGCCTCTGGAGTAGCCAGG + Intergenic
1086198044 11:84165780-84165802 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1086408637 11:86521277-86521299 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1086473231 11:87140181-87140203 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1087281838 11:96219653-96219675 TCTCACTCTGTCATGTAGGCTGG + Intronic
1088210130 11:107445486-107445508 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1088254781 11:107892966-107892988 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1088280679 11:108131465-108131487 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1088289187 11:108217875-108217897 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1088444429 11:109909421-109909443 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
1088628805 11:111753944-111753966 TCTCACCCTGTCACCTAGGCTGG + Intronic
1088654875 11:111989592-111989614 TCTCACCCTGTCACCTAGGCTGG - Intronic
1089037785 11:115413758-115413780 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1089252420 11:117174592-117174614 CCTCAGCCTCCGAAGTAGCCGGG + Intronic
1089512295 11:119007297-119007319 CCTCAGCCTGCTAAGTAGGTGGG + Intronic
1089515227 11:119027902-119027924 CCTCAACATGGGCAGTAGGCTGG - Intronic
1089850607 11:121493092-121493114 CCTCACCCTCTCAAGTAGCTAGG + Intronic
1089944811 11:122458310-122458332 ACTCACACTGGGAAGTAAGCTGG - Intergenic
1089972374 11:122704537-122704559 CCTCACTCTGTCATCTAGGCTGG + Intronic
1090193627 11:124796560-124796582 CCTCACCCTCTAAAGTAGCTGGG + Intronic
1090200488 11:124851607-124851629 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1090328456 11:125909676-125909698 TCTCACCCTGTCAACTAGGCTGG + Intronic
1090362943 11:126186074-126186096 CCTCAGCCTTTGAAGTAGCTGGG - Intergenic
1090746404 11:129709183-129709205 TCTCACTCTGTCACGTAGGCTGG + Intergenic
1090868300 11:130721391-130721413 CCTCAGCCTCCTAAGTAGGCAGG + Intergenic
1091732252 12:2890116-2890138 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1091923752 12:4327072-4327094 GCTCACCCAGTGACATAGGCAGG + Intronic
1091928484 12:4375138-4375160 CATCACCCTATGAAGTAGGCAGG - Intronic
1092410209 12:8246992-8247014 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1092413224 12:8270141-8270163 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1092454278 12:8628548-8628570 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1092824476 12:12385623-12385645 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1094030037 12:26001283-26001305 CCTCAGCCTCTGAAATAGGTGGG + Intronic
1094203601 12:27817502-27817524 CCTCATCCTCTTAAGTAGGTGGG + Intergenic
1094606349 12:31952496-31952518 CCTCACTCTGTCATCTAGGCTGG - Intergenic
1094682237 12:32677201-32677223 CCTCACTCTGTCACTTAGGCTGG + Intergenic
1096091951 12:48908166-48908188 CCTCACCCTCTGGAGTAGCTGGG + Intronic
1096300957 12:50426852-50426874 CCTCAGCATCTGAAGTAGCCGGG + Intronic
1096440570 12:51639528-51639550 CCTCAGCCTGCCAAGTAGGTGGG + Intronic
1096501761 12:52068467-52068489 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1096872269 12:54600702-54600724 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1096936839 12:55289684-55289706 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1097043537 12:56170846-56170868 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1097079375 12:56418691-56418713 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
1097124624 12:56764037-56764059 TCTCACTCTGTCATGTAGGCTGG - Intronic
1097236852 12:57546490-57546512 CCTCACCTTGAGAAGCAGGCAGG + Intronic
1097813506 12:64045463-64045485 TCTCACTCTGTCACGTAGGCTGG + Intronic
1097831381 12:64227802-64227824 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1098349887 12:69547430-69547452 TCTCACTCTGTCAACTAGGCAGG - Intronic
1098361570 12:69659381-69659403 CCTCACTCTGTGACCCAGGCTGG + Intronic
1098652705 12:72992998-72993020 TCTCACCCTGTTGAGTAGGTAGG - Intergenic
1098681710 12:73364398-73364420 CCTCAGCCTCTCAAGTAGGAGGG - Intergenic
1099037375 12:77605722-77605744 CCTCAGCCTCTCAAGTAGCCGGG - Intergenic
1099466480 12:82994267-82994289 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1099734333 12:86549000-86549022 TATTACCCTGTGAAGTAGGCAGG - Intronic
1100174517 12:92014245-92014267 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1100649076 12:96565261-96565283 TCTCACTCTGTCAACTAGGCTGG + Intronic
1100818381 12:98407663-98407685 ACAAGCCCTGTGAAGTAGGCAGG + Intergenic
1101102857 12:101411122-101411144 CCTCAGCCTCCGAAGTAGCCGGG - Intergenic
1101934963 12:109049784-109049806 CCTCACTCTGTCATGCAGGCTGG - Intronic
1102049247 12:109850414-109850436 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1102228377 12:111245504-111245526 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1102264264 12:111468814-111468836 CCTCAGCCTCCGAAGTAGCCGGG + Intronic
1102952272 12:117038783-117038805 CCTCCCCCTGTCACCTAGGCTGG - Intergenic
1103212492 12:119177029-119177051 CCTCATCTCGTGAAGAAGGCAGG + Intergenic
1103245418 12:119452850-119452872 CCTCACTCTGTCACGCAGGCTGG + Intronic
1103543492 12:121682881-121682903 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1103547366 12:121711829-121711851 CCTCAGCCTCTGGAGTAGCCAGG - Intergenic
1103696297 12:122818335-122818357 CCTCAGCCTTTCAAGTAGCCGGG - Intronic
1103773248 12:123345783-123345805 CCTCAACCTCTGAAGTAGCTGGG + Intronic
1103824195 12:123723045-123723067 CCTCACCCTGTGAAGTAGGCTGG + Intronic
1103843007 12:123880453-123880475 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
1104077408 12:125402303-125402325 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1104201732 12:126596312-126596334 CCTCAGCCTCTGGAGTAGCCAGG + Intergenic
1104420854 12:128633638-128633660 CCTCACCTAGTTAAGAAGGCTGG + Intronic
1104689542 12:130814981-130815003 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1105342857 13:19543944-19543966 CCTCAGCCTTTCAAGTAGCCGGG - Intergenic
1105509914 13:21042569-21042591 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1105567385 13:21563916-21563938 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
1105989195 13:25601578-25601600 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1106278212 13:28235825-28235847 TCTCACCCTGTGGAGTAGCTAGG + Intronic
1106306319 13:28514412-28514434 CCTCAGCCTCTTAAGTAGCCAGG - Intergenic
1106722823 13:32453600-32453622 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1106767025 13:32923362-32923384 CCTCAGCCTCCCAAGTAGGCAGG - Intergenic
1107077925 13:36343911-36343933 CCTCAGCCTGTGCAGTAGCTGGG - Intronic
1107184773 13:37505539-37505561 CCTCTGCCTGTGAAGTCTGCAGG - Intergenic
1107234775 13:38155038-38155060 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
1108041923 13:46347289-46347311 CCTCACCCTCCCAAGTAGGTGGG - Intronic
1108063914 13:46558005-46558027 TCTCACTCTGTCACGTAGGCTGG - Intronic
1108429047 13:50335548-50335570 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1108644183 13:52409770-52409792 TCTCACTCTGTCATGTAGGCTGG - Intergenic
1108667699 13:52649377-52649399 ACTCACACTGTTACGTAGGCTGG + Intergenic
1108740632 13:53334163-53334185 CCTCAGCCTATCAAGTAGCCAGG - Intergenic
1109098681 13:58150408-58150430 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1109311325 13:60697415-60697437 TCTCACTCTGTCAACTAGGCTGG + Intergenic
1109483789 13:62992372-62992394 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1110193950 13:72764034-72764056 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
1110250463 13:73375759-73375781 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1110479957 13:75962436-75962458 CCTCAGCCTCCCAAGTAGGCTGG + Intergenic
1110545046 13:76746511-76746533 CCTCACTCTGTCACCTAGGCTGG - Intergenic
1110684109 13:78351807-78351829 CCTCACTCTGTCGACTAGGCTGG + Intergenic
1111379803 13:87434421-87434443 CCTCAGCCTCTGGAGTAGGTGGG + Intergenic
1111454801 13:88466501-88466523 CCTCAGCCTCTGGAGTAGCCGGG - Intergenic
1111503597 13:89158153-89158175 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
1111693567 13:91594706-91594728 TCTCACCCTGTCACCTAGGCTGG + Intronic
1111948417 13:94689986-94690008 CCTCAGCCTCTGGAGTAGCCGGG - Intergenic
1111962918 13:94831202-94831224 CCTCATCCTGTCAAGTAGCTGGG - Intergenic
1112018531 13:95351629-95351651 CACCACGCTGTGAAGTAGCCTGG - Intergenic
1112163891 13:96897041-96897063 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1112189708 13:97164120-97164142 CCTCAGCCTCTCAAGTAGCCTGG + Intergenic
1112260901 13:97877530-97877552 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1112447876 13:99482335-99482357 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
1112498996 13:99927856-99927878 CCTCAGCCTCTGAAGTAGGTGGG + Intergenic
1112510694 13:100006511-100006533 TCTCAGCCTCTGAAGTAGGTGGG - Intergenic
1112515286 13:100048060-100048082 CCTCAGCCTGTGGAGTAGCTGGG - Intergenic
1114007261 14:18328096-18328118 CCTCACTCTGTCAACCAGGCTGG - Intergenic
1114216198 14:20659518-20659540 CCTTACCCTCCCAAGTAGGCAGG + Intergenic
1114249086 14:20942318-20942340 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1114539827 14:23446656-23446678 CCCCACCCTGTGCCGCAGGCCGG + Intergenic
1114641917 14:24229333-24229355 CCTCACCCTGTCAAGTGGCTGGG + Intronic
1114888056 14:26879952-26879974 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1115065377 14:29253817-29253839 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1115252351 14:31362746-31362768 CCTCACTCTGTCAACCAGGCTGG - Intronic
1115427057 14:33272444-33272466 CCTCACTCTGTCACTTAGGCTGG + Intronic
1115531274 14:34330069-34330091 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1115827254 14:37292039-37292061 CCTCACCCTGCTAAGTAGCTGGG + Intronic
1115981302 14:39054585-39054607 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1116000680 14:39239427-39239449 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
1116291607 14:43050296-43050318 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1116361351 14:44002228-44002250 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1116667150 14:47792167-47792189 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1116682688 14:47994938-47994960 CCTCACCCTCTCAAGTAGCTAGG - Intergenic
1116700423 14:48234729-48234751 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1116893741 14:50295257-50295279 CCTCAGCCTTTGAAGTAGCTTGG - Intronic
1117068078 14:52030733-52030755 CCTCACCCTCTGGAGTAGCTGGG - Intronic
1117096884 14:52307880-52307902 CCTCAGCCTGTGAAGGAGAGAGG + Intergenic
1117182473 14:53205287-53205309 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1117447454 14:55818339-55818361 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1117516552 14:56507581-56507603 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1118014189 14:61641746-61641768 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1118187027 14:63546857-63546879 CCTCAGCCTGTGGAGTAGTTGGG - Intergenic
1118345963 14:64941094-64941116 CCTCACTCTGTCACCTAGGCTGG + Intronic
1118387360 14:65267387-65267409 CCTCACCCTCCGGAGTAGCCGGG + Intergenic
1118411586 14:65484642-65484664 CCTCACCCTGTCACCCAGGCTGG - Intronic
1118810064 14:69266772-69266794 CTGCACCCTGGGAAGTAGGCGGG + Intronic
1119245733 14:73105221-73105243 CATCAGCCTCTGGAGTAGGCAGG + Intronic
1119328075 14:73773990-73774012 TCTCACCCTGTCACCTAGGCTGG - Intronic
1119347935 14:73941819-73941841 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1119479877 14:74952487-74952509 CCACAGGCTGTGAAGTAGGAAGG - Intronic
1119657539 14:76428112-76428134 CCTCAGCCTCTGGAGTAGCCAGG + Intronic
1119720131 14:76884789-76884811 CCCCACCCTGTGTAGGAGGCAGG + Intergenic
1119817971 14:77588048-77588070 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
1120419132 14:84260280-84260302 CCTCACCCTCTCAAGTAGCCAGG - Intergenic
1120781413 14:88489525-88489547 CCTCAGCTTCTGAAGTAGCCAGG - Intronic
1120798038 14:88657107-88657129 CCTCAGCCTTTGAAGTAGCTGGG + Intronic
1120928942 14:89827747-89827769 CCTCATCCTCTGAAGTAGCTGGG + Intronic
1120961211 14:90126657-90126679 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
1121139819 14:91531531-91531553 CCTCACTCTGTGGCCTAGGCTGG + Intergenic
1121276254 14:92669923-92669945 CCTCACCCTGTCACTCAGGCTGG + Intronic
1121387618 14:93543038-93543060 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
1121541682 14:94732183-94732205 CCTCAGCCTCTGGAGTAGGTGGG + Intergenic
1121774719 14:96583107-96583129 CCTCACCCTGGGAAATAGGAAGG + Intergenic
1121801070 14:96774652-96774674 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1122310841 14:100793064-100793086 TCTCACCCAGGGAAGTAAGCTGG - Intergenic
1122330685 14:100910450-100910472 CCTCACAGTATGAAGAAGGCAGG + Intergenic
1122567539 14:102671509-102671531 CCTCACCCTCTGAAGTAGCTGGG + Intronic
1122583711 14:102788853-102788875 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1122755320 14:103974084-103974106 CCTCAGCCTCTGAGGTAGGTAGG - Intronic
1122954383 14:105063488-105063510 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1123492711 15:20795354-20795376 CCCCATCCTGTGAGGTAGACAGG - Intergenic
1123549211 15:21364446-21364468 CCCCATCCTGTGAGGTAGACAGG - Intergenic
1123702812 15:22928265-22928287 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1123763732 15:23454094-23454116 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
1123880276 15:24672559-24672581 CCTCACCCAGTGAAGTAGCTGGG + Intergenic
1123908694 15:24945421-24945443 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1124004128 15:25783058-25783080 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1124426127 15:29564653-29564675 GCTCACCCTTTAAAGTAGGATGG - Intronic
1124932741 15:34137964-34137986 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1124953444 15:34344104-34344126 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1125278580 15:38020106-38020128 CCTCAGCCTCTGGAGTAGGTAGG + Intergenic
1125551278 15:40546815-40546837 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1125580055 15:40778902-40778924 TCTCACCCTGTCACCTAGGCTGG - Intronic
1125625689 15:41107383-41107405 CCTCAGCCTCCGAAGTAGCCGGG - Intronic
1125680197 15:41525768-41525790 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
1125749057 15:42016363-42016385 CCTCACTCTGTCATATAGGCTGG + Intronic
1126028923 15:44477111-44477133 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1126162617 15:45628311-45628333 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1126172981 15:45709389-45709411 CCTCAGCCTGTGACGAAGGGAGG - Intergenic
1126319958 15:47411209-47411231 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1126598329 15:50403979-50404001 CCTCAACCTCTGAAGTAGCTGGG + Intergenic
1126755015 15:51917367-51917389 TCTCACCCTGTCACCTAGGCTGG - Intronic
1126787221 15:52186972-52186994 CCTCTCCCTGGGAGGGAGGCAGG + Intronic
1126827327 15:52565160-52565182 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1126837867 15:52685821-52685843 CCTCAGCCTCTGGAGTAGGTAGG + Intronic
1126934986 15:53696885-53696907 CAACACCCTGTGAAGGTGGCTGG - Intronic
1127175065 15:56345537-56345559 CCTCAGCCTCCCAAGTAGGCTGG + Intronic
1127610113 15:60628479-60628501 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
1127737839 15:61861587-61861609 CCTCAGCCTGTTAAGTAGCCTGG - Intronic
1127927879 15:63564961-63564983 TCTTACCCTGTGAGGTATGCAGG + Intronic
1127969630 15:63948153-63948175 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1127998905 15:64172532-64172554 CCTCACCCACCGAAGTAGGCAGG + Intronic
1128048228 15:64638864-64638886 CCTCACTCTGTCACCTAGGCTGG - Intronic
1128100931 15:64999289-64999311 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1128120579 15:65143024-65143046 CTTCAGCCTCTGAAGCAGGCAGG + Intergenic
1128201745 15:65814887-65814909 TCTCACTCTGTCACGTAGGCTGG + Intronic
1128380297 15:67107387-67107409 TCTCACCCTGGGAAGAAGGGTGG - Intronic
1128418356 15:67467191-67467213 TCTCACTCTGTCAACTAGGCTGG - Intronic
1128432999 15:67617719-67617741 CCTCACTCTGTCACCTAGGCTGG + Intronic
1128490774 15:68141085-68141107 CCTCACCCTTCTAAGTAGGTAGG - Intronic
1128908627 15:71491837-71491859 CCTCACTCTGTCAACCAGGCTGG - Intronic
1128990967 15:72260201-72260223 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1129026190 15:72576388-72576410 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1129093203 15:73173982-73174004 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
1129272686 15:74427821-74427843 CTTCTGCCTGTGAAGTAGGGCGG - Intronic
1129440321 15:75576776-75576798 CCTCGCCCTGTCATCTAGGCTGG - Intronic
1129446105 15:75619524-75619546 CCTCAGCCTCTGAAGTAGGTGGG - Intronic
1129718500 15:77865256-77865278 CCTCAGCATGTGAAGGTGGCAGG + Intergenic
1129757006 15:78104801-78104823 CTTCACATTGTGAAGGAGGCCGG + Exonic
1130146422 15:81277557-81277579 CCTCAGCCTCTGAAGTAGTTGGG + Intronic
1130460426 15:84155610-84155632 CCTCAGCATGTGAAGGTGGCAGG - Intergenic
1131012318 15:89028549-89028571 CCTCACTCTGTGACCCAGGCTGG + Intergenic
1131101740 15:89696522-89696544 CCTCACTCTGTCACGTAGGCTGG + Intronic
1131112592 15:89774943-89774965 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1131251961 15:90836869-90836891 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1131335182 15:91542231-91542253 TCTCACACTGTGATGTAAGCCGG + Intergenic
1131353735 15:91724813-91724835 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1131682485 15:94738501-94738523 CCTCAGCCTGTCAGGTAGCCAGG - Intergenic
1131693100 15:94847183-94847205 CCTCAGCCTCCTAAGTAGGCTGG + Intergenic
1131985116 15:98035288-98035310 CCTCGCCCTCTGGAGTAGCCGGG + Intergenic
1132097920 15:99001745-99001767 TCTCACCCTGTCACGTAGGCTGG + Intronic
1132120783 15:99173468-99173490 CCTCAGCCTGCGAAGTAGGTGGG - Intronic
1132221089 15:100106024-100106046 TCTCACTCTGTCACGTAGGCTGG + Intronic
1132343519 15:101092805-101092827 CCTCGGCCTGTCCAGTAGGCAGG - Intergenic
1132357880 15:101186202-101186224 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1132384343 15:101389611-101389633 ACTCACTCTGTGGAGAAGGCTGG + Intronic
1132507024 16:315710-315732 CCTCAGCCTCCGAAGTAGTCTGG - Intronic
1132817917 16:1843175-1843197 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1132876320 16:2139913-2139935 TCTCACTCTGTCATGTAGGCTGG - Intergenic
1132883050 16:2170814-2170836 CCTCTCCCTGTGAGCTGGGCGGG - Intronic
1133143473 16:3765675-3765697 CCTCACTCTGTCACTTAGGCTGG + Intronic
1133145115 16:3779286-3779308 CCTCAGCCTCTAAAGTAAGCTGG + Intronic
1133351199 16:5101789-5101811 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1133423771 16:5669533-5669555 CCTCAGCCTGCCAAGTAGCCGGG + Intergenic
1133509762 16:6446078-6446100 CCTCAACCTCTCAAGTAGCCAGG + Intronic
1133813428 16:9178508-9178530 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1134010227 16:10846567-10846589 CCTCACTCTGTCAACTAGGCTGG - Intergenic
1134023634 16:10938750-10938772 CCTGACCCTGGGAAGTGGGGAGG - Intronic
1134032199 16:11001199-11001221 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1134034825 16:11021680-11021702 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
1134361604 16:13536026-13536048 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1134505441 16:14802257-14802279 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1134575138 16:15326653-15326675 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1134615454 16:15648001-15648023 TCTCACCCTGTGACATAGGCTGG - Intronic
1134727308 16:16429839-16429861 CCTCAGCCTGTGGAGTAGCTGGG - Intergenic
1134802221 16:17095724-17095746 CCTCAGCCTCCCAAGTAGGCGGG + Intergenic
1134883313 16:17767273-17767295 TCTCACTCTGTGACCTAGGCTGG + Intergenic
1134940129 16:18282016-18282038 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1135006423 16:18827308-18827330 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1135107486 16:19662871-19662893 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1135410884 16:22233569-22233591 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1135557189 16:23446865-23446887 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1135659363 16:24281309-24281331 CCTCAGCCTCTGGAGTAGCCAGG + Intronic
1135712935 16:24733176-24733198 TTTCACTCTGTCAAGTAGGCTGG - Intronic
1135760027 16:25130222-25130244 CCTCAGCCTCCGAAGTAGGTGGG - Intronic
1136044475 16:27604347-27604369 ACTCAGCCTGTGAAGTAGCTTGG + Intronic
1136137840 16:28268270-28268292 TCTCACCCTGTCAACTAGGCTGG + Intergenic
1136346975 16:29682143-29682165 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1136511938 16:30743581-30743603 GGCCACCCTGAGAAGTAGGCAGG + Intronic
1137428005 16:48396011-48396033 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1137443543 16:48516671-48516693 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1137663321 16:50228900-50228922 CCACACACTGTTAAGAAGGCGGG + Intronic
1137734213 16:50712077-50712099 CCTCACCCGGTGCAGCTGGCGGG - Exonic
1137766137 16:50979168-50979190 CCTGGCCCTGTAAGGTAGGCTGG + Intergenic
1137976718 16:53038375-53038397 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1138002898 16:53300321-53300343 TCTCACCCTGTCACCTAGGCTGG - Intronic
1138084130 16:54118387-54118409 TCTCACCCTGTCACGTAGGCTGG + Exonic
1138323316 16:56138206-56138228 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1138452615 16:57102715-57102737 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1138904586 16:61315350-61315372 CCTCAGCCTCTCAAGTAGCCGGG - Intergenic
1139094793 16:63692531-63692553 CCTCACCCTGACAAGTAGCTGGG + Intergenic
1139206319 16:65032458-65032480 CCTCATCCTGTCACCTAGGCTGG - Intronic
1139295033 16:65893245-65893267 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1139535586 16:67570773-67570795 TCTCACTCTGTCAAGCAGGCTGG + Intronic
1139644264 16:68316648-68316670 CCTCAGCCTCTCAAGTAAGCTGG - Intronic
1139769902 16:69265795-69265817 ACTCACCCTGTCACCTAGGCTGG - Intronic
1139839779 16:69869002-69869024 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1139841610 16:69886110-69886132 TCTCACCCTGTCACCTAGGCTGG + Intronic
1139895864 16:70287711-70287733 TCTCACCCTGTTACCTAGGCTGG - Intronic
1139987356 16:70909809-70909831 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1140186514 16:72777762-72777784 CCTCACCCTGTGCTGTGGCCTGG - Intergenic
1140346076 16:74214403-74214425 TCTCACCCTGTTACCTAGGCTGG + Intergenic
1140514858 16:75534526-75534548 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1140710508 16:77672946-77672968 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
1141093158 16:81144319-81144341 TCTCACCCTGTCAACCAGGCTGG + Intergenic
1141405518 16:83789460-83789482 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1141520456 16:84575471-84575493 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1141646982 16:85372824-85372846 CCACACCCTGGGAGGTGGGCAGG + Intergenic
1141818371 16:86428450-86428472 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1142054929 16:87987793-87987815 TCTCACTCTGTGATGCAGGCTGG + Intronic
1142528757 17:564422-564444 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1143053988 17:4148980-4149002 TCTCACCCTGTCACGCAGGCTGG + Intronic
1143489628 17:7278324-7278346 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1143641913 17:8203814-8203836 TCTCACCCTGTCATGCAGGCTGG - Intergenic
1143898317 17:10154472-10154494 CCTCACCCTGTCATCTAAGCTGG - Intronic
1144084905 17:11799697-11799719 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1144108462 17:12008448-12008470 CCTCAGCCTGTCAAGTAGCTAGG + Intergenic
1144173098 17:12678809-12678831 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1144328856 17:14206656-14206678 AGCCACCCTGTGATGTAGGCAGG + Intronic
1144712099 17:17408256-17408278 CCTCACTCTGTCACCTAGGCTGG - Intergenic
1144800869 17:17926053-17926075 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1144807080 17:17975325-17975347 CCTCAGCCTGTCAAGTAGCTGGG + Intronic
1144939100 17:18924737-18924759 CCTCACCCTGTCACCCAGGCTGG - Intronic
1145033946 17:19527059-19527081 CCTCACTCTGTCATCTAGGCTGG + Intronic
1145119048 17:20239921-20239943 CCTCACTCTGTCACCTAGGCTGG + Intronic
1145257292 17:21333273-21333295 CCTCAGCCTGTGAAGTTGCTGGG + Intergenic
1145319348 17:21754761-21754783 CCTCAGCCTGTGAAGTTGCTGGG - Intergenic
1145763803 17:27444091-27444113 CCTCACCCTCTGGAGTAGCTAGG + Intergenic
1145822960 17:27854284-27854306 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1146021192 17:29280654-29280676 TCTCACCCTGTGACTCAGGCTGG - Intronic
1146357433 17:32145984-32146006 TCTCACCCTGTCAACCAGGCTGG - Intronic
1146358460 17:32154966-32154988 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1146713901 17:35067571-35067593 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1146714269 17:35071080-35071102 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1146821847 17:35989707-35989729 CCTCACCCTCTGGAGTAGCTGGG + Intronic
1147037369 17:37691810-37691832 CCTCACCCAGTGAAGAAGCTGGG + Intronic
1147606086 17:41774447-41774469 CCTCAACCTCTGAAGTAGCTGGG + Intronic
1147615721 17:41826124-41826146 CCTCACTCTGTCACCTAGGCTGG - Intronic
1147706198 17:42426463-42426485 CCTCACCCTCTCAAGTAGCTTGG + Intergenic
1147813510 17:43191222-43191244 TCTCACTCTGTCATGTAGGCTGG - Intronic
1147908016 17:43835455-43835477 CCTCACCCTGTGGCCCAGGCTGG - Intergenic
1148066595 17:44875412-44875434 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
1148391927 17:47279050-47279072 ACCAACCCTGTGAAATAGGCAGG + Intronic
1148396080 17:47309161-47309183 CCTCACCCTCCCAAGTAGCCAGG + Intronic
1148573798 17:48693198-48693220 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1148664411 17:49363457-49363479 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1148777178 17:50102257-50102279 CCTGGCCCTGTGAGGGAGGCTGG + Intronic
1148819909 17:50354355-50354377 CCCCACCCTGTGACCTAGGGTGG + Intronic
1149141955 17:53441843-53441865 CCTCAGCCTCTGAAGTAGTTGGG + Intergenic
1149377270 17:56057668-56057690 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1149427481 17:56569253-56569275 CCTGCCCCTGTGAAGCAGGCAGG + Intergenic
1150052555 17:61979337-61979359 TCTCACTCTGTCAAATAGGCTGG + Intronic
1150278145 17:63913048-63913070 CCTCACCCTGTTTAGTAGCTGGG + Intronic
1150350560 17:64441093-64441115 CCTCAGCCTCTAAAGTAGGTGGG + Intergenic
1150407567 17:64915980-64916002 CCTCAGCCTCTGAAGTAGTTAGG - Intronic
1150542150 17:66112828-66112850 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
1150555878 17:66253607-66253629 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1150659247 17:67061244-67061266 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
1150744448 17:67805087-67805109 CCTCAGCCTATGAAGTAGCTAGG - Intergenic
1150848197 17:68680344-68680366 CATCACCCTCTCAAGTAGGTAGG + Intergenic
1150966917 17:69981300-69981322 CCTCACCCGGAGAAGTAGTTGGG + Intergenic
1151403638 17:73872631-73872653 CCTCACTCTGTCACTTAGGCTGG - Intergenic
1151677872 17:75608847-75608869 CCTCAGCCTATGAAGTAGCTGGG + Intergenic
1151737141 17:75950359-75950381 CCTCAGCCTCCCAAGTAGGCCGG + Intronic
1151808989 17:76424898-76424920 CCTCACCCTGTCACCCAGGCTGG + Intronic
1151843249 17:76632743-76632765 CCTGACCCTGTGAGCTGGGCTGG + Intronic
1151922356 17:77166721-77166743 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1152102473 17:78310359-78310381 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1152400360 17:80062693-80062715 CCTCAGCCTCTCAAGTAGGTAGG + Intronic
1152752507 17:82070374-82070396 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1153267960 18:3289991-3290013 CCTCAGCCTCCCAAGTAGGCGGG + Intergenic
1153272526 18:3336694-3336716 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1153300412 18:3587168-3587190 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1153876681 18:9378863-9378885 CCTCAGCCTCTGTAGTAGGTAGG - Intronic
1153908197 18:9682572-9682594 TCTCACTCTGTGACTTAGGCTGG + Intergenic
1154017771 18:10635618-10635640 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1154142393 18:11836114-11836136 CCTCACCCTGTCACTTAAGCTGG - Intronic
1154301809 18:13200749-13200771 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1154450255 18:14469892-14469914 CCCCATCCTGTGAGGTAGACAGG - Intergenic
1154936789 18:21067501-21067523 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1154943878 18:21141425-21141447 CCTCAGCCTCCCAAGTAGGCGGG - Intergenic
1155006379 18:21733368-21733390 CCTCAGCCCCTGAAGTAGGTGGG + Intronic
1155019343 18:21880701-21880723 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1155412530 18:25562458-25562480 TCTCACCCTGTCAACCAGGCTGG + Intergenic
1155847755 18:30731049-30731071 CCTCCCCCTGGGAACTCGGCAGG - Intergenic
1155969053 18:32064108-32064130 CCTCAGCCTCTGGAGTAGCCAGG + Intronic
1155969118 18:32064632-32064654 CCTCAGCCTGCCAAGTAGGTGGG + Intronic
1156103224 18:33624126-33624148 CCTCACTCTGTCACCTAGGCTGG - Intronic
1156463808 18:37336251-37336273 CCTCACTCTGTCACGCAGGCTGG + Intronic
1156638250 18:39057429-39057451 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1156705920 18:39882346-39882368 CCTCAGCCTCTGGAGTAGGTGGG + Intergenic
1157216798 18:45790725-45790747 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1157227828 18:45883574-45883596 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1157833971 18:50882112-50882134 CCTCAGCCTCTGAAGTAGCCAGG + Intronic
1158088462 18:53682386-53682408 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1158990319 18:62862193-62862215 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1159076409 18:63686316-63686338 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
1159256840 18:65957884-65957906 CCTCAGCCTCTCAAGTAGCCAGG + Intergenic
1159475008 18:68910175-68910197 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
1159790866 18:72777625-72777647 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1160347553 18:78146236-78146258 CCGCACACTGTGAACTACGCTGG + Intergenic
1160456369 18:79005146-79005168 TCTCACCCTGTGACCCAGGCTGG - Intergenic
1160482698 18:79257182-79257204 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1160984814 19:1833659-1833681 CCTCCCCCAGTGAAGTGGGCCGG - Intronic
1161188604 19:2939862-2939884 CCTCACCCTCCTAAGTAGCCGGG - Intronic
1161259246 19:3327468-3327490 CCTCAGCCTCTGGAGTAGGTGGG + Intergenic
1161463178 19:4411343-4411365 CCTCACCCTCTCAAGTAGCTGGG + Intronic
1161545324 19:4877124-4877146 CCTCAGCCTCCGAAGTAGCCGGG - Intergenic
1161722649 19:5912108-5912130 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1161787189 19:6333993-6334015 CCTCAGCCTCTGAAGTAGCCAGG + Intergenic
1161805883 19:6442662-6442684 CCTCAGCCTGCCAAGTAGCCGGG + Intronic
1162415683 19:10535521-10535543 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1162455046 19:10778534-10778556 CCTCAGCCTCTTAAGTAGGTGGG - Intronic
1162458399 19:10799647-10799669 CCTCAGCCTCCGAAGTAGCCAGG + Intronic
1162815352 19:13190970-13190992 CCTCAGCCTCCGAAGTAGCCGGG + Intergenic
1162986064 19:14270911-14270933 CCTCACCCTCTGAAGTAGCTAGG + Intergenic
1163040196 19:14596516-14596538 CCTCACCCTTTCAAGTAGCTGGG - Intronic
1163102078 19:15103994-15104016 CCTCAACCTCTCAAGTAGGTGGG - Intergenic
1163197117 19:15730103-15730125 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1163341815 19:16713234-16713256 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
1163489400 19:17607995-17608017 CCTCACCCTCTGGAGTAGCTGGG + Intronic
1163579004 19:18127132-18127154 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1163627674 19:18399674-18399696 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1163804910 19:19389876-19389898 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1163811298 19:19433882-19433904 CCTCAACCTGAGAAGTAGCTGGG + Intronic
1163905143 19:20145701-20145723 CCTCACCCTCCCAAGTAGGTGGG + Intergenic
1163947029 19:20547263-20547285 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1164041823 19:21499343-21499365 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1164080281 19:21856375-21856397 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1164458810 19:28430462-28430484 CCTCAGCCTGCCAAGTAGCCGGG + Intergenic
1164785247 19:30925377-30925399 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1164973437 19:32551748-32551770 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1165000040 19:32753451-32753473 CCTCACCCTCTCAAGTAGTTGGG + Intronic
1165155336 19:33783603-33783625 CCTCAGCCTGTGGAGTAGCTGGG - Intergenic
1165617583 19:37215593-37215615 CCTCAACATCTAAAGTAGGCAGG - Intronic
1165762320 19:38328729-38328751 CCTCAGCCTCTGAAGTAGCCAGG - Exonic
1165899485 19:39162286-39162308 TCTCACCCTGTCACCTAGGCTGG + Intronic
1165971141 19:39631205-39631227 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
1166046372 19:40233166-40233188 CCTCACCCTATGGATGAGGCAGG - Exonic
1166152939 19:40887618-40887640 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1166475816 19:43123833-43123855 TCTCAGCCTCTGAAGTAGGTAGG + Intronic
1166804253 19:45475604-45475626 CCTCAACCTCTCAAGTAGCCTGG - Intronic
1166946263 19:46398442-46398464 CCTCAGCCTCTGGAGTAGCCGGG - Intergenic
1167060818 19:47144945-47144967 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1167138852 19:47635361-47635383 CCTCACTCTATCAAGTAGGCGGG + Intronic
1167196316 19:48031422-48031444 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1167297492 19:48660243-48660265 CCTCAGCCTCTCAAGTAGCCGGG - Intergenic
1167490556 19:49790512-49790534 CCTCAGCCTGCCAAGTAGGTGGG + Intronic
1167624943 19:50581779-50581801 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1167682994 19:50936831-50936853 CCTCAGCCTCTGAAGTAGTTGGG + Intergenic
1167686009 19:50957214-50957236 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1167700311 19:51039806-51039828 CCTCAGCCTCTCAAGTAGTCGGG + Intergenic
1167959716 19:53096101-53096123 CCTCACCCTCTGGAGTAGCTGGG - Intronic
1168156270 19:54474573-54474595 CCTCAGCCTGTTGAGTAGCCGGG + Intergenic
1168221978 19:54966955-54966977 CCTCAGCCTTTGAAGTAGCTGGG + Intronic
1168225666 19:54993102-54993124 CCTCACCCTCCCAAGTAAGCTGG - Intronic
925122103 2:1427396-1427418 CCAGACCCTGTGAGGGAGGCAGG + Intronic
925373418 2:3363653-3363675 TCTCACTCTGTCAAGCAGGCTGG - Intronic
925766810 2:7244408-7244430 CCTCACCCTGTCACCCAGGCTGG + Intergenic
925932939 2:8724654-8724676 CCTCACCCTGTAACCCAGGCTGG + Intergenic
926417326 2:12662627-12662649 TTCCACCCTGTGAGGTAGGCAGG + Intergenic
926995378 2:18729762-18729784 TCTCACTCTGTCAACTAGGCTGG - Intergenic
926997538 2:18752986-18753008 CCTCAAGCTGTGAAGAAGTCTGG - Intergenic
927179234 2:20432623-20432645 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
927424485 2:22966722-22966744 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
927524190 2:23721883-23721905 CCTCAATCTGAGAAGCAGGCTGG + Intergenic
927748592 2:25645265-25645287 CCTCACCCTCTCAAGTAGCTGGG - Intronic
928041623 2:27883754-27883776 CATCACCCTGTTACCTAGGCTGG + Intronic
928084610 2:28337955-28337977 CCTCACTCTGTGAGCCAGGCTGG - Intronic
928298701 2:30107219-30107241 CCTCACCCTCCCAAGTAGGTGGG - Intergenic
928899528 2:36302357-36302379 CCTCACCATGTTGACTAGGCTGG - Intergenic
929003397 2:37370153-37370175 CCTCACCCTGTCACCCAGGCTGG - Intronic
929164864 2:38871820-38871842 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
929183537 2:39069257-39069279 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
929186384 2:39099852-39099874 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
929500714 2:42489272-42489294 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
929503216 2:42507813-42507835 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
929660860 2:43782864-43782886 CCTCACCCTCTCAAGTAGCTGGG - Intronic
929711569 2:44272003-44272025 CCTCACTCTGTCACCTAGGCTGG + Intergenic
929888966 2:45904017-45904039 CCTCACCCTTTGGAGTAGCTGGG + Intronic
930121866 2:47767221-47767243 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
930140644 2:47948235-47948257 TCTCACTCTGTCATGTAGGCTGG - Intergenic
930163343 2:48180047-48180069 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
930211573 2:48644053-48644075 CCTCAGCCTCTCAAGTAGCCAGG - Intronic
930765500 2:55081187-55081209 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
930778627 2:55200106-55200128 ACTCACCCTGTCAAGTAGCTGGG - Intronic
931084878 2:58818905-58818927 CCTCAACCTCTGAAGTAGCTGGG + Intergenic
931214654 2:60229581-60229603 ATGCACGCTGTGAAGTAGGCAGG + Intergenic
931277254 2:60754782-60754804 CCTCACCCTGCTGAGTAGCCGGG + Intergenic
931294421 2:60907517-60907539 CCTCAGCCTCTGGAGCAGGCTGG - Intronic
931302394 2:60993339-60993361 CCTCAGCCTGTCAAGTAGCGGGG - Intronic
931308866 2:61059348-61059370 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
931378997 2:61734830-61734852 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
931411841 2:62040222-62040244 TCTCACTCTGTCACGTAGGCTGG - Intronic
931582787 2:63795413-63795435 CCTCACCCTCTCAAGTAGCTGGG - Intronic
931725564 2:65107179-65107201 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
931796209 2:65712369-65712391 CCTCACCCTGTCACCCAGGCTGG + Intergenic
932039969 2:68289085-68289107 AACCACCCTGTGAGGTAGGCAGG - Intronic
932155302 2:69411706-69411728 CCTCAGCTTGTCAAGTAGGTGGG + Intronic
932653508 2:73585842-73585864 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
932748124 2:74352124-74352146 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
932815094 2:74855110-74855132 CCTCACCCTCTGGAGTAGCTGGG + Intronic
932940630 2:76160588-76160610 CCTCACTCTGTCAACCAGGCTGG - Intergenic
933281573 2:80337859-80337881 CCCCACCATGGGAAGTGGGCTGG + Intronic
933375400 2:81473757-81473779 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
933599809 2:84317888-84317910 CCTCAGCCTCTGGAGTAGCCGGG + Intergenic
933764929 2:85700566-85700588 CCTCAGCCTCTGAAGTAGCTTGG + Intergenic
933920298 2:87039197-87039219 TCTCACCCTGTCACCTAGGCTGG - Intergenic
933931326 2:87154589-87154611 TCTCACCCTGTCACCTAGGCTGG + Intergenic
933989831 2:87626270-87626292 CCTCAGCCTCCGAAGTAGCCAGG + Intergenic
934002699 2:87730697-87730719 TCTCACCCTGTCACCTAGGCTGG + Intergenic
934509227 2:94923682-94923704 CCTCACCCTCTGAAGTAGCTGGG - Intergenic
934583530 2:95467379-95467401 CCTCAGCCTATGGAGTAGTCAGG - Intergenic
934595922 2:95609335-95609357 CCTCAGCCTATGGAGTAGTCAGG + Intergenic
934671399 2:96215668-96215690 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
934673304 2:96230891-96230913 TCTCACCCTGTCACCTAGGCTGG + Intergenic
934728846 2:96643463-96643485 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
934783421 2:96987258-96987280 CCTCAGCCTCTGAAGTAGTTGGG - Intronic
934786855 2:97016144-97016166 CCTCAGCCTATGGAGTAGTCAGG - Intronic
936304014 2:111324554-111324576 CCTCAGCCTCCGAAGTAGCCAGG - Intergenic
936361795 2:111810851-111810873 TCTCACCCTGTCACCTAGGCTGG - Intronic
936431205 2:112465232-112465254 CCTCACCCTCTGGAGTAGCTGGG - Intergenic
936455727 2:112672595-112672617 CCTCACTCTGTCACCTAGGCTGG + Intergenic
936775577 2:115968493-115968515 CCTCAGCCTCCCAAGTAGGCTGG + Intergenic
937317860 2:120943455-120943477 AGTCACCCTGAGAAGCAGGCAGG + Intronic
937413911 2:121699313-121699335 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
937420809 2:121753757-121753779 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
937844985 2:126569736-126569758 TCTCACCCTGTCAACCAGGCTGG - Intergenic
938280402 2:130059997-130060019 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938281118 2:130064327-130064349 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938281557 2:130067071-130067093 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938281685 2:130067881-130067903 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938331986 2:130454439-130454461 CCTCACCCACTGAAGGAAGCAGG - Intergenic
938358025 2:130667400-130667422 CCTCACCCACTGAAGGAAGCAGG + Intergenic
938439542 2:131316401-131316423 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
938477977 2:131633671-131633693 CCTCACCCACTGAAGGAAGCAGG + Intergenic
938481161 2:131662815-131662837 CCCCATCCTGTGAGGTAGACGGG + Intergenic
938872544 2:135495196-135495218 TCTCACTCTGTCACGTAGGCTGG - Intronic
939154280 2:138505657-138505679 CCTCACCCTCCCAAGTAGCCGGG - Intronic
939268501 2:139907804-139907826 CCTCAGCCTCTCAAGTAGGAAGG + Intergenic
940094826 2:149962622-149962644 CCTCTCCCTGGGAACTCGGCAGG + Intergenic
940469126 2:154070883-154070905 TCTCACTCTGTCAACTAGGCTGG - Intronic
940744654 2:157554151-157554173 TCTCACCCTGTTACCTAGGCTGG - Intronic
940783380 2:157957280-157957302 CCTCAGCCTCTTAAGTAGGTAGG + Intronic
940835359 2:158515367-158515389 CCTCAGACTCTCAAGTAGGCTGG - Intronic
941586229 2:167362969-167362991 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
941595270 2:167468753-167468775 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
941839005 2:170058629-170058651 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
941863258 2:170307211-170307233 CCTCACTCTGTCACCTAGGCTGG - Intronic
941976827 2:171414696-171414718 CCTCACTCTGTCACCTAGGCTGG - Intronic
942050100 2:172131788-172131810 TCTCACTCTGTCACGTAGGCTGG - Intergenic
942219511 2:173755706-173755728 CCTCAGCCTCTGGAGTAGCCGGG + Intergenic
942231355 2:173863522-173863544 CCTCACCCTGTCACCCAGGCTGG + Intergenic
942251788 2:174053641-174053663 CCTCCCCCATTGAAGCAGGCGGG + Intergenic
942548729 2:177092253-177092275 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
942644884 2:178099320-178099342 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
942751126 2:179288554-179288576 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
942942007 2:181630151-181630173 CCTCACCCTCTTGAGTAGGTGGG + Intronic
942990503 2:182195333-182195355 AATCATCCTGGGAAGTAGGCAGG + Intronic
943120589 2:183730159-183730181 CCTCAGCCTCTTAAGTAGGTAGG + Intergenic
943575623 2:189627538-189627560 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
943950153 2:194123490-194123512 CCTCACTCTGTCACGCAGGCTGG - Intergenic
944550581 2:200841094-200841116 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
944558206 2:200908334-200908356 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
944616160 2:201463219-201463241 CCTCAGCCTCCCAAGTAGGCGGG - Intronic
944644506 2:201765111-201765133 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
944710349 2:202329827-202329849 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
944733245 2:202536140-202536162 CCTCACTCTGTCACCTAGGCTGG + Intronic
944735520 2:202559184-202559206 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
944805692 2:203278762-203278784 CCTCACCCTCTCAAGTAGCTGGG - Intronic
944888549 2:204091436-204091458 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
945093700 2:206199709-206199731 CCTCACCCTCCCAAGTAGCCAGG + Intronic
945296211 2:208173980-208174002 CCTCACCCTGTCACCCAGGCTGG + Intronic
945420454 2:209629842-209629864 ACTCAGCCTGTTAAGTAGGAGGG - Intronic
945679343 2:212894587-212894609 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
945771913 2:214054123-214054145 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
945856030 2:215071079-215071101 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
945876659 2:215285028-215285050 CCTCACCCTGTTAAGTTGCTGGG + Intergenic
945903922 2:215569434-215569456 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
946738539 2:222778295-222778317 CCTCACCCTCTGGAGTAGCTAGG - Intergenic
946936699 2:224729205-224729227 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
947288598 2:228546194-228546216 TCTGACCCTGTGAAGTAGGATGG - Intergenic
947496150 2:230638771-230638793 CCTCACCCTCTCAAGTAGTTGGG - Intergenic
947501206 2:230672510-230672532 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
947723659 2:232383541-232383563 CCTCACCCTCCCAAGTAGCCAGG + Intergenic
948470917 2:238178209-238178231 TCTCACTCTGTCAACTAGGCTGG + Intronic
948490735 2:238311076-238311098 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
948582651 2:238998404-238998426 TCTCACCCTGTCACCTAGGCTGG + Intergenic
949057201 2:241934611-241934633 CTTCAGACTGTGAAGTTGGCGGG + Intergenic
1169094266 20:2882403-2882425 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
1169150993 20:3289326-3289348 CCTGACCCTCCCAAGTAGGCAGG - Intronic
1169264019 20:4156770-4156792 CCTCACTCTGTCACGCAGGCTGG + Intronic
1169321939 20:4640324-4640346 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1169695818 20:8385548-8385570 CCTCCCCCTGGGAACTTGGCAGG + Intronic
1169761215 20:9097048-9097070 CCTTAGCCTCTGAAGTAGGTGGG + Intronic
1169782226 20:9321975-9321997 CCTCACTCTGTCACCTAGGCTGG + Intronic
1170111346 20:12807437-12807459 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1170477038 20:16725818-16725840 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1170561678 20:17563768-17563790 CCTCAGCCTGTCAAGTAGCTAGG - Intronic
1170569289 20:17623814-17623836 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1170712388 20:18803256-18803278 TCTCACTCTGTCAAGCAGGCTGG - Intergenic
1170815648 20:19712060-19712082 CCTCACCCTTTCAAGTAGCTGGG + Intronic
1170884960 20:20332477-20332499 GCTCACCCAGTGTAGTAAGCAGG + Intronic
1171241003 20:23566856-23566878 TCTCACCCTGTCAACCAGGCTGG - Intronic
1172105404 20:32514374-32514396 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1172139291 20:32710697-32710719 TCTCACCCTGTTACATAGGCTGG - Intronic
1172228417 20:33320703-33320725 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
1172365145 20:34343415-34343437 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1172454445 20:35056868-35056890 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1172620848 20:36317567-36317589 CCTCAGCCTCTGGAGTAGCCAGG + Intronic
1172679649 20:36702802-36702824 CCTCAGCCTCTCAAGTAGCCGGG + Intronic
1172719621 20:36989722-36989744 CCTCACCCTCCCAAGTAGGTGGG - Intergenic
1172748234 20:37230171-37230193 TCACACCCTGTGGATTAGGCAGG + Intronic
1172895554 20:38297339-38297361 CCTCAGCCTGTCAAGTAGTTGGG - Intronic
1172960610 20:38796487-38796509 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1173256724 20:41399030-41399052 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1173272832 20:41554113-41554135 CCTCACTCTGTCACCTAGGCTGG - Intronic
1173281804 20:41635027-41635049 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
1173567692 20:44053303-44053325 CTTGACCCTGTGAAGTGGGGAGG - Intronic
1173868744 20:46329076-46329098 CCCAACCCTGGGAAGCAGGCAGG + Intergenic
1174323519 20:49761098-49761120 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1174477581 20:50807221-50807243 CCTCACTCTGTCACCTAGGCTGG + Intronic
1174517305 20:51102446-51102468 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1174807244 20:53615366-53615388 CCTCAGCCTATGAAGTAGCTGGG + Intergenic
1174947129 20:55000094-55000116 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1176064935 20:63189363-63189385 AGTCACCCTCTGCAGTAGGCAGG + Intergenic
1176136754 20:63526184-63526206 CCTCACCCTGTCACCGAGGCTGG - Intergenic
1176605785 21:8829526-8829548 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1176641699 21:9310600-9310622 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1176726739 21:10442086-10442108 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
1176886445 21:14261409-14261431 CCTCTTCCTGTGAAGTAACCTGG + Intergenic
1177382226 21:20359659-20359681 CCTCAGCCTCTTAAGTAGCCTGG - Intergenic
1177972554 21:27808502-27808524 TCTCACCCTGTCACGCAGGCTGG - Intergenic
1178302823 21:31467214-31467236 CCTCAGCCTCTGAAGTAGCCAGG - Intronic
1178496728 21:33092657-33092679 CCTCAGCCTCCGAAGTAGGTAGG + Intergenic
1178692234 21:34759743-34759765 CCTCACTCTGTCACCTAGGCTGG - Intergenic
1178833352 21:36074872-36074894 CCTCACCCTCAGAGGTAAGCAGG - Intronic
1179181012 21:39045390-39045412 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1179220342 21:39401163-39401185 CCTCAGCCTGCTAAGTAGGTGGG + Intronic
1179478614 21:41663833-41663855 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1179840368 21:44068714-44068736 CCTCAGCCAGTCAAGTAGCCAGG + Intronic
1180112231 21:45665376-45665398 TCTCACTCTGTGACATAGGCCGG - Intronic
1180287650 22:10764995-10765017 CCTCAGCCTCTCAAGTAGCCGGG - Intergenic
1180348083 22:11721131-11721153 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1180350715 22:11799956-11799978 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1180355858 22:11839228-11839250 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1180382398 22:12153097-12153119 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1180387495 22:12192126-12192148 CCTCACCCTCTGAAGTAGCTGGG + Intergenic
1180431768 22:15258903-15258925 CCTCACTCTGTCAACCAGGCTGG - Intergenic
1180632772 22:17241319-17241341 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1181101183 22:20540456-20540478 CCTCAGCCTGTCGATTAGGCAGG - Intronic
1181155093 22:20915274-20915296 CCTCAGCCTGCCAAGTAGGTGGG - Intergenic
1181160840 22:20958608-20958630 CCTCAGCCTGTGGAGTAGCTGGG - Intergenic
1181893900 22:26089297-26089319 CCTCAGCCTGTTAAGTAGCTGGG + Intergenic
1182232020 22:28845563-28845585 CCTCAGCCTGCGAAGTAGCTGGG + Intergenic
1182245600 22:28955154-28955176 CCTCACCCTCTGGAGTAGCTGGG + Intronic
1182374914 22:29839560-29839582 CCTCAGCCTCCCAAGTAGGCAGG + Intergenic
1182500523 22:30743468-30743490 CATCACCCAGTGAAGGAGGCAGG + Intronic
1182590788 22:31378028-31378050 CTTCACCCTCTGAAGTAGCTGGG + Intergenic
1182647233 22:31820139-31820161 TCTCACTCTGTTACGTAGGCTGG + Intronic
1183080948 22:35456175-35456197 CCTCACTCTGTCATCTAGGCTGG + Intergenic
1183132688 22:35854476-35854498 CCTCAGCCTCCGAAGTAGGTGGG - Intronic
1183292874 22:37013487-37013509 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1183584437 22:38744463-38744485 CATCAGCCTGTGAAGTAGCTGGG - Intronic
1183842079 22:40507243-40507265 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1183963794 22:41429144-41429166 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
1184050786 22:42002557-42002579 CCTCACCCTGTTACCCAGGCTGG - Intronic
1184150976 22:42638278-42638300 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1184159070 22:42687306-42687328 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1184197463 22:42939780-42939802 GTTCACCCTGAGAACTAGGCTGG - Intronic
1184253809 22:43275954-43275976 CCACAACCTTTGAAGAAGGCAGG + Intronic
1184278290 22:43422950-43422972 CCTCACCCTCTCAAGTAGCTGGG + Intronic
1184914836 22:47562375-47562397 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1185177901 22:49340548-49340570 CCTCACCCTGGCAAGAAGGTTGG - Intergenic
949478234 3:4468844-4468866 CCTCAGCCTCCGAAGTAGCCAGG - Intergenic
949863530 3:8528302-8528324 CCTCAGCCTCTCAAGTAAGCTGG + Intronic
949865485 3:8543596-8543618 CCTCAGCCACTGAAGTAGCCAGG + Intronic
950046877 3:9953666-9953688 CCTCAGCCTCTGGAGTAGGTAGG - Intergenic
950232122 3:11285207-11285229 TCTCACCCTGTCACGCAGGCTGG + Intronic
950286376 3:11748492-11748514 CCTCACCCTCCCAAGTAGCCGGG + Intergenic
950292971 3:11802100-11802122 CCTCAGCCTTTCAAGTAGGTGGG - Intronic
950761231 3:15229689-15229711 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
950783732 3:15414804-15414826 CCTCAGCCTCTGAAGTAGTTGGG - Intronic
950994354 3:17479877-17479899 CCTCTTCCTATCAAGTAGGCAGG + Intronic
951518296 3:23586408-23586430 CCTCAGCCTCTCAAGTAGGCTGG + Intronic
951528079 3:23672545-23672567 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
951727884 3:25780734-25780756 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
951780594 3:26358805-26358827 CCTCAGCCTGTTAAGTAGCTGGG + Intergenic
951797488 3:26556693-26556715 CCTCAGCCTCTGGAGTAGGTAGG - Intergenic
951937780 3:28040937-28040959 CCTCACCCTCTTAAGTAGCTGGG - Intergenic
952767718 3:36969547-36969569 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
952796802 3:37246189-37246211 CCTCAGCCTCTGGAGTAGCCAGG - Intronic
952944405 3:38467992-38468014 CCTCAGCCTTTGAAGTAGCTAGG + Intronic
953104004 3:39857181-39857203 CCTCACCCTGTCACTCAGGCTGG - Intronic
953165321 3:40459741-40459763 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
953901863 3:46848039-46848061 ACTCACCCTGTCACCTAGGCTGG + Intergenic
953964246 3:47290655-47290677 CCTCACCTTGTGGTCTAGGCTGG + Intronic
953988604 3:47465651-47465673 CCTCAGCCTGCTAAGTAGGTGGG - Intronic
954102719 3:48389406-48389428 TCTCACTCTGTCACGTAGGCTGG + Intronic
954191217 3:48962982-48963004 CCTCAGCCTATGAAGTAGCTGGG + Intronic
954250544 3:49363931-49363953 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
954337117 3:49925621-49925643 CCTCAGCCTCTTAAGTAGGTGGG - Intronic
954355310 3:50080051-50080073 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
954975188 3:54687168-54687190 CCTCACCCTGTCACCCAGGCTGG + Intronic
955019589 3:55106432-55106454 CCCCACTCCGTGAGGTAGGCTGG + Intergenic
955085723 3:55700718-55700740 CCTCACCCTGTCCTGGAGGCTGG + Intronic
955765446 3:62339876-62339898 CCTCACCCTGTCATCCAGGCTGG + Intergenic
956111868 3:65878079-65878101 CCTCACTCTGTCACGTAGGCTGG - Intronic
956191589 3:66613219-66613241 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
956383868 3:68696003-68696025 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
956440805 3:69278700-69278722 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
956618812 3:71199708-71199730 TCTCACCCTGTCACCTAGGCTGG - Intronic
956961464 3:74407382-74407404 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
957055441 3:75439109-75439131 CCTCACCCTGTCACCCAGGCTGG - Intergenic
957058328 3:75461325-75461347 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
957164748 3:76657949-76657971 CCTCAGCCTCTGGAGTAGGTAGG - Intronic
957457694 3:80473127-80473149 CCTCAGCCTGTGAAAGAAGCTGG + Intergenic
957845723 3:85732143-85732165 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
958009558 3:87859080-87859102 CCTCAGCCTCCCAAGTAGGCTGG - Intergenic
958121500 3:89295704-89295726 CCTCAGCCTGTCAAGTAGCTGGG + Intronic
959039312 3:101402504-101402526 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
959057600 3:101583498-101583520 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
959091110 3:101904048-101904070 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
959145931 3:102544605-102544627 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
959675056 3:109025495-109025517 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
960130174 3:114047545-114047567 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
960400824 3:117196078-117196100 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
960904816 3:122589999-122590021 CCTCACCCTCTCAAGTAGCTGGG + Intronic
960913160 3:122669322-122669344 CCTCAGCCTGTTAAGTAGCTAGG + Intergenic
960960282 3:123066056-123066078 TCTCACCCTGTGGCCTAGGCTGG + Intergenic
961156417 3:124683458-124683480 CCCCATCCTGTGATGTAGGCAGG - Intronic
961183543 3:124895340-124895362 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
961208202 3:125104219-125104241 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
961524743 3:127489548-127489570 CCTCACCCGGTCTAGTAGGGAGG + Intergenic
961798845 3:129428929-129428951 CCTAACCCTCTGGAGGAGGCAGG - Intergenic
961803609 3:129472180-129472202 CCTCACCCTGTTACCCAGGCTGG + Intronic
961889115 3:130115506-130115528 CCTCACCCTGTCACCCAGGCTGG - Intergenic
962240789 3:133749129-133749151 CCTCACTCTGTCACCTAGGCTGG - Intronic
962713440 3:138106972-138106994 TAGCACCCTGTGAGGTAGGCAGG - Intronic
962780454 3:138710152-138710174 CCTCACCCTGTCACCCAGGCTGG - Intronic
963034837 3:141016824-141016846 TCTCACCCTGTCAACCAGGCTGG - Intergenic
963047557 3:141113970-141113992 CCTCAGCCTCTCAAGTAGCCAGG - Intronic
963104745 3:141637512-141637534 CCTCAGCCTCCCAAGTAGGCTGG + Intergenic
963155061 3:142087528-142087550 CCTCACTCTGTCACCTAGGCTGG + Intronic
963685479 3:148428185-148428207 CCTCACCCTCTCAAGTAGCTAGG - Intergenic
964108557 3:153065349-153065371 CCTCACTCTGTCACGCAGGCTGG + Intergenic
964298062 3:155255940-155255962 TCTCACCCTGTCACCTAGGCTGG + Intergenic
964574947 3:158155545-158155567 CCTCACCCTCTCAAGTAGGTGGG + Intronic
964780980 3:160337592-160337614 TCTCACCCTGTCACCTAGGCTGG - Intronic
965200434 3:165649900-165649922 CCTCACCTTCTGAAGTAGCTGGG - Intergenic
965663302 3:171065079-171065101 CCACACCCTTAGGAGTAGGCTGG - Intronic
965976850 3:174635616-174635638 CCTCAGCCTGTCAAGTAGCTGGG + Intronic
966243523 3:177780982-177781004 CCTCAACCTCTGAAGTAGCTGGG + Intergenic
966392802 3:179470572-179470594 CCTCACTCTGTCACCTAGGCTGG + Intergenic
966599448 3:181760854-181760876 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
966889582 3:184397128-184397150 CCTCACCCTCTTAAGTAGCTGGG - Intronic
966905287 3:184519655-184519677 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
966926240 3:184646365-184646387 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
967011410 3:185438178-185438200 CCTCAGCCTCTTAAGTAGGTAGG - Intronic
967064703 3:185904564-185904586 CCTCAGCCTGTAAAGTAGCTGGG + Intergenic
967251587 3:187545631-187545653 CCTCAGCCTGCGAAGTAGCTGGG + Intergenic
967296844 3:187973680-187973702 CCTCATCCTCTCAAGTAGGTGGG - Intergenic
967378902 3:188835587-188835609 CCTCACTCTGTCACCTAGGCTGG - Intronic
967645964 3:191924130-191924152 TCTCACTCTGTCAAGTAAGCTGG - Intergenic
968197222 3:196717183-196717205 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
968216101 3:196892257-196892279 CCTCAGCCTCTGGAGTAGCCAGG + Intronic
968323841 3:197794887-197794909 CCTCACCCTCTCAAGTAGTTGGG - Intronic
1202745195 3_GL000221v1_random:94418-94440 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
968378809 4:70451-70473 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
968635905 4:1679354-1679376 TCTCACCCTGTCACCTAGGCTGG - Intronic
968780799 4:2579667-2579689 CCTCACTCTGTCACCTAGGCTGG - Intronic
968998255 4:3959428-3959450 CCTCACCCTGTCACCCAGGCTGG - Intergenic
969276811 4:6141318-6141340 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
969351841 4:6602697-6602719 TCTCACCCTGTCATGCAGGCTGG + Intronic
969585587 4:8089617-8089639 CCTCACCCTCTCAAGTAGCTGGG - Intronic
969755745 4:9149233-9149255 CCTCACCCTGTCATCCAGGCTGG + Intergenic
970882968 4:20953564-20953586 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
970982373 4:22114770-22114792 TCTCACTCTGTCACGTAGGCTGG - Intergenic
971025369 4:22584219-22584241 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
971394655 4:26216807-26216829 CCTCAGCCTGCCAAGTAGCCGGG - Intronic
971682250 4:29715624-29715646 CCCCACTCTGTGATGCAGGCTGG + Intergenic
971690563 4:29829058-29829080 CCTCACCCTCTCAAGTAGCTGGG - Intergenic
972060081 4:34858815-34858837 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
972318332 4:37948509-37948531 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
972400789 4:38701747-38701769 CCTCAGCCTCTTGAGTAGGCGGG + Intergenic
972681618 4:41311907-41311929 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
973136801 4:46718546-46718568 TCTCACTCTGTCATGTAGGCTGG - Intergenic
973372321 4:49261455-49261477 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
973751994 4:54030405-54030427 CCTCACCCTCCCAAGTAGGCGGG - Intronic
973783343 4:54311628-54311650 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
973797906 4:54447641-54447663 CTTCACCCTCTCAAGTAGCCAGG - Intergenic
973842326 4:54874909-54874931 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
973898999 4:55447332-55447354 CCTCACCCTGTCACCCAGGCTGG - Intronic
973940363 4:55903112-55903134 CCTCACTCTGTTGCGTAGGCTGG - Intronic
974037832 4:56832390-56832412 CCTCAGCCTCCCAAGTAGGCGGG + Intergenic
974833431 4:67216545-67216567 CCTCACCCTGGCAAGTAGCTGGG - Intergenic
975086395 4:70345313-70345335 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
975103661 4:70543838-70543860 CCTCACCCTGTCACTCAGGCTGG - Intergenic
975434276 4:74333680-74333702 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
975795596 4:78003378-78003400 CCTCAGCCTCTGAAGTAGATGGG + Intergenic
975867338 4:78737578-78737600 CCTCACTCTGTCACCTAGGCTGG + Intergenic
976245656 4:83003639-83003661 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
976416238 4:84779526-84779548 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
976597089 4:86904641-86904663 CCTCAGCCTTTTGAGTAGGCGGG - Intronic
976604788 4:86972651-86972673 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
977208656 4:94192904-94192926 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
977212711 4:94239600-94239622 CCTCACTCTGTCACCTAGGCTGG + Intronic
977447431 4:97148725-97148747 CCTCAACCTCTGAAGTAGCTAGG - Intergenic
977641720 4:99364783-99364805 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
978426973 4:108593335-108593357 CCTCACCCTCTCAAGTAAGTGGG + Intergenic
978670334 4:111241015-111241037 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
978696987 4:111593725-111593747 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
978837057 4:113163646-113163668 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
979660438 4:123247452-123247474 TCTCACCCTGTCACTTAGGCTGG + Intronic
979675589 4:123407020-123407042 CCTCAGCCTGTGAAGCAGCGGGG + Intergenic
980070641 4:128240233-128240255 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
980276961 4:130665435-130665457 CCTCACTCTGTCACCTAGGCTGG + Intergenic
980353003 4:131706560-131706582 CCTCAGCCTACCAAGTAGGCAGG + Intergenic
980805580 4:137808862-137808884 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
981013719 4:139952047-139952069 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
981068263 4:140508059-140508081 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
981164103 4:141536776-141536798 TCTCACCCTGTCACCTAGGCTGG + Intergenic
981533954 4:145780073-145780095 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
981611007 4:146593651-146593673 TCTCACTCTGTCAACTAGGCTGG - Intergenic
981919557 4:150072673-150072695 CCTCACCCTCTGCAGTAGCTGGG + Intergenic
981976138 4:150730651-150730673 CCTCACTCTGTCACGCAGGCTGG - Intronic
981983633 4:150827715-150827737 CCTCAGCCTCTGGAGTAGCCTGG + Intronic
982154858 4:152508571-152508593 CCTCAGCCTGTTAAGTAGCTGGG - Intronic
982711726 4:158764814-158764836 CCTCAGCCTCTTAAGTAGGTAGG + Intergenic
982735033 4:158997344-158997366 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
983053726 4:163078329-163078351 CCTCAGCCTCTTAAGTAGCCTGG + Intergenic
983222725 4:165058281-165058303 CCTCAACCTCCCAAGTAGGCTGG + Intergenic
983255720 4:165397934-165397956 CCTCAGCCTCTGGAGTAGCCAGG - Intronic
983276836 4:165628211-165628233 CCTCACTCTGTCACCTAGGCTGG + Intergenic
983307013 4:166002558-166002580 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
983620032 4:169751371-169751393 CCTCACCCTGTCACCCAGGCTGG - Intronic
984092124 4:175387480-175387502 CCCCACCCTGTGAGGAAGGATGG - Intergenic
984236753 4:177168684-177168706 TCTCACTCTGTGAACCAGGCTGG + Intergenic
985060049 4:186068914-186068936 CCTCACCATTTGATGTGGGCGGG - Intergenic
985114003 4:186573398-186573420 TCTCACTCTGTGGAGCAGGCTGG - Intergenic
986003526 5:3648971-3648993 CCTCACCCAGTGAAAGAGGCAGG - Intergenic
986205458 5:5620855-5620877 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
986497623 5:8361502-8361524 CCTCACTCTGTCATCTAGGCTGG - Intergenic
986943490 5:12986056-12986078 CCTCATCCAGTGAAGGAGGCTGG - Intergenic
987104307 5:14622179-14622201 TCTCACCCTGTCATGTAGGCTGG - Intergenic
987399108 5:17456571-17456593 CCTCACCCTCCCAAGTAGGTGGG - Intergenic
987427165 5:17786667-17786689 CCTCAGCCTCTGGAGTAGGTGGG + Intergenic
987825421 5:23024848-23024870 CCTCAGCCTCTCAAGTAGGTAGG + Intergenic
988304529 5:29478037-29478059 TCTCACTCTGTCAACTAGGCTGG - Intergenic
988418439 5:30975673-30975695 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
988489438 5:31693914-31693936 CCTCAGCCTGGGAAGCAGGAAGG - Intronic
988518617 5:31926408-31926430 CCTCAGCCTCTGGAGTAGCCGGG - Intronic
988701192 5:33676648-33676670 TCTCACTCTGTCAAGCAGGCTGG - Intronic
988809669 5:34772022-34772044 CCTCACCCTCTCAAGTAGGTGGG + Intronic
988815432 5:34830013-34830035 CCTCACTCTGTCATGCAGGCTGG + Intronic
989039869 5:37216517-37216539 CCTCACTCTGTCACCTAGGCTGG - Intronic
989064820 5:37449474-37449496 CCTCAGCCTCTGAAGTAACCAGG - Intronic
990679553 5:58226335-58226357 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
991394561 5:66190727-66190749 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
991687356 5:69193765-69193787 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
991709196 5:69390836-69390858 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
991994898 5:72377169-72377191 CCTCAGCCTCCCAAGTAGGCGGG + Intergenic
992060472 5:73039810-73039832 CCTCAGCCTCTCAAGTAGCCGGG - Intronic
992200777 5:74381576-74381598 CCTCACCCTCTGGAGTAGCTGGG - Intergenic
992216859 5:74534119-74534141 CCTCACCCTGTTGAGTAGCTGGG - Intergenic
992796456 5:80258339-80258361 CCTCAGCCTCTGAAGTAGCCGGG + Intergenic
992851849 5:80818101-80818123 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
992885935 5:81160303-81160325 TCTCACTCTCTGAAGTAGGTGGG - Intronic
993091101 5:83427403-83427425 CCTCAGCCTTTGAAGTAGCTGGG - Intergenic
993160323 5:84281980-84282002 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
993376699 5:87156950-87156972 CCTCACCCTCTGGAGTAGTTAGG - Intergenic
993989260 5:94636745-94636767 CCTCACCCTGTCACCCAGGCTGG + Intronic
994372448 5:98982742-98982764 CCTCACCCTCCTGAGTAGGCTGG + Intergenic
994402653 5:99300883-99300905 CCTCAGCCTTTGAAGTAGTTGGG + Intergenic
994418621 5:99505306-99505328 CCTCAGCCTCTGAAGTAACCAGG - Intergenic
994580044 5:101629898-101629920 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
994747060 5:103691671-103691693 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
994946559 5:106401030-106401052 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
995141528 5:108740743-108740765 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
995666198 5:114544931-114544953 CCCCACCCAGTGAAGAAGGATGG - Intergenic
996064492 5:119066459-119066481 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
996227127 5:121013655-121013677 CCTCAGCCTCTTAAGTAGGTGGG + Intergenic
996525839 5:124478587-124478609 CCTCACTCTGTCATGCAGGCTGG + Intergenic
996724574 5:126663081-126663103 CCTCACCCTTTCAAGTAGCGGGG + Intergenic
997453454 5:134001600-134001622 CCTCACCCTCTCGAGTAGCCGGG - Intronic
997489925 5:134265551-134265573 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
997507692 5:134431295-134431317 CCTCAGCCTCTGAAGTAGCTAGG - Intergenic
997539616 5:134650888-134650910 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
997650863 5:135518979-135519001 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
997951542 5:138246358-138246380 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
998049137 5:139016874-139016896 CCTCACTCTGTCACCTAGGCTGG + Intronic
998103075 5:139450386-139450408 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
998514818 5:142743363-142743385 TCTCACTCTGTGACGCAGGCTGG - Intergenic
998836907 5:146211162-146211184 CCTCAGCCTCTCAAGTAGGTAGG - Intronic
999344057 5:150798960-150798982 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
999417232 5:151409113-151409135 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
999926410 5:156383472-156383494 CCTCACCCTGTCACCCAGGCTGG - Intronic
1000000129 5:157130209-157130231 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1000298155 5:159930547-159930569 CCTCACCCTGTCACCCAGGCTGG - Intronic
1000435629 5:161204127-161204149 TCTCACTCTGTCAACTAGGCTGG - Intergenic
1000613475 5:163401059-163401081 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1000850953 5:166339737-166339759 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1000908832 5:166996225-166996247 CCTCACCCTCACAAGTAGCCGGG - Intergenic
1001001573 5:168012530-168012552 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1001134629 5:169092105-169092127 CCTCAGCCTCCGAAGTAGGTGGG - Intronic
1001505170 5:172273473-172273495 CCTCAGCCTCTGAAATAGCCGGG - Intronic
1001817517 5:174682466-174682488 CCTCAGCCTCTGGAGTAGCCAGG - Intergenic
1001978126 5:176017720-176017742 TCTCACCCTGTCACCTAGGCTGG + Intronic
1002032767 5:176442799-176442821 CCTCAGCCTTTGAAGTAGCTTGG - Intergenic
1002057276 5:176605707-176605729 CCTCAGCCTCTGGAGCAGGCAGG - Intronic
1002125777 5:177042965-177042987 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1002138295 5:177122233-177122255 CCTCAGCCTCTGAAGTAGGTGGG - Intergenic
1002239293 5:177826042-177826064 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1002532140 5:179853740-179853762 TCTCACCCTGTCGTGTAGGCTGG - Intronic
1002629266 5:180558892-180558914 CCTCAGCCTCTGAAGCAGGTGGG + Intronic
1002721384 5:181263099-181263121 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1002811235 6:631420-631442 CCTCAGCCTCTGCAGTAGCCGGG - Intronic
1002881671 6:1257813-1257835 TCTCAGCCTCTGAAGTAGGTGGG - Intergenic
1002952574 6:1829552-1829574 CCTCAGCCTGTAAAGTAGCTGGG + Intronic
1003230448 6:4247164-4247186 TCTCAGCCTCTCAAGTAGGCAGG + Intergenic
1003247647 6:4397975-4397997 TTTCAGCATGTGAAGTAGGCAGG + Intergenic
1003298512 6:4855404-4855426 CCTCATCCTCTGGAGTAGCCGGG + Intronic
1003675897 6:8204082-8204104 TCTCACCCTGTCACCTAGGCTGG + Intergenic
1003837742 6:10089977-10089999 CCTCAGCCTCTGGAGTAGGTGGG + Intronic
1004363566 6:14992836-14992858 CCTCAGCCTCTGAAGTAGCTAGG - Intergenic
1004435035 6:15583094-15583116 CCTCAGCCTCTCAAGTAGGTAGG + Intronic
1004938149 6:20528353-20528375 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1004954449 6:20712758-20712780 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1005057600 6:21744672-21744694 CCTCACCCTGTCACCCAGGCTGG + Intergenic
1005078690 6:21934815-21934837 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1005115892 6:22336253-22336275 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1005294466 6:24411652-24411674 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1005517829 6:26571365-26571387 CCTCAGCCTCTGGAGTAGCCGGG - Intergenic
1006411763 6:33877931-33877953 CCTCAGCCTGTGGTGTGGGCTGG - Intergenic
1006620862 6:35362999-35363021 CATCTCCCTGGGCAGTAGGCAGG + Intronic
1006766782 6:36513428-36513450 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1006773393 6:36572643-36572665 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1006828162 6:36951782-36951804 CCTCAGCCTCCCAAGTAGGCTGG - Intronic
1006845739 6:37060080-37060102 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
1006930276 6:37683615-37683637 CCTCACCCAGTGACAGAGGCGGG + Intronic
1006936091 6:37719530-37719552 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1007020953 6:38520915-38520937 TCTCACTCTGTCAAGCAGGCTGG - Intronic
1007737893 6:43993238-43993260 CCTCACCCTGGGGAAAAGGCAGG + Intergenic
1008273466 6:49516676-49516698 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1008276489 6:49549944-49549966 CCTCAGCCCGTCAAGTAGCCGGG - Intergenic
1009970924 6:70624794-70624816 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1010099676 6:72089475-72089497 TCTCACCCTGTCAACCAGGCTGG + Intronic
1010213791 6:73383978-73384000 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1010215852 6:73401091-73401113 CCTCAGCCTGTCAAGTAGCTGGG + Intronic
1010467766 6:76189130-76189152 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1010469975 6:76216340-76216362 CCTCACCCTTTGTAGCAGGGAGG - Intergenic
1010489253 6:76453595-76453617 CCGCACCCCGTCAAGTTGGCGGG - Intergenic
1010750068 6:79607827-79607849 CCTCAGCCTGTGGAGTAGCTGGG - Intergenic
1011615617 6:89195345-89195367 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1011745640 6:90405336-90405358 CCTCAGCCTCTGGAGTAGCCGGG + Intergenic
1011966275 6:93161504-93161526 CCTCAGCCTCTGAAGTGGGCTGG + Intergenic
1012409755 6:98943455-98943477 CCTCAGCCTCTCAAGTAGCCTGG - Intronic
1012889034 6:104878254-104878276 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1012940008 6:105405406-105405428 AGTCACCCTCTGAAGAAGGCAGG + Intergenic
1013403304 6:109819582-109819604 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1014953017 6:127581713-127581735 CTTCACCCAGTGATGTGGGCAGG + Intronic
1014971750 6:127824807-127824829 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1015116852 6:129659581-129659603 CCTCAGCCTCTGTAGTAGCCAGG + Intronic
1015137348 6:129888376-129888398 CCTCACCCTCTCAAGTAGCTGGG + Intergenic
1015301193 6:131654556-131654578 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1015395621 6:132731521-132731543 ACTCTTCCTGTGAAGGAGGCAGG + Intronic
1015432651 6:133149130-133149152 CCTCAACCTCTGAAGTAGCTTGG - Intergenic
1015584033 6:134757648-134757670 CATCACCATGTGAAGTAGAGTGG + Intergenic
1015634295 6:135260904-135260926 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1015649275 6:135436715-135436737 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1015806472 6:137114730-137114752 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1015862751 6:137697741-137697763 CCTCACCCTGAGAAGTGGCAAGG - Intergenic
1015923536 6:138288571-138288593 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1016139674 6:140593696-140593718 CCTCAGCCTCTTAAGTAGGTGGG + Intergenic
1016326319 6:142906102-142906124 TCTCACTCTGTCAACTAGGCTGG - Intronic
1016370718 6:143371429-143371451 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1016384670 6:143518850-143518872 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1016675789 6:146766309-146766331 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1016700188 6:147045509-147045531 CCTCAGCCTCTAAAGTAGACGGG + Intergenic
1016765721 6:147791177-147791199 CCTCAGCCTGTCAAGTAGCTGGG - Intergenic
1016776371 6:147909091-147909113 CCTCAGCCTCTGAAGTAGCAAGG - Intergenic
1016776825 6:147913578-147913600 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1016956778 6:149634407-149634429 CCTCAGCCTCTAAAGTAGGCAGG - Intronic
1017313991 6:153007705-153007727 CCTCAGCCTCTCAAGTAGCCGGG + Exonic
1017518995 6:155185240-155185262 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1017852700 6:158318839-158318861 CCTCAGCCTGCCAAGTAGGTGGG + Intronic
1017911288 6:158795220-158795242 TCTCACCCTGTCACCTAGGCTGG - Intronic
1018037777 6:159896263-159896285 TCTCACCCTGTCAACCAGGCTGG - Intergenic
1018173446 6:161160051-161160073 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1018289001 6:162271425-162271447 CCTCAGCCTCTCAAGTAGCCAGG - Intronic
1018568008 6:165177734-165177756 CCTCAGCCTCTGAAGTAGTTGGG - Intergenic
1018733230 6:166668915-166668937 CCTCACTCTGTCACCTAGGCAGG + Intronic
1018832160 6:167451458-167451480 CCTCACCCTGTGAGGTCGGTGGG - Intergenic
1018860826 6:167709621-167709643 CCACAGCCTGTGAACTAGCCTGG + Intergenic
1019339475 7:502104-502126 CCTCAGCCTCCCAAGTAGGCTGG - Intronic
1019661455 7:2226345-2226367 ACTAACCCTGTGTGGTAGGCAGG - Intronic
1019736738 7:2653745-2653767 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1020031382 7:4935235-4935257 CCTCACCCTCTGAAGTAGCTGGG - Intronic
1020052959 7:5094697-5094719 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1020163448 7:5789871-5789893 TCTCACCCTGTGGCCTAGGCTGG - Intergenic
1020168762 7:5828393-5828415 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
1020210680 7:6155872-6155894 CCTCAGCCTCTGGAGTAGCCGGG + Intronic
1020428296 7:8094258-8094280 CCTCACACTGTAAGGTAAGCAGG + Intronic
1021278314 7:18684140-18684162 CCTCAGCCTCTGAAGTAGATGGG - Intronic
1021411926 7:20338515-20338537 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1021648341 7:22808345-22808367 TCTCACCCTGTGCAGTGGGGAGG + Intergenic
1021697180 7:23286599-23286621 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1021709553 7:23401647-23401669 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1021866686 7:24965379-24965401 AATAACCCTGTGAGGTAGGCAGG - Intronic
1021945929 7:25727082-25727104 CCTCACCCAGTGAAGTGAGAAGG - Intergenic
1022358020 7:29633944-29633966 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1022465113 7:30648451-30648473 CCTCACCCTGTCACCTAGGCTGG + Intergenic
1022468320 7:30665974-30665996 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1022528298 7:31052267-31052289 CCCCAGCCTGTGAAGTGAGCAGG + Intergenic
1022565316 7:31394128-31394150 TCTCACCCTGTCATGCAGGCTGG + Intergenic
1022614267 7:31912569-31912591 CCTCAGCCTCTGAAGTAGTTAGG - Intronic
1023060387 7:36321054-36321076 CCTCAGCCTTTGAAGTAGCTGGG + Intergenic
1023154236 7:37231966-37231988 CCTCAACCTCCCAAGTAGGCGGG + Intronic
1023430191 7:40082985-40083007 CCTCACCCTCTGGAGTAGCTGGG - Intronic
1023924171 7:44653206-44653228 CCTCAGCCTCTCAAGTAGCCAGG + Intronic
1024265964 7:47606699-47606721 CCTCAGCCTCTGGAGTAGCCGGG - Intergenic
1024587678 7:50855696-50855718 CCTCAGCCTCTGAGGCAGGCTGG + Intergenic
1024588616 7:50862007-50862029 ACAGACCCTGTGAAGTAGGAAGG + Intergenic
1024603929 7:51009943-51009965 CCCCAAGCTGTGATGTAGGCAGG - Intergenic
1024639913 7:51320046-51320068 CCTCAGCCTCTCAAGTAGCCAGG + Intergenic
1025068837 7:55881202-55881224 CCTCACTCTCTGAAGTAGCTGGG + Intergenic
1025175287 7:56797473-56797495 CCTCACCCTTCCAAGTAGCCGGG + Intergenic
1025175554 7:56799869-56799891 CCTCACCCTCTGGAGTAGCTAGG + Intergenic
1025188670 7:56880723-56880745 CCTCACTCTGTCACCTAGGCTGG - Intergenic
1025189366 7:56884927-56884949 CCTCACCCTCTGGAGTAGCTTGG + Intergenic
1025193584 7:56915094-56915116 CCTCACTCTGTGACCCAGGCTGG - Intergenic
1025604722 7:63031222-63031244 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
1025608558 7:63057051-63057073 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1025678357 7:63661835-63661857 CCTCACTCTGTGACCCAGGCTGG + Intergenic
1025682574 7:63691990-63692012 CCTCACCCTCTGGAGTAGCTTGG - Intergenic
1025683260 7:63696198-63696220 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1025696245 7:63776551-63776573 CCTCACCCTCTGGAGTAGCTAGG - Intergenic
1025696514 7:63778935-63778957 CCTCACCCTTCCAAGTAGCCGGG - Intergenic
1025792306 7:64700653-64700675 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1025938727 7:66058052-66058074 CCTCAACCTCTGAAGTAGCTGGG - Intergenic
1025955055 7:66176499-66176521 CCTCAGCCTCCCAAGTAGGCAGG + Intergenic
1025981197 7:66408259-66408281 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1026266064 7:68797040-68797062 TCTCACCCTGTGACATAGGATGG + Intergenic
1026531927 7:71206988-71207010 CCTCAGCCTGTCAAGTAGCTGGG - Intronic
1026660714 7:72299994-72300016 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1026736994 7:72955210-72955232 CCTCACCCTCTGGAGTAGCTAGG + Intergenic
1026814485 7:73499670-73499692 TCTCACCCTGTCACCTAGGCCGG - Intronic
1026924925 7:74184794-74184816 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1026939283 7:74277613-74277635 CCTCACCCTCCCAAGTAGGTGGG + Intergenic
1027106738 7:75409858-75409880 CCTCACCCTCTGGAGTAGCTAGG - Intronic
1027242701 7:76343019-76343041 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1027341444 7:77212503-77212525 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1027404978 7:77850610-77850632 TCTCACTCTGTGAACTAGGTTGG - Intronic
1027514283 7:79122805-79122827 CCTCACCCTCTCAAGTAGCTGGG + Intronic
1027642377 7:80752583-80752605 TCTCACCCTGTGACCCAGGCTGG - Intronic
1027676083 7:81160611-81160633 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1028197521 7:87924395-87924417 CCTCAGCCTCTCGAGTAGGCAGG - Intergenic
1028205449 7:88011422-88011444 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1028311503 7:89343456-89343478 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1028408911 7:90506649-90506671 CCTCACCCTCTCAAGTAGCTAGG - Intronic
1028591545 7:92501284-92501306 CCTCACTCTGTCATCTAGGCTGG - Intronic
1028600897 7:92599395-92599417 TCTCACTCTGTCAACTAGGCTGG + Intergenic
1028910385 7:96201394-96201416 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1028935820 7:96462916-96462938 ACTCACTCTGTCACGTAGGCTGG - Intergenic
1028955626 7:96686138-96686160 ACCCACCCTGTGAAGCAGGGAGG - Intronic
1029280582 7:99433009-99433031 CCTCACTCTGTCACCTAGGCTGG - Intronic
1029455929 7:100672462-100672484 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1029478594 7:100799870-100799892 CCTCAGCCTCTCAAGTAGCCAGG + Intergenic
1029542140 7:101190060-101190082 CTTCAACCTGTCAAGTAGACTGG - Intergenic
1029591452 7:101509755-101509777 CCTCACTCTGTCACCTAGGCTGG + Intronic
1029639484 7:101810560-101810582 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1029672918 7:102046346-102046368 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1029688554 7:102165380-102165402 TCTCACCCTGTGACCCAGGCTGG + Intronic
1029873794 7:103725536-103725558 CCTCACTCTGTCACCTAGGCTGG - Intronic
1030354816 7:108530167-108530189 CCTCACCCTGTTACCCAGGCTGG - Intronic
1030509073 7:110460694-110460716 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1030849323 7:114463142-114463164 CCTCAGCCTCTGAAGTAGCTAGG + Intronic
1031093496 7:117390731-117390753 CCTCACTCTGTCACCTAGGCTGG + Intronic
1031460791 7:122046290-122046312 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
1031615477 7:123874431-123874453 TCTCACCCTGTCATCTAGGCTGG + Intronic
1031962229 7:128000481-128000503 CCTCAGCCTCTCAAGTAGGTAGG + Intronic
1031983301 7:128144425-128144447 CCTCACTCTGTCATGCAGGCTGG - Intergenic
1032055707 7:128682609-128682631 TCTCACTCTGTCACGTAGGCTGG + Intronic
1032067516 7:128782876-128782898 CCTCACCCTGTAAGGTAGACAGG + Intergenic
1032131837 7:129235536-129235558 CCTCACCCTGTGGAGGAGCTGGG + Intronic
1032493597 7:132343885-132343907 CCTCACTCTGTCACCTAGGCTGG - Intronic
1032823191 7:135543667-135543689 CCTCAGCCTCTGAAGTAGTTGGG + Intergenic
1033081702 7:138304894-138304916 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1033086128 7:138343747-138343769 CCTCAGCCTCTGGAGTAGCCAGG + Intergenic
1033202211 7:139383039-139383061 CCTCACCCTTCCAAGTAGGTGGG + Intronic
1033507557 7:142020629-142020651 CCTCACTCTGTCATGCAGGCTGG + Intronic
1033788239 7:144759904-144759926 TCTCACTCTGTGACCTAGGCTGG - Intronic
1034209847 7:149353853-149353875 TCTCACCCTGTCATCTAGGCTGG - Intergenic
1034735426 7:153425072-153425094 CCTCAGCCTCTGAAGTAGTTCGG - Intergenic
1035719634 8:1782258-1782280 CCTCACCCTTTCAAGTAGCTGGG + Exonic
1035775689 8:2186238-2186260 CCTCAGCCTCTCAAGTAGCCGGG + Intergenic
1035963602 8:4165517-4165539 CCTCAGCCTGCCAAGTAGGTGGG + Intronic
1036166611 8:6440473-6440495 CCTCACCCTCTCAAGTAGCTAGG + Intronic
1036192661 8:6684857-6684879 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1036209650 8:6831897-6831919 CTTCAGCCTGTTGAGTAGGCGGG - Intronic
1036375044 8:8192734-8192756 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1036378990 8:8224529-8224551 CCTCACCCTGTCACCCAGGCTGG + Intergenic
1036559470 8:9889275-9889297 CCTCACCCTCTGAGGTAGCTGGG - Intergenic
1036666470 8:10746350-10746372 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1036764158 8:11536418-11536440 TCTCACTCTGTCAACTAGGCTGG + Intronic
1036850577 8:12198070-12198092 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1036854498 8:12230415-12230437 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1036871942 8:12440335-12440357 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1036875857 8:12472914-12472936 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1037103018 8:15071496-15071518 CATAGCCCTGTGAAGTAGGCAGG - Intronic
1037402185 8:18504285-18504307 CCTCACCCTCCGAAGTAGCTGGG - Intergenic
1037432062 8:18824055-18824077 CCTCAGCCTCCCAAGTAGGCAGG - Intronic
1037493298 8:19416228-19416250 CCTCAGCCTGTGGAGTAGTTGGG + Intronic
1037736766 8:21573454-21573476 CCTCACCCTCTGGAGTAGCTGGG + Intergenic
1037798937 8:22020857-22020879 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1038107914 8:24457303-24457325 CCTCACTCTGTCATCTAGGCTGG + Intronic
1038299150 8:26325861-26325883 CCTCACCCTGTCACCCAGGCTGG + Intronic
1038570168 8:28655248-28655270 CCTCACTCTGTCACCTAGGCTGG - Intronic
1038668004 8:29557979-29558001 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1039054152 8:33521360-33521382 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1039544371 8:38398022-38398044 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1039612680 8:38932018-38932040 CCTCGCCCTGTTACTTAGGCTGG + Intronic
1039668127 8:39559784-39559806 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
1039775601 8:40732959-40732981 CCTCACCCTGCCAAGTAGCTGGG + Intronic
1039931284 8:41992083-41992105 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1040011796 8:42667425-42667447 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1040620039 8:49081895-49081917 CCTCACCCTCTCAAGTAGTTGGG - Intergenic
1040687318 8:49890394-49890416 CCTCACCCTCCCAAGTAGTCTGG - Intergenic
1040855169 8:51941698-51941720 CCTCAGCCTCTCAAGTAGGTAGG + Intergenic
1040986748 8:53303382-53303404 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1041080223 8:54208617-54208639 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1041097650 8:54365285-54365307 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1041715828 8:60931051-60931073 CCTCACCCTGTCACCCAGGCTGG - Intergenic
1041720071 8:60967682-60967704 CCACACCCTGAGCAGTGGGCAGG - Intergenic
1042096175 8:65218146-65218168 CCTCACTCTGTCACGTAGGCTGG + Intergenic
1042227001 8:66521957-66521979 CATCAGCCTGTGAGGTTGGCTGG - Intergenic
1042256823 8:66813136-66813158 CCTCAGCCTGCCAAGTAGCCAGG - Intronic
1042321646 8:67481812-67481834 CCTGACCCTGGGAGGGAGGCAGG + Intronic
1042548302 8:69970910-69970932 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1043051872 8:75394829-75394851 CCTCACCCTGCCAAGTAGCTGGG + Intergenic
1043577876 8:81678574-81678596 CCTCAGCCTGCCAAGTAGGTGGG - Intronic
1043644141 8:82496694-82496716 CCTCACCCTCTGGAGTAGCTGGG - Intergenic
1043882837 8:85564650-85564672 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1044032148 8:87251470-87251492 CCTCAACCTGTCAAGTAGCTGGG - Intronic
1044238127 8:89855444-89855466 CCTCAGCCTGTGAAGTTGCTGGG - Intergenic
1044315785 8:90748915-90748937 CCTCACCCAGTGAGGAAGGAGGG - Intronic
1044511788 8:93089757-93089779 CCTCACCCTTTGGAGTAGCTGGG - Intergenic
1044555457 8:93557647-93557669 CCTCACTCTGTCAACCAGGCTGG - Intergenic
1044834268 8:96280536-96280558 TCTCACCCTGTCACCTAGGCTGG - Intronic
1044870580 8:96615806-96615828 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1045267336 8:100630901-100630923 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1045469301 8:102496978-102497000 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1045909356 8:107388297-107388319 CCTCAGCCTCTGAAGTAGCTAGG - Intronic
1046631898 8:116629741-116629763 TCTGCCCCTGTGAAGGAGGCAGG - Intergenic
1046840513 8:118851157-118851179 CCTCAGCCTGCGAAGTAGCTGGG + Intergenic
1046912787 8:119647110-119647132 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1046937373 8:119897501-119897523 TCTCACCCTGTCAACCAGGCTGG - Intronic
1047959835 8:130003186-130003208 TCTCACTCTGTCAACTAGGCTGG - Intronic
1048015893 8:130497809-130497831 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1048622136 8:136145389-136145411 ACTAACACTGTGGAGTAGGCAGG - Intergenic
1048736482 8:137507613-137507635 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1049081486 8:140446667-140446689 CCTCAGCCTCTCAAGTAAGCTGG + Intronic
1049535512 8:143178814-143178836 CATAACCCTGTGAAGAATGCAGG - Intergenic
1049979959 9:894928-894950 CCTCAGCCTGTGAAGTAGCTGGG + Intronic
1050081564 9:1921225-1921247 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1050251439 9:3748906-3748928 CCTCTGCCTGTGAAGTAGCTGGG + Intergenic
1050342369 9:4653819-4653841 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1050405658 9:5306221-5306243 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1050958350 9:11693835-11693857 CCTCAGCCTCAGAAGTAGGTGGG + Intergenic
1051176202 9:14362864-14362886 CCTCACTCTGTCAAGCAGACTGG - Intronic
1052546661 9:29889015-29889037 CCCCACCCAGTGAAGAAGGATGG - Intergenic
1052892415 9:33715521-33715543 TCTCACTCTGTCATGTAGGCTGG - Intergenic
1052905761 9:33832190-33832212 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1052937344 9:34103809-34103831 TCTCACTCTGTTATGTAGGCTGG - Intronic
1053172351 9:35897883-35897905 CCTCAGCCTGTGGAGTAGCTGGG - Intergenic
1053342369 9:37348493-37348515 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1053566237 9:39255453-39255475 CCTCACCCTGTCACCCAGGCTGG - Intronic
1053589106 9:39492586-39492608 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1053832011 9:42093313-42093335 CCTCACCCTGTCACCCAGGCTGG - Intronic
1054130912 9:61363555-61363577 CCTCACCCTGTCACCCAGGCTGG + Intergenic
1054352566 9:64030641-64030663 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1054577193 9:66872709-66872731 TCTCACCCTGTCACCTAGGCTGG + Intronic
1054598533 9:67094113-67094135 CCTCACCCTGTCACCCAGGCTGG + Intergenic
1054774698 9:69115273-69115295 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1055085671 9:72311733-72311755 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1055294387 9:74819277-74819299 CCTCACTCTGTCACCTAGGCTGG - Intronic
1055304830 9:74918591-74918613 CCTCAGCCTGCCAAGTAGACAGG - Intergenic
1055385476 9:75757436-75757458 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1055955804 9:81772712-81772734 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1056162541 9:83911180-83911202 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1056357806 9:85820349-85820371 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1056376241 9:86015012-86015034 CCTCAGCCTCTCAAGTAGGTGGG + Intronic
1056649006 9:88441637-88441659 CCTCAACCTCTGAAGTAGCTGGG - Intronic
1056842523 9:90010106-90010128 CCTCACTCTGTCCACTAGGCTGG + Intergenic
1056968718 9:91185301-91185323 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1057238719 9:93389794-93389816 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1057387722 9:94619276-94619298 CCTCACCCTATTAAGAGGGCAGG - Intronic
1057418952 9:94892827-94892849 CCTCAGCCTGTCAAGTAGGTAGG + Intronic
1057805294 9:98215621-98215643 CCTCAGCCTGTCAAGTAGCTGGG + Intronic
1058196497 9:101983490-101983512 CCTCACTCTGTCACCTAGGCTGG + Intergenic
1058281914 9:103126973-103126995 CCTGACCCTGTGAAGTAACCTGG - Intergenic
1058458945 9:105164978-105165000 CCTCAACCTCTCAAGTAGCCGGG - Intergenic
1058813777 9:108665639-108665661 CCTCACCATGTGCAGAAGGAAGG + Intergenic
1059292452 9:113238644-113238666 CCTCAGCCTTCCAAGTAGGCGGG - Intronic
1059473897 9:114528388-114528410 CCTCACTCTGTTATTTAGGCTGG - Intergenic
1060428367 9:123525786-123525808 TCTCGCTCTGTGACGTAGGCTGG + Intronic
1060500240 9:124148023-124148045 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1060540682 9:124428225-124428247 CCTCAGCCTCTCAAGTAGTCGGG - Intergenic
1060569147 9:124622098-124622120 CCTCAGCCTGCGAAGTAGCTGGG - Intronic
1060579360 9:124730341-124730363 CCTCACCTTCTCAAGTAGGTGGG + Intronic
1060580927 9:124745869-124745891 CCTCAGCCTCTTGAGTAGGCAGG - Intronic
1060609995 9:124955050-124955072 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1060839211 9:126781108-126781130 TCTCACCCTGTCACCTAGGCTGG - Intergenic
1060914235 9:127376072-127376094 CCTCAGCCTCCCAAGTAGGCTGG + Intronic
1061148835 9:128817415-128817437 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1061354465 9:130093928-130093950 CTTCAGCCTCTGAAGTAGGTGGG + Intronic
1061722737 9:132563047-132563069 CCTCACTCTGTCACCTAGGCTGG + Intronic
1061868709 9:133508662-133508684 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1062666563 9:137676479-137676501 CCTCAGCCTCTGAAGTAGCCGGG + Intronic
1203688182 Un_GL000214v1:15852-15874 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1203713819 Un_KI270742v1:124369-124391 CCTCACCCTCCGAAGTAGCTGGG + Intergenic
1203553180 Un_KI270743v1:181544-181566 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1203648093 Un_KI270751v1:88201-88223 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1185483272 X:463938-463960 CCTCAGCCTCCGAAGTAGCCAGG - Intergenic
1185538908 X:886391-886413 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1185800365 X:3005163-3005185 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1185839752 X:3377459-3377481 CCTCACTCTGTCACTTAGGCTGG - Intergenic
1185875263 X:3696902-3696924 CCTCAGCCTCTCAAGTAGGTGGG - Intronic
1185953666 X:4464939-4464961 CCTCAGCCTCTGAAGTAGGTGGG - Intergenic
1185979224 X:4757556-4757578 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1186105187 X:6197947-6197969 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1186212405 X:7263182-7263204 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1187171450 X:16855879-16855901 CCTCAGCCTGTCAAGTAGGTGGG - Intronic
1187382060 X:18811721-18811743 CCTCAGCCTCTGAAGTAGCTGGG + Intronic
1187700164 X:21957410-21957432 CCTCACCCTCCCAAGTAGCCAGG + Intronic
1187842604 X:23504620-23504642 CCTCAGCCTCCGAAGTAGCCGGG - Intergenic
1188378714 X:29465374-29465396 CCTCACCCTGTTACCCAGGCTGG - Intronic
1188499169 X:30806791-30806813 CCTCAGCCTCTTAAGTAGCCGGG + Intergenic
1189108851 X:38265917-38265939 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1189124556 X:38432486-38432508 CCTCACTCTGTCACATAGGCTGG - Intronic
1189316855 X:40062673-40062695 CCTCAAGCTGGGAAGCAGGCAGG + Intronic
1189981026 X:46510975-46510997 AATGACCCTGTAAAGTAGGCTGG - Intronic
1189989389 X:46579874-46579896 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1190089837 X:47428029-47428051 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1190165363 X:48069123-48069145 CCTCAGCCTGCCAAGTAGCCAGG - Intronic
1190307221 X:49091323-49091345 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1190485733 X:50922888-50922910 TCTCACTCTGTCATGTAGGCTGG - Intergenic
1190864618 X:54374247-54374269 CCTCACCCTGTCACCCAGGCTGG + Intergenic
1191011792 X:55767895-55767917 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1191031743 X:55981075-55981097 CCTCAGCCTCTGAAGTAGCTTGG - Intergenic
1191665061 X:63693580-63693602 TCTCACTCTGTGACGCAGGCTGG - Intronic
1192124126 X:68485632-68485654 CCTCAGCCTGTGGAGTAGCTGGG + Intergenic
1192492514 X:71588709-71588731 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1193641939 X:84020303-84020325 CCTCAGCCTCCCAAGTAGGCTGG + Intergenic
1193813397 X:86078070-86078092 CCTCAGCCTCTCAAGTAGCCAGG - Intergenic
1194380707 X:93188227-93188249 CCTTAGCCTGTGAAGTAGCTGGG + Intergenic
1194722987 X:97362123-97362145 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1194754137 X:97717357-97717379 CTTGACCCTTTGAATTAGGCAGG - Intergenic
1194943403 X:100040211-100040233 CCTCAACCTCTCAAGTAGTCTGG - Intergenic
1195643337 X:107201820-107201842 CCTCAGCCTCTGGAGTAGGTGGG - Intronic
1195919636 X:109970947-109970969 CCTCAGCCTGTCAAGTAGCTGGG + Intergenic
1196026223 X:111044119-111044141 CATCATGCTTTGAAGTAGGCAGG + Intronic
1196205407 X:112933889-112933911 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1196280369 X:113817196-113817218 CCTCACCCTCTCAAGTAGTTAGG + Intergenic
1197223765 X:123936703-123936725 TCTCACTCTGTCAACTAGGCTGG - Intergenic
1197296436 X:124724678-124724700 CCTCAGCCTGTGGAGTAGCTGGG - Intronic
1198221286 X:134604847-134604869 CCACACCCTTTGAAGTTAGCTGG - Intronic
1198225947 X:134646065-134646087 CATGACCCTGTGAGGTAGGTAGG - Intronic
1198606523 X:138344926-138344948 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1198634523 X:138681056-138681078 CCTCAGCCTCTGAAGTAGCTGGG - Intronic
1198718482 X:139588812-139588834 CCTCACCCTCTCAAGTAGCTGGG - Intronic
1198737533 X:139803726-139803748 ACTCACCCTGTCACCTAGGCTGG + Intronic
1200307461 X:155042300-155042322 CCTCAGCCTGTGGAGTAGCTGGG + Intronic
1200428034 Y:3043534-3043556 CCTCAGCCTGTCAAGTAGCAAGG - Intergenic
1200784204 Y:7245143-7245165 CCTCAGCCTCTCAAGTAGGTGGG + Intergenic
1200794464 Y:7328119-7328141 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1200799010 Y:7368632-7368654 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1200887689 Y:8285909-8285931 CCTCAACCTCTTAAGTAGGTGGG + Intergenic
1201154449 Y:11117206-11117228 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1201236072 Y:11913405-11913427 CCTCACTCTGTCACTTAGGCTGG + Intergenic
1201275316 Y:12291619-12291641 CCTCAGCCTCTGGAGTAGCCGGG - Intergenic
1201361792 Y:13159520-13159542 CCTCAGCCTCTGAAGTAGCTGGG - Intergenic
1201553227 Y:15240551-15240573 CCTCAGCCTCTGGAGTAGGTGGG - Intergenic
1201602960 Y:15750788-15750810 CCTCAGCCTCTGAAGTAGCTGGG + Intergenic
1201607354 Y:15801554-15801576 CCTCAGCCTCTCAAGTAGGTGGG - Intergenic
1202070350 Y:20985645-20985667 CCTCCCCCTGTGAACTTGGCAGG + Intergenic
1202082702 Y:21100993-21101015 CCTCACCCTCCTAAGTAGCCAGG - Intergenic
1202378826 Y:24259570-24259592 CCTCAGCATGTGAAGGTGGCAGG + Intergenic
1202491956 Y:25410551-25410573 CCTCAGCATGTGAAGGTGGCAGG - Intergenic
1202589497 Y:26467741-26467763 CCTCAGCCTTTCAAGTAGCCAGG + Intergenic