ID: 1103825589

View in Genome Browser
Species Human (GRCh38)
Location 12:123735572-123735594
Sequence AGCGGAGGGAGATCCAGGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103825574_1103825589 22 Left 1103825574 12:123735527-123735549 CCAGCTACCACTGCCACGTGTAC 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366
1103825582_1103825589 -7 Left 1103825582 12:123735556-123735578 CCAAACACAGCCGAGGAGCGGAG 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366
1103825577_1103825589 0 Left 1103825577 12:123735549-123735571 CCCCTATCCAAACACAGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 89
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366
1103825580_1103825589 -2 Left 1103825580 12:123735551-123735573 CCTATCCAAACACAGCCGAGGAG 0: 1
1: 0
2: 0
3: 5
4: 117
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366
1103825575_1103825589 15 Left 1103825575 12:123735534-123735556 CCACTGCCACGTGTACCCCTATC 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366
1103825579_1103825589 -1 Left 1103825579 12:123735550-123735572 CCCTATCCAAACACAGCCGAGGA 0: 1
1: 0
2: 0
3: 20
4: 149
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366
1103825576_1103825589 9 Left 1103825576 12:123735540-123735562 CCACGTGTACCCCTATCCAAACA 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG 0: 1
1: 0
2: 3
3: 34
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103825589 Original CRISPR AGCGGAGGGAGATCCAGGAG GGG Exonic
900126159 1:1069758-1069780 AGCTCAGGGAGGTCCAGGGGCGG + Intergenic
900135563 1:1115704-1115726 AGGGGAGGGGGTTCCCGGAGCGG - Intronic
900688320 1:3963452-3963474 AGCAGAGTCAGGTCCAGGAGAGG + Intergenic
901195355 1:7437109-7437131 AGAGGAGGGAGGCCCAGCAGAGG + Intronic
901511639 1:9720749-9720771 AGCTGCGGGAAATCCTGGAGCGG + Exonic
901701391 1:11046541-11046563 AGCCGAGGGTGAGCCAAGAGGGG - Exonic
901853075 1:12028439-12028461 AGCTGAGGAACAGCCAGGAGGGG - Intronic
901919351 1:12525402-12525424 AGGGGAGGAGGATCCAGGAAGGG + Intergenic
902878723 1:19356779-19356801 AGCTGAGGGAGAGCCTGAAGTGG + Intronic
903189306 1:21647872-21647894 AGTGGAGGGACATCAAGGGGAGG + Intronic
904899715 1:33847196-33847218 AGCTGAGGGAAACCCAGCAGTGG - Intronic
905134529 1:35788227-35788249 AGGTGAGGGAGATCCAGCAAAGG - Intergenic
905353003 1:37360468-37360490 AGGGGAGGGAGATGATGGAGAGG - Intergenic
905462013 1:38128109-38128131 AGGGGAGGGAGGACAAGGAGGGG + Intergenic
905945948 1:41901539-41901561 AGCAGAGAGAAAACCAGGAGAGG + Intronic
906584077 1:46961256-46961278 AGGAGAGGGAGGTACAGGAGTGG + Intergenic
906811559 1:48832216-48832238 AGCGGATGCAGCTCCAGGAGAGG - Intronic
907200924 1:52726398-52726420 AGCGGAGGCGGGTCCAGGCGCGG + Intergenic
907289021 1:53401013-53401035 AGCGGAGGGACAGACAGGAGAGG + Intergenic
907401251 1:54226219-54226241 ACGGAAGGGAGGTCCAGGAGAGG + Intronic
908591635 1:65643309-65643331 AGCGAAGGGAGATACGGGTGGGG + Intergenic
908592380 1:65647705-65647727 AGCGAAGGGAGATACGGGTGGGG + Intergenic
909248862 1:73326900-73326922 AGCGGAGGGAGCTCCTTGTGAGG + Intergenic
909768113 1:79383873-79383895 AGGGGAAGGAGATGAAGGAGAGG - Intergenic
912373778 1:109193828-109193850 AGCAGAGGGAGCTCCAGGGAAGG - Intronic
913168109 1:116208213-116208235 TGAGGAGGAAGATTCAGGAGGGG - Intergenic
913203669 1:116516607-116516629 AGCGGAGGCAAATACATGAGAGG - Intronic
913237879 1:116800481-116800503 AGAGGAGGAAGATCCAGGGAAGG + Intergenic
913409634 1:118537072-118537094 AGAGGAGGGAGATAGAGAAGGGG - Intergenic
914917181 1:151825980-151826002 AGCAGGGGGTGGTCCAGGAGTGG + Intronic
915023529 1:152804942-152804964 AGTGAATGGAGATCCAGGAGAGG + Exonic
915647743 1:157285968-157285990 AGCAGAGGGAGATGCAGCACAGG - Intergenic
915662925 1:157418549-157418571 AGCAGAGGGAGATGCAGCACAGG + Intergenic
915839334 1:159202381-159202403 AGAGGAGGGAAATCCAGGGAAGG - Intronic
917112074 1:171558704-171558726 AGAATAGGGAGGTCCAGGAGAGG - Intronic
917978353 1:180254354-180254376 AGCAGAGGGAGATCCTGGCCTGG - Intronic
918887862 1:190220010-190220032 AGCTGAGCAAGATCAAGGAGTGG + Intronic
918912603 1:190592846-190592868 AGCAGAGGTAGAAGCAGGAGGGG - Intergenic
919403251 1:197146451-197146473 GGGGCAAGGAGATCCAGGAGGGG - Exonic
919574949 1:199296140-199296162 AGCGGAGGGAAATCCAGGACAGG + Intergenic
920859405 1:209693077-209693099 AGCAGAGGGAGCCCCAGGAGTGG - Intronic
922561027 1:226569731-226569753 ACAAGAGGGAGAGCCAGGAGTGG + Intronic
923210441 1:231799515-231799537 AGCGGAGGGAGGGCCAAGGGAGG + Intronic
923408145 1:233683551-233683573 AGCGAAGGGAGATAGAGGTGGGG + Intergenic
923641994 1:235772743-235772765 AGGGGAGTCAGGTCCAGGAGAGG - Intronic
923972398 1:239219041-239219063 AGAGGGGGAAGATTCAGGAGAGG + Intergenic
924039538 1:239970996-239971018 AGAGAAGGGAGATCCAGAAAAGG + Intergenic
924126876 1:240863998-240864020 AGCGGTGGGAGAGCCAGGCCTGG - Intronic
924519741 1:244795619-244795641 AGAGGAGGCAGAAACAGGAGAGG - Intergenic
1063377615 10:5563507-5563529 AGAGGAGTGAGGTCCTGGAGGGG + Intergenic
1064315694 10:14254000-14254022 AGCGTAGGGAGAGTCATGAGAGG - Intronic
1064987916 10:21229571-21229593 AGCTGAGGGAGTTTCAGTAGAGG - Intergenic
1066647597 10:37625325-37625347 AGCCAGGTGAGATCCAGGAGTGG - Intergenic
1067074110 10:43163396-43163418 AGAGGATGGAGATGAAGGAGTGG + Intronic
1067780815 10:49205467-49205489 TGGGGAGGGAGCTCAAGGAGAGG - Intergenic
1071941010 10:90591906-90591928 AGGGGAGGGAGTTTCAGCAGTGG + Intergenic
1074532056 10:114304974-114304996 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532093 10:114305088-114305110 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532104 10:114305124-114305146 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532159 10:114305304-114305326 AGGGGACGGAGCTGCAGGAGGGG + Intronic
1074532190 10:114305430-114305452 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532199 10:114305466-114305488 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532293 10:114305817-114305839 AGGGGAGGCAGATCCAGGAGGGG + Intronic
1074532352 10:114305996-114306018 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532356 10:114306014-114306036 AGGGGACGCAGATGCAGGAGGGG + Intronic
1074532427 10:114306302-114306324 AGGGGACGCAGATCCAGGAGGGG + Intronic
1075632470 10:124009323-124009345 AGCAGAGAGAGAGCCAGGACTGG + Exonic
1076678072 10:132158291-132158313 AGCATAGAGAGCTCCAGGAGTGG + Intronic
1077266402 11:1652957-1652979 GGTGGAGGGAGCTGCAGGAGGGG + Intergenic
1077443796 11:2580926-2580948 AGCGGAGGCAGAGCCCGGAGTGG + Intronic
1077680609 11:4237194-4237216 AGCAGAGGGAGACCAGGGAGAGG - Intergenic
1077727668 11:4691606-4691628 AGGGAATGGAGATCCAGGTGTGG + Intronic
1077729840 11:4718686-4718708 AGGGAATGGAGATCCAGGTGTGG - Intronic
1077933057 11:6753721-6753743 AGCTGATGGAGATGGAGGAGTGG - Intergenic
1078668106 11:13342387-13342409 AGGGGAGGGTCATACAGGAGGGG + Intronic
1080517174 11:33035258-33035280 AGAGGAAGGAGAGGCAGGAGAGG - Intergenic
1080588184 11:33699953-33699975 GGCGGATGGAGTTCCAGGTGTGG + Intronic
1081737565 11:45414674-45414696 AGAGAAGGCAGATCTAGGAGAGG - Intergenic
1081742451 11:45450007-45450029 TCTGGAGGGAGATCCAGAAGGGG - Intergenic
1082816799 11:57514717-57514739 CGTGGAGGGAGACCCAGGACGGG + Intronic
1082823186 11:57558777-57558799 AGAGGAAGGAGAACCAGGAAAGG - Intronic
1083571613 11:63764525-63764547 AGAGGAGGGGGCTCCAGCAGCGG + Exonic
1083627358 11:64078513-64078535 ATCGGAGGGATACCCGGGAGGGG + Intronic
1083856159 11:65394083-65394105 AGCGGCGGGAGCTCCAGGTGAGG + Exonic
1085013536 11:73157754-73157776 AGCAGAGGGTGAACCAGAAGAGG + Intergenic
1085941090 11:81207588-81207610 TGCGGAGGGAGAGGCAGGGGCGG + Intergenic
1086005528 11:82030890-82030912 AGCGAAGGGAGATAAAGGTGGGG - Intergenic
1086080439 11:82898559-82898581 AGCTGAAAGAGATCCAAGAGAGG + Intronic
1086728776 11:90222749-90222771 AGCCAAGGGAGGCCCAGGAGGGG + Intronic
1086957968 11:92953533-92953555 GGTGGAGGGAGAGACAGGAGAGG + Intergenic
1087245105 11:95826083-95826105 AGTGGAGGGGGAGGCAGGAGAGG - Intronic
1089385185 11:118062638-118062660 TGTGGAGGGAGGGCCAGGAGAGG - Intergenic
1089586345 11:119512171-119512193 GGAGGAGGGAGCTCCATGAGGGG + Intergenic
1089943223 11:122440954-122440976 GGCTGAGGAAGAGCCAGGAGGGG - Intergenic
1090246144 11:125217233-125217255 GAAGGAGAGAGATCCAGGAGTGG - Intronic
1090604959 11:128411996-128412018 AGCCGAGGGATATCCAGGAAGGG + Intergenic
1093491624 12:19711253-19711275 AGCGGAGTAAGTTCCAGGATTGG + Intronic
1095719477 12:45385350-45385372 AGCTGAGGGAGCTTCAGGGGTGG + Intronic
1095958816 12:47820894-47820916 AGCGGAGGGAGAGGCAGGGAGGG - Intronic
1096226962 12:49872260-49872282 AGAGGAAGGTGACCCAGGAGAGG + Intronic
1097222768 12:57460613-57460635 AAAGGAGGGAGCTCCAGGTGGGG + Intronic
1097247350 12:57613868-57613890 AGAGTAGGAAGGTCCAGGAGTGG - Intronic
1099928098 12:89042142-89042164 AGGGGAGGTAGATTCAGGGGAGG - Intergenic
1101209858 12:102524973-102524995 GTGGGAGGGAGTTCCAGGAGAGG + Intergenic
1103825589 12:123735572-123735594 AGCGGAGGGAGATCCAGGAGGGG + Exonic
1104958567 12:132477512-132477534 AGGGGAGAGAGATGCAGGTGGGG - Intergenic
1108036232 13:46293145-46293167 AGAGGAGGGAGATGCACCAGTGG - Intergenic
1109141006 13:58714076-58714098 TGTGGAGGGAGAGACAGGAGCGG + Intergenic
1112051174 13:95644657-95644679 GCCGGAGGGAGATCGCGGAGGGG - Intronic
1112388211 13:98959690-98959712 AGCAGAAGGAGATGCAGGGGAGG + Intronic
1113614636 13:111671572-111671594 AGCAGAGAGACACCCAGGAGTGG + Intronic
1113834427 13:113319436-113319458 AGTGGAGGGAGATTCAGGTCTGG - Intronic
1114648699 14:24269853-24269875 TGGGGAGGGATATCCAGGATGGG - Intronic
1115027510 14:28761593-28761615 AGCCAAGGGAGAGCCAGGCGTGG - Intergenic
1116534306 14:46012535-46012557 AGCGAAGGGAGATACGGGTGGGG + Intergenic
1117073268 14:52075302-52075324 AGGTGAGGGAGATCCATGAAAGG - Intergenic
1117342597 14:54804928-54804950 CGCGGAGGCAGGGCCAGGAGAGG - Intergenic
1118849344 14:69572477-69572499 AGCGGCGGGAGCGCGAGGAGCGG - Exonic
1119401217 14:74363969-74363991 AATGGTGGGACATCCAGGAGTGG - Intergenic
1119682255 14:76601606-76601628 AGCGGAGGGAGAGAGAGAAGGGG + Intergenic
1119995489 14:79248886-79248908 AGGGGAGGGAAATGCAGGTGGGG + Intronic
1120539872 14:85738292-85738314 AGCGAAGGGAGATAGAGGTGGGG + Intergenic
1121320984 14:92991501-92991523 AGCTGTGGGTGTTCCAGGAGAGG - Intronic
1121896278 14:97650905-97650927 TGGGGAAGGAGATCCAGGAAAGG + Intergenic
1122090320 14:99334187-99334209 AGCGCCAGGAGCTCCAGGAGAGG - Intergenic
1122187241 14:100009306-100009328 AAGGTAGGGAGATCAAGGAGGGG - Intronic
1122671921 14:103379235-103379257 AGCAAAGGGAGAGCCAGGACTGG - Intergenic
1122833450 14:104417060-104417082 AGCAGAAGAAGATACAGGAGAGG + Intergenic
1122899222 14:104775295-104775317 GTCGGAGGCAGAGCCAGGAGAGG + Intronic
1122958697 14:105084608-105084630 AGTGGAGGGAGAGCTTGGAGAGG + Intergenic
1123450869 15:20358175-20358197 AGCAGAGGGAGAGGGAGGAGAGG - Intergenic
1123881994 15:24685461-24685483 AGCGAAGGGAGATCGGGGTGGGG + Intergenic
1124999509 15:34755252-34755274 GGCGGAGGGGGAGCCGGGAGCGG + Intergenic
1125537658 15:40451676-40451698 AGCAGAGGGAGACCCATGTGGGG - Intronic
1126240954 15:46442792-46442814 ATAGGAAGGAGATACAGGAGGGG - Intergenic
1128578591 15:68792957-68792979 AGAGGAGGGAGCTCCAAGAATGG - Intronic
1129295612 15:74598491-74598513 CGCGGAGGGAGATCCACTACAGG + Intronic
1130374882 15:83320073-83320095 AGTTCAGGGAGATCAAGGAGGGG + Intergenic
1130655937 15:85792246-85792268 AGAGGAGGGAGGTGCAGGGGAGG - Intronic
1131014208 15:89043711-89043733 AGAGGAGGGAGAAGGAGGAGGGG + Intergenic
1132616837 16:845355-845377 AACGCAGGGAGATCTGGGAGAGG - Intergenic
1132804056 16:1767583-1767605 CGCGGCGGGAGAGCCAGGTGCGG + Exonic
1133046887 16:3092972-3092994 AGAGGAGAGAGACCCAAGAGCGG - Intronic
1133962374 16:10505734-10505756 AGCGAAGGGAGATAGAGGTGGGG - Intergenic
1134388738 16:13798410-13798432 AGGGGAGGGAAGTCCATGAGGGG - Intergenic
1134477991 16:14592499-14592521 AGAAGAGGGAGAGCCAGTAGAGG + Intronic
1134849288 16:17467966-17467988 TTTGGAGGGAGATTCAGGAGTGG - Intronic
1135110317 16:19685898-19685920 AGAGGAGGGAGAGGAAGGAGAGG - Intronic
1135743670 16:24998038-24998060 AGCGGAAGGAGAACCAGGGCAGG + Intronic
1135920022 16:26641540-26641562 AGGGGAGGGAGATGGAGGATGGG - Intergenic
1136690288 16:32023877-32023899 ATAGGAAGGAGATCCAGGAGAGG + Intergenic
1136790877 16:32967441-32967463 ATAGGAAGGAGATCCAGGAGAGG + Intergenic
1136878938 16:33886491-33886513 ATAGGAAGGAGATCCAGGAGAGG - Intergenic
1137039691 16:35599357-35599379 AGGGGAGGGACAGGCAGGAGTGG + Intergenic
1138598379 16:58041419-58041441 AGTGTGGGGAGATCGAGGAGGGG + Intronic
1139088772 16:63618527-63618549 AGCAGAGAGAGATCAAGCAGAGG + Intergenic
1140760847 16:78107518-78107540 AGGGGATGGAGATTAAGGAGTGG + Intronic
1140888182 16:79262526-79262548 AGGGAAGGGAGCTCCAGCAGAGG + Intergenic
1141322794 16:83027487-83027509 AGAGTAGGGAGATGCAAGAGTGG + Intronic
1141841383 16:86576417-86576439 CGCGTGGGGAGCTCCAGGAGGGG + Intronic
1142127008 16:88415251-88415273 AGCTGAGCGAGGTCCTGGAGAGG + Intergenic
1142358076 16:89613521-89613543 AGAGGAGGGAAATGGAGGAGGGG - Intronic
1203093082 16_KI270728v1_random:1228898-1228920 ATAGGAAGGAGATCCAGGAGGGG + Intergenic
1142477035 17:194606-194628 AGCGGAGGGCCATCCATCAGCGG + Intergenic
1143125021 17:4636474-4636496 TGCAGAGGGAGATCAAGGAGAGG - Intronic
1143403492 17:6660683-6660705 TGCAGAGGGAGATGAAGGAGAGG + Intergenic
1143928087 17:10391090-10391112 AGTGGAGGGATAACCAGGAAGGG + Intronic
1144174569 17:12692736-12692758 AGAAGAGGGAGAACCAGGTGCGG - Intronic
1146773393 17:35589509-35589531 ACTGGAGGGAGATATAGGAGAGG + Intronic
1147153145 17:38530012-38530034 ATAGGAAGGAGATCCAGGAGAGG + Exonic
1148576177 17:48712920-48712942 AGTGGAGGGAGATCATAGAGAGG + Intergenic
1148755773 17:49972258-49972280 ACCGCAGCGCGATCCAGGAGTGG + Intronic
1148793909 17:50188222-50188244 AGGAGAGAGAGATCCAGCAGAGG - Intronic
1149991156 17:61384276-61384298 AGCGGAGGGCCCTCCAGGAGCGG - Intronic
1151363979 17:73605315-73605337 AGAGGATGGAGGTCCAGGTGAGG + Intronic
1151377354 17:73699055-73699077 AGAGGAGAGTGGTCCAGGAGGGG - Intergenic
1151499230 17:74478249-74478271 AGCAGAGGTATAGCCAGGAGGGG - Intronic
1152092748 17:78256206-78256228 ATAGGAGAAAGATCCAGGAGGGG + Intergenic
1152699132 17:81810606-81810628 AGCGGAGGCTGGTCCAGGGGAGG + Intronic
1154148560 18:11887030-11887052 AGCGGAGGGAAACGCAGGTGAGG + Intronic
1155172979 18:23280854-23280876 AGGTGAGGGAGCTCCAGAAGAGG - Intronic
1157055463 18:44223249-44223271 AGCTGATGGAGATCATGGAGAGG - Intergenic
1157315156 18:46580720-46580742 AGTGGAGGGACATCTTGGAGTGG + Intronic
1158171435 18:54605013-54605035 AGTGGAGGTCTATCCAGGAGAGG + Intergenic
1160009456 18:75093915-75093937 AGCGAAGGGAGATCGGGGTGGGG + Intergenic
1160703183 19:517925-517947 GGAGGAGGGAGATCCAGGTTGGG + Intronic
1160703200 19:517974-517996 GGAGGAGGGAGATCCAGGTTGGG + Intronic
1161431102 19:4232996-4233018 AGCGGATGGGGATCCCGGGGTGG - Intronic
1161661405 19:5548890-5548912 AGCGAAGGGAGATACGGGTGGGG - Intergenic
1162832944 19:13298561-13298583 CGCGGAGGGAGGACAAGGAGCGG - Exonic
1163378271 19:16947536-16947558 AGTGGATGGACATGCAGGAGAGG - Intronic
1165902262 19:39174367-39174389 TGCCGAGGGACACCCAGGAGTGG - Intronic
1166181382 19:41111648-41111670 GGCGGGGGGAGTTCCAAGAGAGG + Intergenic
1166409384 19:42546703-42546725 AGTGGTGGGTGTTCCAGGAGGGG + Intronic
1166981630 19:46635031-46635053 GGCAGAGCGAGAGCCAGGAGGGG + Intergenic
1167270164 19:48501917-48501939 AGAGGAGGAGGGTCCAGGAGAGG - Intronic
925338356 2:3115154-3115176 AGCGGCGGGAGAGCCAGCAAAGG + Intergenic
925704823 2:6674376-6674398 AGTGGAGGGAGATGCAGCATTGG + Intergenic
925828274 2:7872018-7872040 AGTGGAGGGAGAAGCAGCAGAGG - Intergenic
926589065 2:14720335-14720357 ACCTGGGGGAGATACAGGAGGGG - Intergenic
926812183 2:16765073-16765095 AGCACAGGGAGGGCCAGGAGAGG - Intergenic
927045439 2:19273476-19273498 AGCAGAGGCAGATCCAGGATGGG + Intergenic
927965147 2:27263428-27263450 CGCGGAGGCAGAAACAGGAGCGG + Intronic
930510496 2:52337935-52337957 AGCGAAGGGAGATAGAGGTGGGG - Intergenic
930685434 2:54302444-54302466 AGCAGAGGAAGAACCAGGAAAGG - Intronic
931853888 2:66281510-66281532 AGATGGAGGAGATCCAGGAGAGG - Intergenic
934562084 2:95318589-95318611 AGAGGAGGGAGAGCCTGGAGTGG - Intronic
934843499 2:97646363-97646385 AGCGGAGTGAGTTCGGGGAGCGG - Intronic
935612297 2:105038067-105038089 AGCTGTGGGAGCTCCAGGACCGG - Exonic
935857379 2:107289697-107289719 AAGAGAGGGAGATCCAGGTGCGG + Intergenic
935973569 2:108555411-108555433 GGCAGAGGGAGATCCAGGCCTGG - Intronic
936810259 2:116390352-116390374 AGCAGAGGGAGAGGCAGGATCGG - Intergenic
937452182 2:122010751-122010773 AGCGGAGGCAAACCCTGGAGGGG + Intergenic
937471214 2:122175462-122175484 AGTGGAGGGAGACCCTCGAGAGG + Intergenic
938225214 2:129609956-129609978 TGCGGAAGCAGATCCAGGGGAGG - Intergenic
939108600 2:137979929-137979951 AGCTGAAGGAGATGAAGGAGAGG - Intronic
940340107 2:152571186-152571208 AGAGAAGGGAGAGCCAGGAGAGG - Intronic
941177123 2:162211519-162211541 AGCAGAAGGAGAACCATGAGAGG + Intronic
942693456 2:178612140-178612162 GGCGTAGGGTGGTCCAGGAGTGG + Exonic
942866323 2:180679829-180679851 AGCTGAGGCAGATCCTGCAGAGG - Intergenic
943458808 2:188143479-188143501 GGTGCAGGGAAATCCAGGAGAGG - Intergenic
943746979 2:191472220-191472242 AGGGTAGGGAGATTGAGGAGAGG - Intergenic
946306406 2:218859342-218859364 TGCGGAGGGAGATGCTGGCGCGG - Intergenic
948200534 2:236127073-236127095 AGCTGAGGGAGGCCCACGAGCGG + Exonic
948275151 2:236702823-236702845 AAGGGAGGGAGAGCCAGGAGAGG - Intergenic
948336684 2:237213919-237213941 AGCGGGTTGTGATCCAGGAGAGG + Intergenic
949074508 2:242046618-242046640 AGCGGAGAGAGATGCCGGGGCGG + Intergenic
1168951195 20:1803360-1803382 AGCGGAGGGAGCGGCGGGAGCGG - Intergenic
1169135728 20:3195933-3195955 AGCAGGAGGAAATCCAGGAGAGG - Intronic
1169493724 20:6093214-6093236 AGGGGAGGGAGATTCGAGAGTGG - Intronic
1171381017 20:24734253-24734275 AGAGCAGGGAGGACCAGGAGTGG + Intergenic
1172511602 20:35504704-35504726 AGCTGAGGGAGACCCAGCAAAGG + Exonic
1172650688 20:36499709-36499731 AGCGGAGGGAGGGAGAGGAGAGG - Intronic
1172765889 20:37350515-37350537 GGGGGAGGGAGACCCAGTAGAGG + Intronic
1173306322 20:41853871-41853893 AGCAGAGTGAGATCCAGGAGTGG + Intergenic
1173589244 20:44211122-44211144 AGCGCAAGGAGATCCCGGGGCGG - Intergenic
1173782175 20:45765121-45765143 AGCGAAGGGAGATCAGGGTGGGG - Intronic
1174393643 20:50233264-50233286 CGGGCAGGGAGACCCAGGAGAGG - Intergenic
1174800629 20:53560450-53560472 AGGGGTGAGAGAACCAGGAGAGG + Intergenic
1175424854 20:58856839-58856861 TGAGGAGGGGGATCCTGGAGAGG - Intronic
1175468346 20:59208237-59208259 AGAGGAGGGAGATGGAGGTGAGG - Intronic
1176101412 20:63366141-63366163 AGGGCAGGGAGCACCAGGAGAGG - Intronic
1176101423 20:63366181-63366203 AGGGCAGGGAGCACCAGGAGAGG - Intronic
1176101439 20:63366241-63366263 AGGGCAGGGAGCACCAGGAGAGG - Intronic
1176101445 20:63366261-63366283 AGGGCAGGGAGCACCAGGAGAGG - Intronic
1177905488 21:26967247-26967269 AGAGGAGGGTGATCGAGGAAAGG + Intergenic
1179466567 21:41579691-41579713 AGAGGAGGGAGATTAGGGAGAGG - Intergenic
1179511896 21:41879011-41879033 CGCGCAGGGCGATCCCGGAGCGG + Exonic
1179516244 21:41909361-41909383 GGCGGTGGGAGATCCAGCAGAGG - Intronic
1181079138 22:20402202-20402224 AGTGGAGGGGGATGGAGGAGGGG - Intronic
1181633051 22:24161474-24161496 GGCTGAGGGAGAACTAGGAGAGG + Intronic
1182979218 22:34652618-34652640 AGAAGAGGGAGATCCCGAAGTGG + Intergenic
1183606068 22:38867249-38867271 GGCGTAGGGACATCCAGGGGAGG - Intronic
1184278604 22:43424950-43424972 AGCGGTGGGAGATGCCGGGGCGG + Exonic
1185173548 22:49306798-49306820 AGCAGAGGGAGAGGCAAGAGTGG - Intergenic
950217170 3:11167975-11167997 AGCAGAGGGACATGCAGGAGAGG + Intronic
950743010 3:15064810-15064832 GGAGGAAGGAGATCCAGGAGTGG + Intronic
952170657 3:30803263-30803285 AGGGCAGGGAGATGCAGCAGTGG - Intronic
952558614 3:34562642-34562664 AGGGGAGGGAAATCTATGAGTGG - Intergenic
952849971 3:37719772-37719794 ATCTCAGGGAGCTCCAGGAGAGG - Intronic
952938648 3:38422476-38422498 AGGGTTGGGAGATACAGGAGCGG + Intergenic
953089783 3:39713309-39713331 TGTGGAGGGAGAGACAGGAGAGG + Intergenic
954135554 3:48580592-48580614 AGACCAGGGAGATCCTGGAGAGG - Exonic
954635584 3:52069090-52069112 AGCTGAGGCTGATCCTGGAGTGG + Intergenic
957995061 3:87679090-87679112 TGTGGAGGGAGATACACGAGCGG + Intergenic
958468101 3:94483282-94483304 AGGGCAGGGAGTGCCAGGAGGGG + Intergenic
961038440 3:123660034-123660056 AGGGAAGGGACATCCAGGTGGGG - Intronic
961085204 3:124061132-124061154 TGCGGAGGCAGATACACGAGGGG + Intergenic
962280696 3:134049643-134049665 GGGGGCGGGAGATGCAGGAGAGG - Intronic
962920694 3:139948118-139948140 AGCAGAGAAAGATCCTGGAGGGG - Intronic
963608949 3:147441062-147441084 AGAGAAGGAAAATCCAGGAGAGG + Intronic
963781660 3:149492574-149492596 AGCAGAGGATGAGCCAGGAGTGG + Intronic
964075161 3:152684333-152684355 AGTGGAGGGAGACCCAGAATGGG + Intergenic
964664271 3:159154895-159154917 AGGGGAGGGAGAGGAAGGAGAGG - Intronic
965723942 3:171693469-171693491 ATTGGAGGGGGATCCATGAGTGG - Intronic
966023968 3:175252486-175252508 AGGAGAGGGAGGCCCAGGAGAGG - Intronic
966636479 3:182139981-182140003 AGTTGAGGGAGGGCCAGGAGAGG - Intergenic
967543142 3:190692588-190692610 AGCAGAGGCAGATTCAGGAGAGG - Intergenic
967930598 3:194687684-194687706 GGCAGAGGGAGATCCAGCAGAGG + Exonic
968652979 4:1767369-1767391 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968652988 4:1767387-1767409 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968652997 4:1767405-1767427 AGGGGAGGGAGGGGCAGGAGGGG - Intergenic
968808804 4:2791012-2791034 TGCGGAGGGAGCTCCAGGCTGGG - Intergenic
968949724 4:3684232-3684254 AAGGGAAGGAGCTCCAGGAGCGG - Intergenic
968952605 4:3702617-3702639 AGCAGAGGCAGATGCAGGAGCGG - Intergenic
969413799 4:7045990-7046012 AGAGGAGGCAGAGCCAGGACAGG + Intronic
969544976 4:7820054-7820076 AGCATAGGGAAATCCATGAGAGG + Intronic
975995376 4:80307980-80308002 AGCTGAGGGAGAGACTGGAGAGG + Intronic
978137168 4:105276189-105276211 AGACGAGGGAGATCCTGGTGGGG - Exonic
979357683 4:119724646-119724668 AGAGGATCGAGAGCCAGGAGGGG + Intergenic
981529663 4:145739935-145739957 AGAGGAGGGAGATCTGGGAAAGG + Intronic
982521381 4:156420643-156420665 AGGGGAGTGAGGTGCAGGAGGGG + Intergenic
985535209 5:460819-460841 AGCTGAGGGTGATCAAGGAACGG - Intronic
985553067 5:543035-543057 TGCGGAGGAAGGTCCAGGGGAGG + Intergenic
985964021 5:3325909-3325931 AACGGAGGGAGACGCAGGAACGG - Intergenic
987487960 5:18543894-18543916 AGCGAAGGGAGATAAAGGTGGGG - Intergenic
990948618 5:61275234-61275256 AGAGGAAGGAGAGCCAGGTGGGG - Intergenic
994507068 5:100656757-100656779 TGTGGAGGGAGAGGCAGGAGCGG + Intergenic
995221654 5:109655019-109655041 AGCAGAGGCAGATGCAGGACTGG - Intergenic
995858224 5:116615679-116615701 AGCGAAGGGAGATAGAGGTGAGG + Intergenic
995883424 5:116867534-116867556 AGCGAAGGGAGATAGAGGTGGGG + Intergenic
996744911 5:126839439-126839461 AGCGAAGGGAGATAAGGGAGGGG + Intergenic
998059236 5:139106020-139106042 AGGGGAGGGGGACGCAGGAGTGG + Intronic
998290006 5:140905956-140905978 AGGGGAGGAAGATCCAGCATGGG + Intronic
998443560 5:142181401-142181423 AGCTCAGGGAGAGCCAGGTGGGG - Intergenic
999395390 5:151223794-151223816 ACCGGACGGAGAACCTGGAGAGG - Intronic
999743831 5:154576697-154576719 AGAGGAGAGAGCTCAAGGAGGGG + Intergenic
1000779556 5:165464503-165464525 AGCAGAGCGAAATACAGGAGTGG + Intergenic
1002454589 5:179338902-179338924 AGGGGAGGGCGATCCTGGAAGGG + Intronic
1002784810 6:392750-392772 TGCGGAAGGAGGGCCAGGAGGGG + Intronic
1003059692 6:2853494-2853516 AGGGGAGGGGGCTCCAGGAGAGG - Intergenic
1003059730 6:2853585-2853607 AGGGGAGGGGGTCCCAGGAGAGG - Intergenic
1003059743 6:2853617-2853639 AGGGGAGGGGGCTCCAGGAGAGG - Intergenic
1003059766 6:2853675-2853697 AGGGGAGGGGGTCCCAGGAGAGG - Intergenic
1005332916 6:24766302-24766324 TGTGGAGGGAGAGGCAGGAGCGG - Intergenic
1006014395 6:31068203-31068225 AGGGGAGGGAGAGGGAGGAGAGG + Intergenic
1006180730 6:32151975-32151997 GGCGGAGGGAGAGCGGGGAGGGG + Intronic
1007109095 6:39302820-39302842 GGATGAGGGAGATCCAGAAGGGG + Intronic
1007398114 6:41588715-41588737 AGCAGCTGGAGATCCAGGTGTGG + Exonic
1007496034 6:42260872-42260894 AGCTGAGGGAGAAACAGAAGGGG - Intronic
1007746989 6:44049182-44049204 GGGGGAGGGCGTTCCAGGAGGGG - Intergenic
1008717353 6:54305292-54305314 AGGGGAGGGAGAAGGAGGAGTGG + Intergenic
1013012686 6:106134534-106134556 AGCCCAGGCAGAACCAGGAGAGG + Intergenic
1013349410 6:109291802-109291824 AAGGGAGGGAGTTCCAGCAGTGG + Intergenic
1014667764 6:124260560-124260582 AGTGGAGGGAATTGCAGGAGAGG + Intronic
1015843738 6:137497242-137497264 AGCAGAGGGTGACCGAGGAGCGG - Intergenic
1016519281 6:144928732-144928754 AGCGAAGGGAGATACGGGTGGGG - Intergenic
1017378360 6:153797534-153797556 AGTGGAGGCAGAGCCAGGGGTGG + Intergenic
1018568586 6:165183812-165183834 TACAGAGGGTGATCCAGGAGGGG + Intergenic
1019276658 7:179478-179500 AGCGGAGGGAGAGACAGGGCAGG + Intergenic
1019306479 7:337727-337749 AGCGGAGGGGAAGTCAGGAGAGG + Intergenic
1021482907 7:21137285-21137307 AGTGGAAGGAGAGTCAGGAGAGG - Intergenic
1021534498 7:21688204-21688226 AGGGGAGAGAGATGTAGGAGAGG - Intronic
1021594479 7:22300682-22300704 AGTGTAGGGGAATCCAGGAGAGG - Intronic
1021978196 7:26029473-26029495 AGCGAAGGGAGATACGGGTGGGG + Intergenic
1022141831 7:27499593-27499615 AGAGCAGGCAGGTCCAGGAGGGG - Intergenic
1023108038 7:36782340-36782362 AGAGCAGGCAGACCCAGGAGTGG - Intergenic
1023137091 7:37063708-37063730 TGCGGAGGGAGATAGCGGAGGGG - Intronic
1023264890 7:38394142-38394164 AGCTGAGGGGGCCCCAGGAGAGG - Exonic
1024912579 7:54463091-54463113 AGAGGATGGAGAGACAGGAGGGG - Intergenic
1026564903 7:71481699-71481721 AGCTGTGGGAGAACCTGGAGGGG - Intronic
1026907934 7:74073678-74073700 AACGGAGGTAGAGCCAGGTGAGG - Intergenic
1027232991 7:76282765-76282787 AGCGGCTGGAGCTCCAGGAGCGG - Exonic
1028435535 7:90798928-90798950 AGGGCTGGGAGATACAGGAGAGG + Intronic
1029105010 7:98167836-98167858 AGAGGAGGGAGAGCCAGTGGGGG + Intronic
1031627612 7:124008590-124008612 AGCGAAGGGAGATAGAGGTGGGG - Intergenic
1032490561 7:132321124-132321146 GGCGGACGGAGAGCCAGGTGAGG - Intronic
1032504543 7:132425493-132425515 AGGGGAGGAGGAGCCAGGAGGGG - Intronic
1033543202 7:142376128-142376150 GGTGGAGGGTGACCCAGGAGAGG + Intergenic
1034674834 7:152884874-152884896 AGCGAAGGGAGATACCGGTGGGG - Intergenic
1035426300 7:158777263-158777285 GGAATAGGGAGATCCAGGAGAGG + Intronic
1035689721 8:1552111-1552133 AGGGCAGGGAAGTCCAGGAGTGG - Intronic
1037306402 8:17509040-17509062 AGTGGAGGCAGCTCTAGGAGTGG + Intronic
1037547613 8:19939676-19939698 CCCGGAGTGGGATCCAGGAGGGG + Intronic
1037988285 8:23303135-23303157 AGCTGAGGAAGGTCCAGGTGGGG + Intronic
1039455614 8:37703954-37703976 AGCAGAGGGAGAGGCAGAAGAGG + Intergenic
1039888234 8:41667646-41667668 AAAGGAGGGAGGGCCAGGAGAGG + Intronic
1041051553 8:53939589-53939611 AGCGGATGGAGATGCGGAAGCGG + Exonic
1042533125 8:69834413-69834435 AGCCGAGGGAGATGCCGGAGCGG - Intronic
1044969278 8:97604377-97604399 ATCAGAGGGAGACCCTGGAGAGG - Intergenic
1045197147 8:99943999-99944021 AGCGAAGGGAGATAAAGGTGGGG - Intergenic
1046146116 8:110160798-110160820 AGTGGAGGGAGAGGAAGGAGAGG + Intergenic
1046734037 8:117756937-117756959 AGGAGAGGGAGATACAGGAAAGG + Intergenic
1049225816 8:141450001-141450023 AAAGCGGGGAGATCCAGGAGGGG - Intergenic
1049786296 8:144452441-144452463 AGCTGATGGAGATCCTGGATGGG - Exonic
1049788732 8:144463302-144463324 AGCGGAGAGACTTCCAGGAGAGG + Intronic
1049831875 8:144705857-144705879 AGAGGAGGGGGATCCAGAGGAGG - Intergenic
1050125194 9:2349331-2349353 AGAGGAGGGAAATGCAGGTGGGG - Intergenic
1050416964 9:5428291-5428313 AGCAGAGGGAGTTGGAGGAGAGG - Intronic
1051052311 9:12948702-12948724 AGCGGAGGGAGATAAAGGTGGGG - Intergenic
1051053121 9:12954004-12954026 AGCGGAGGGAGATAAGGGTGGGG - Intergenic
1051357118 9:16249971-16249993 ACGGGAAGGAGATGCAGGAGAGG - Intronic
1051412877 9:16809250-16809272 ATCAGAGAGTGATCCAGGAGGGG - Intronic
1051428604 9:16959870-16959892 AACAGAGGGAGAAGCAGGAGGGG - Intergenic
1054718758 9:68583104-68583126 CGCGGCGGGTGATCCAGGACAGG - Intergenic
1055507288 9:76961423-76961445 AGCAGAGGGAGAGCGAGAAGGGG - Intergenic
1056771438 9:89480785-89480807 TGTGGAGGGAGAGGCAGGAGCGG - Intronic
1057387117 9:94614130-94614152 AGAGGAGGGAGAAGGAGGAGGGG + Intronic
1058365079 9:104200144-104200166 AGCACAGGGAGAACGAGGAGAGG - Intergenic
1058680516 9:107436667-107436689 AGTTGAGGGAGCTCCAGGGGTGG - Intergenic
1058961098 9:109993698-109993720 AGGGGAGGGAGAATGAGGAGAGG - Intronic
1060402256 9:123355838-123355860 TGGGGAGGGGGATCCAGGAGAGG + Intergenic
1060522071 9:124299622-124299644 AGCGCTGGGAGACCCAGGTGGGG + Intronic
1060814267 9:126626541-126626563 TGCAGAGGGGGCTCCAGGAGAGG - Intronic
1061783227 9:133007974-133007996 AGAGGAGGGAGAGAGAGGAGGGG - Intergenic
1062400898 9:136372211-136372233 AGCCCAGGGGCATCCAGGAGAGG + Intronic
1062562445 9:137147708-137147730 GGCAGAGGGAGACCAAGGAGAGG + Intronic
1185450599 X:279011-279033 AGCGAAGGGAGATGGGGGAGGGG + Intronic
1185508329 X:644713-644735 CGCGGAAGGAGCTCCAGGCGGGG - Exonic
1190381471 X:49843336-49843358 AGAGGAGGGAGAGAGAGGAGAGG - Intergenic
1190505434 X:51120460-51120482 ATCGGAGGGAGACCGTGGAGAGG + Intergenic
1190822280 X:53985075-53985097 AGCAGTGGGAGCTCCAGCAGTGG - Exonic
1191216563 X:57937665-57937687 GGGGGAGGGGGATCCAGCAGTGG + Intergenic
1191762175 X:64657543-64657565 AGCGAAGGGAGATAGAGGTGGGG - Intergenic
1191784589 X:64903761-64903783 AGGGGAGGGAAATCCAGGCCTGG - Intergenic
1195925485 X:110020563-110020585 AGTGGAATGAGATCCAGGAGAGG + Intronic
1196752179 X:119127965-119127987 AGAGGAGAGAGATCCAGCAAAGG - Intronic
1197753575 X:129980904-129980926 AGGGGAGGGAGAGCCGGGGGTGG + Intergenic
1198210599 X:134512325-134512347 AGGGCAGGGAGATCCCGGAGTGG + Intronic
1198992663 X:142533291-142533313 AGCGGAGCCAGTTCCTGGAGGGG + Intergenic
1200134715 X:153869327-153869349 AGCCGAGGGAGATGTAAGAGGGG - Intronic
1200398297 X:156003972-156003994 AGCCGAGTGAGATCCAGGGCTGG + Intronic
1201340032 Y:12924254-12924276 AGGGGAGGGATTTCTAGGAGAGG + Intergenic
1201479892 Y:14428083-14428105 TGTGGAGGGAGAGACAGGAGCGG + Intergenic