ID: 1103826362

View in Genome Browser
Species Human (GRCh38)
Location 12:123742259-123742281
Sequence CTGGCCATTTTTGGTGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 537}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103826352_1103826362 28 Left 1103826352 12:123742208-123742230 CCAGCTGCTTTTTGTGGTTTGGC 0: 1
1: 0
2: 2
3: 20
4: 292
Right 1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG 0: 1
1: 0
2: 3
3: 51
4: 537
1103826360_1103826362 -8 Left 1103826360 12:123742244-123742266 CCAGGGAGGTTCTTTCTGGCCAT 0: 1
1: 0
2: 2
3: 11
4: 160
Right 1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG 0: 1
1: 0
2: 3
3: 51
4: 537
1103826359_1103826362 -7 Left 1103826359 12:123742243-123742265 CCCAGGGAGGTTCTTTCTGGCCA 0: 1
1: 0
2: 1
3: 17
4: 154
Right 1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG 0: 1
1: 0
2: 3
3: 51
4: 537
1103826355_1103826362 6 Left 1103826355 12:123742230-123742252 CCTCCTCTGCTTTCCCAGGGAGG 0: 1
1: 1
2: 5
3: 59
4: 497
Right 1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG 0: 1
1: 0
2: 3
3: 51
4: 537
1103826357_1103826362 3 Left 1103826357 12:123742233-123742255 CCTCTGCTTTCCCAGGGAGGTTC 0: 1
1: 0
2: 0
3: 19
4: 241
Right 1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG 0: 1
1: 0
2: 3
3: 51
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103826362 Original CRISPR CTGGCCATTTTTGGTGTTGT TGG Intronic
900201542 1:1409594-1409616 CTGGCCAATTTTTGTATTTTTGG + Intergenic
900661378 1:3786029-3786051 CTGGCTAATTTTTGTGTTTTCGG + Intronic
901024522 1:6272039-6272061 ATGATCATTATTGGTGTTGTAGG - Intronic
901106439 1:6759942-6759964 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
901117641 1:6861115-6861137 CCGGCTAATTTTTGTGTTGTTGG + Intronic
901251372 1:7783145-7783167 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
901582326 1:10255108-10255130 CTGGCTAATTTTTGTGTTTTTGG + Intronic
901595546 1:10382709-10382731 CTGGCCATGTTGGGTTTTTTTGG + Intergenic
902750516 1:18506102-18506124 CTGACTATTTTTGGGGTTTTTGG + Intergenic
903567116 1:24275975-24275997 CTGGCTACTTTTTGTGTTTTAGG + Intergenic
903605372 1:24571745-24571767 CTGGCTAATTTTTGTGTTTTTGG + Intronic
903768993 1:25752326-25752348 CTGGCTATTTTTTGTATTTTTGG + Intronic
905164607 1:36071616-36071638 CTGGCCTTTTTTGTTGTTGTTGG + Exonic
907108021 1:51901657-51901679 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
907214694 1:52852208-52852230 CTGGCCAGTTTTTGTATTTTTGG + Intronic
908078305 1:60545319-60545341 CTGGGCAATTTTGATGTTGTGGG - Intergenic
908147438 1:61261717-61261739 CTTGCTTTTTTTGTTGTTGTTGG - Intronic
908818974 1:68063351-68063373 TTGGTCAATTTTGGTTTTGTTGG - Intergenic
909096400 1:71293424-71293446 CTGGCAAATTTTTGTGTTTTTGG - Intergenic
909411678 1:75360185-75360207 TTGTCCATTTTTGCTTTTGTTGG + Intronic
910914686 1:92276498-92276520 CTGGCCAATTTTTGTATTTTGGG - Intronic
911588093 1:99714343-99714365 CTGGCTAATTTTAGTGTTTTTGG + Intronic
911698160 1:100917377-100917399 CTTGACCTTTTTGGTGCTGTGGG + Intronic
912282786 1:108334298-108334320 CTGGCCAATTTTTGTATTTTTGG - Intergenic
913101094 1:115567286-115567308 CTGGGCTTTTTTGTTATTGTTGG - Intergenic
914228198 1:145739739-145739761 CTGGCTAATTTTTGTGTTTTTGG + Exonic
915164831 1:153942622-153942644 CTTGCCATTTCTGGGGTAGTGGG - Exonic
915799070 1:158769323-158769345 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
916221873 1:162452668-162452690 CTGGACATTTTTTGTTTGGTAGG - Intergenic
916590401 1:166184590-166184612 CTGGCGATCTTTGGTTTTCTTGG + Intergenic
916639882 1:166716450-166716472 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
917284831 1:173413041-173413063 CTGTCCATTTTTGGTCTGGGTGG - Intergenic
917457074 1:175194073-175194095 CTAGCCATTTTTGGCGTTTCAGG - Intergenic
918528808 1:185494723-185494745 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
918839153 1:189512710-189512732 CTTGCCATTTTTGTTCTTGGTGG - Intergenic
919594129 1:199540418-199540440 TTGTCCTTTTTTAGTGTTGTTGG - Intergenic
919665071 1:200283803-200283825 CTGGGCACTTTTGGTAGTGTAGG - Intergenic
920005312 1:202828975-202828997 CTGGCTATTTTTTGTATTTTTGG - Intergenic
920321207 1:205124163-205124185 CTGGCTATTTTTTGTATTTTTGG - Intergenic
920498652 1:206472741-206472763 CTGGAGATTTGTGGTGGTGTGGG + Intronic
920861901 1:209715909-209715931 CAGGTCATTTGTGGTGTTTTTGG - Intronic
920889746 1:209973103-209973125 CTGTCCTTTTTTATTGTTGTTGG + Intronic
920894849 1:210037055-210037077 CTGGGCTTTTTTGTTGTTGTTGG + Intronic
922071644 1:222200654-222200676 CTGGCCCCTTTTGCTGTTTTTGG - Intergenic
923768073 1:236911446-236911468 CTGGCCAATTTTTGTATTTTTGG + Intergenic
924412222 1:243818769-243818791 CTGGCCTTTTTTGTTCTTGGTGG - Intronic
924541036 1:244981019-244981041 CTGGCTAATTTTTGTGTTTTGGG - Intronic
1062821561 10:537949-537971 CTGGCTATTTTTTGTATTTTTGG + Intronic
1063193920 10:3722373-3722395 CTACACATTTTTGGTGCTGTGGG + Intergenic
1064920062 10:20506177-20506199 CTGGCTAATTTTGGTATTTTTGG - Intergenic
1064936552 10:20684928-20684950 CCTGCCAGTTTTGGTTTTGTGGG - Intergenic
1065043264 10:21718883-21718905 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1065407496 10:25385977-25385999 TTGTCTATTTTTGGTTTTGTTGG + Intronic
1066679819 10:37926917-37926939 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1067128690 10:43542185-43542207 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1068239554 10:54288158-54288180 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1069481602 10:68787671-68787693 CTGGCCAATTTTTGTATTTTTGG - Intronic
1069554342 10:69387446-69387468 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1069676170 10:70249642-70249664 CTGGCTAATTTTTGTGTTTTTGG + Exonic
1070105501 10:73427127-73427149 CTGCTTATTTTTGGTGTTATTGG - Intronic
1071015562 10:80993341-80993363 CTGGACTTTTTTGTTGTTGGTGG + Intergenic
1073092470 10:100953811-100953833 CTGGCCAATTTTTGTATTTTTGG + Intronic
1073269108 10:102246576-102246598 CTGGCAAAGTTTGGTATTGTCGG + Intronic
1073805381 10:107091986-107092008 CTGGCCTGTTTTGGTCCTGTAGG - Intronic
1073882708 10:108001993-108002015 CTGGCCATTTCTTGGCTTGTAGG + Intergenic
1073900198 10:108212045-108212067 CTGGACTTTTGTGTTGTTGTTGG + Intergenic
1074723529 10:116284645-116284667 CTGGCAATCTTTGGTGTTCTTGG + Intergenic
1074911964 10:117919525-117919547 GTGGCCTTTTTTGGTGGTATGGG + Intergenic
1075156235 10:119978201-119978223 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1075590054 10:123684615-123684637 CTGGCCATTTTTGGATTCCTTGG + Intronic
1076489790 10:130850838-130850860 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1077936646 11:6795068-6795090 CTGGCCATTTTTATTCTTCTAGG - Exonic
1078405328 11:11065718-11065740 CTGGCCACTCTTGTTATTGTGGG - Intergenic
1078673819 11:13390503-13390525 CTGGCTAATTTTTGTATTGTTGG + Intronic
1079048031 11:17125960-17125982 CTGGCTAATTTTTGTGTTTTGGG - Intronic
1079208977 11:18443619-18443641 CTGGCCACTTTTTGTATTTTTGG + Intronic
1079420564 11:20283401-20283423 CTGGCCATTTTGGGATTGGTTGG - Intergenic
1080550941 11:33373838-33373860 CTGGACAATTGTGGTGTTGATGG - Intergenic
1080916901 11:36668965-36668987 CTGGCCATTTTGAGTTTTGGGGG + Intergenic
1081630431 11:44685804-44685826 CTGGACATATGTGGTTTTGTCGG + Intergenic
1082620025 11:55408849-55408871 CTGGGCTTTTTTGTTGTTGTTGG + Intergenic
1082966005 11:58966700-58966722 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1082978300 11:59097240-59097262 CTTGCTATTTCTGGTGATGTTGG + Intergenic
1083487116 11:62990203-62990225 CTGGCCATTTATGATCATGTTGG - Intronic
1084439419 11:69163785-69163807 CTGTTCGTTTTTGGTGTGGTTGG - Intergenic
1085090506 11:73708741-73708763 TTGCCCATTTTCTGTGTTGTAGG - Intronic
1085122107 11:73973868-73973890 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1085965470 11:81517975-81517997 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1086413797 11:86569003-86569025 CTGCCCATTTCATGTGTTGTGGG + Intronic
1086507623 11:87522443-87522465 CAGGCCATTTTTGATGTTGATGG + Intergenic
1088217156 11:107523762-107523784 CTGGCCAATTTTTGTATTTTTGG + Intronic
1088271745 11:108041436-108041458 CTGGCCAATTTTTGTATTTTTGG + Intronic
1088840420 11:113623016-113623038 CTGGCCAATTTTCGTATTTTTGG + Intergenic
1089083143 11:115794434-115794456 TAGCACATTTTTGGTGTTGTAGG + Intergenic
1089711746 11:120319982-120320004 CTGTGCCTTTTTGTTGTTGTGGG + Intergenic
1090806631 11:130206727-130206749 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1092744203 12:11658394-11658416 CTGGCCAATTTTTGTATTTTTGG + Intronic
1093413340 12:18892851-18892873 CTGGGCTTTTTTGGTGGTGGTGG + Intergenic
1094189649 12:27684268-27684290 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1094558790 12:31529661-31529683 CTGGCCAATTTTTGTATTTTTGG - Intronic
1095298463 12:40554481-40554503 TTGTCCTTTTTTGCTGTTGTTGG + Intronic
1095574232 12:43716742-43716764 CTGGCTATTTCTGGAGTTTTAGG - Intergenic
1095574561 12:43721205-43721227 CTGGCCCTTTTTGGTTTTAAGGG - Intergenic
1095866329 12:46976428-46976450 CTGGGCTTTTTTGTTGTTGTTGG + Intergenic
1096450066 12:51732085-51732107 CTGTCCATTTTTGCTTTGGTTGG + Intronic
1096474909 12:51902691-51902713 CCGGCTATTTTTTGTGTTTTTGG + Intergenic
1098202028 12:68066354-68066376 TTGTCCATTTTTACTGTTGTTGG + Intergenic
1099032333 12:77542436-77542458 CTTGGCTTTTTTGTTGTTGTTGG - Intergenic
1100131507 12:91499572-91499594 CTGGCCATCTTTGGCATTCTGGG - Intergenic
1100982860 12:100176118-100176140 CTGGCCATTTTTATTTTTGTAGG - Intergenic
1101504766 12:105336100-105336122 CAGGTCATTTTTAGTGCTGTAGG + Intronic
1102343875 12:112145705-112145727 CAGGCCATAATTGGTGTTGCAGG + Intronic
1102364490 12:112320171-112320193 CTGGCTATTTTTTGTATTTTTGG - Intronic
1102381712 12:112472660-112472682 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1103434736 12:120916010-120916032 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1103706130 12:122873901-122873923 CTTGGCTTTTTTGGGGTTGTGGG - Intronic
1103820100 12:123691028-123691050 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1103826362 12:123742259-123742281 CTGGCCATTTTTGGTGTTGTTGG + Intronic
1104604690 12:130179528-130179550 CTGTCCATGTTCGGTGTTGTGGG + Intergenic
1105773306 13:23633272-23633294 CTGGCTAGTTTTTGTGTTTTCGG + Intronic
1106025982 13:25955638-25955660 CTGGGCATTTTTTGGGTGGTAGG - Intronic
1106271670 13:28160101-28160123 CTGGCCAATTTTTGTATTTTTGG + Intronic
1106600749 13:31184538-31184560 CTGGCCCTTGATGGTGATGTAGG + Intergenic
1107654725 13:42579658-42579680 CTGGACTTTTCTGGTCTTGTGGG + Intronic
1108047420 13:46396283-46396305 CTGGCCAATTTTTGTATTTTTGG - Intronic
1108412449 13:50163482-50163504 CTGGCTAATTTTTGTATTGTTGG + Intronic
1108443716 13:50484551-50484573 CTTGCCTTTTTAGTTGTTGTGGG + Intronic
1109678867 13:65719429-65719451 ATGGACTTTTTTGTTGTTGTTGG - Intergenic
1110695746 13:78486309-78486331 CTGGCCAGTGTTGGTGGTGGAGG - Intergenic
1111502063 13:89134385-89134407 CTGGGCAGTTATGGTGATGTTGG + Intergenic
1112343046 13:98568156-98568178 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1112927202 13:104690797-104690819 CTGGGCATCTTTGGTGTTTGTGG - Intergenic
1113722006 13:112565249-112565271 CTTGCGAGTTATGGTGTTGTAGG - Intronic
1114243005 14:20886630-20886652 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1114603405 14:23974761-23974783 CTGGACTTTTTTGGTTTGGTAGG - Intronic
1115228134 14:31126827-31126849 CTGGCTAATTTTGGGGATGTAGG + Intronic
1115783244 14:36794604-36794626 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1116681375 14:47974073-47974095 TTGTCCATTTTTACTGTTGTTGG - Intergenic
1118190599 14:63576702-63576724 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1118781374 14:69010633-69010655 CTGGCCAATTTTTGTATTTTTGG + Intergenic
1120127333 14:80761114-80761136 CAGGCTATTTTTGTTGTTGTTGG - Intronic
1120690253 14:87584782-87584804 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1120721581 14:87894848-87894870 TTGTCTATTTTTGTTGTTGTTGG + Intronic
1122781655 14:104146334-104146356 CTGGCTGCATTTGGTGTTGTGGG + Intronic
1122833244 14:104414649-104414671 TTGGACATTTTTTGGGTTGTAGG + Intergenic
1122903016 14:104789662-104789684 CTGGCCATTGGTGGTCTGGTGGG - Intronic
1202892780 14_KI270722v1_random:175392-175414 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1123470130 15:20544426-20544448 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1123647923 15:22456271-22456293 TTGGCCATTTTTATTCTTGTGGG + Intergenic
1123697716 15:22891126-22891148 CTGGCCATCTTTAGTGTTTTAGG - Intronic
1123730426 15:23139422-23139444 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1123748564 15:23336840-23336862 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1124280943 15:28360718-28360740 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1124301761 15:28550907-28550929 TTGGCCATTTTTATTCTTGTGGG + Intergenic
1124446830 15:29742099-29742121 CTGGCTATTTTGGGTTTTCTGGG - Intronic
1124531835 15:30515409-30515431 TTGGCCATTTTTATTCTTGTGGG + Intergenic
1124766822 15:32492281-32492303 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1124951064 15:34321480-34321502 CTTGCCAAATTTGGTGTTTTTGG - Intronic
1125018878 15:34965507-34965529 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1125032448 15:35086270-35086292 TTGACCATTTTTAGTGTTTTAGG - Intergenic
1125850687 15:42900152-42900174 CCGGCCAATTTTTGTGTTTTTGG + Intronic
1126035410 15:44540431-44540453 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1126035433 15:44540600-44540622 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1126555422 15:49982537-49982559 CTGGGGATATTTGGTGCTGTAGG + Intronic
1127478283 15:59355092-59355114 CTGGGCACTTTTGGTCTAGTGGG + Intronic
1128189415 15:65677369-65677391 CTGGCTAATTTTTGTATTGTTGG + Intronic
1129036424 15:72652102-72652124 TTGGCCATTTTTATTCTTGTGGG + Intergenic
1129213465 15:74085123-74085145 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1129396937 15:75255963-75255985 TTGGCCATTTTTATTCTTGTGGG + Intergenic
1129400549 15:75280240-75280262 TTGGCCATTTTTATTCTTGTGGG + Intronic
1129474166 15:75772959-75772981 TTGGCCATTTTTATTCTTGTGGG + Intergenic
1129730591 15:77929437-77929459 TTGGCCATTTTTATTCTTGTGGG - Intergenic
1129820350 15:78597266-78597288 CTGGCCAATTTTTGTATTTTTGG - Intronic
1130551017 15:84889995-84890017 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1131123173 15:89835864-89835886 CTGGCCAATTTTTGTATTTTTGG - Intronic
1131159977 15:90099340-90099362 CAGGCCATTTTCGGTATTGGGGG - Intronic
1132348505 15:101122777-101122799 CTGGCCACTTTTGGTTTTTGAGG - Intergenic
1132852726 16:2032179-2032201 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1133529685 16:6643279-6643301 CTGGCCATTTGTGATATTGCAGG + Intronic
1133801210 16:9087012-9087034 CTGTCAATTTTTTGTGTTTTTGG + Intergenic
1134505296 16:14800935-14800957 TTGCCCATTTTTCCTGTTGTTGG + Intronic
1134575281 16:15327975-15327997 TTGCCCATTTTTCCTGTTGTTGG - Intergenic
1134694017 16:16209760-16209782 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1134727164 16:16428517-16428539 TTGCCCATTTTTCCTGTTGTTGG + Intergenic
1134775393 16:16848899-16848921 CTGGCTAATTTTTGTGTTTTGGG + Intergenic
1134940273 16:18283338-18283360 TTGCCCATTTTTCCTGTTGTTGG - Intergenic
1135658933 16:24277611-24277633 CTGGCCAATTTTTGTATTTTTGG - Intronic
1138636464 16:58342623-58342645 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1139321831 16:66120802-66120824 ATGGTCATTTGTGGTCTTGTTGG + Intergenic
1139839184 16:69864546-69864568 CTGTCCATTCTTTTTGTTGTGGG + Intronic
1140101812 16:71924427-71924449 CTGGCCAATTTTTGTATTTTGGG - Intronic
1141508042 16:84492741-84492763 CTGGCCAATTTTTGTATTTTTGG + Intronic
1141518284 16:84560861-84560883 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1141920205 16:87130517-87130539 CTGGCTATTTTTTGTATTTTTGG - Intronic
1142406044 16:89890568-89890590 CTTTACATTTTTGGTGTTGATGG + Intronic
1142584379 17:961971-961993 CTGGCTAATTTTTGTGTTCTTGG - Intronic
1143819770 17:9550911-9550933 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1144121639 17:12160037-12160059 CTGGCCATTTTTTTTTTTTTAGG + Intergenic
1144397161 17:14855659-14855681 TTGGCCACTTTTGTTGTTGTTGG + Intergenic
1144444844 17:15317326-15317348 CTGCCCATCTTTTGTGTTCTTGG - Intronic
1144664756 17:17094770-17094792 CTGGCTAATTTTGGTATTTTTGG + Intronic
1146173584 17:30650726-30650748 CTGGCTATTTTTTGTATTTTTGG + Intergenic
1146192091 17:30778251-30778273 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1146314432 17:31796029-31796051 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1146337260 17:31984991-31985013 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1146347038 17:32066747-32066769 CTGGCTATTTTTTGTATTTTTGG + Intergenic
1146648092 17:34588913-34588935 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1146959536 17:36961834-36961856 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1147155763 17:38543862-38543884 CTTGCCATGTTTGCTTTTGTCGG + Exonic
1147958193 17:44149408-44149430 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1150427012 17:65085156-65085178 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1150948110 17:69769590-69769612 TTGTCCTTTTTTGCTGTTGTTGG + Intergenic
1151295810 17:73185400-73185422 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1152216783 17:79037831-79037853 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1153055508 18:942171-942193 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1153437440 18:5082834-5082856 CTTGCCATTTTGGTTTTTGTGGG - Intergenic
1153532724 18:6065475-6065497 CTGGACTTTTTTGTTGTTGACGG + Intronic
1155104058 18:22643001-22643023 CTGAACATTTTTGGTGTTCTGGG + Intergenic
1155631000 18:27892418-27892440 CTGGCCCTTTTTGTTGTTGTTGG + Intergenic
1155954784 18:31947740-31947762 CTGGCCAATTTTTGTATTTTTGG - Intronic
1156261593 18:35449399-35449421 CTGGCTAATTTTGGTATTTTTGG - Intronic
1156921586 18:42529098-42529120 GTGGACATTTTTTGTGGTGTGGG + Intergenic
1157828254 18:50832155-50832177 CTGGGCATTTGTGATGTTGATGG + Intergenic
1157996090 18:52557819-52557841 CTGGCTAATTTTGGTATTTTTGG + Intronic
1158827136 18:61235303-61235325 CTGGCAATCTTTGGTGTTCTTGG + Intergenic
1159599019 18:70411083-70411105 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1159747123 18:72251196-72251218 TTGGCTATTTTTGCTCTTGTTGG + Intergenic
1159933919 18:74345044-74345066 TTGCCCATTTTTGGTATTGTTGG + Intronic
1160083319 18:75751772-75751794 CTGGCTAGTTTTTGTGTTTTTGG - Intergenic
1160706659 19:533016-533038 CTGGATGTTTTTGTTGTTGTTGG + Intronic
1161792783 19:6370640-6370662 CAGGCCTTTTCTGGTGCTGTGGG + Intergenic
1162732903 19:12729573-12729595 CTGGCTAATTTTTGTATTGTTGG - Intergenic
1162741438 19:12775767-12775789 CTGGCCCTTTTTGGGGTGGGAGG + Intronic
1162988841 19:14289338-14289360 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1163348270 19:16758715-16758737 CGGGCCATTTATGGTTCTGTAGG + Intronic
1163740894 19:19011307-19011329 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1163788799 19:19293420-19293442 CTGGCCAATTTTTGTGTTTTTGG - Intronic
1165082194 19:33314385-33314407 CTGGCCAATTTTTGTATTATTGG - Intergenic
1166840922 19:45696427-45696449 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1166842208 19:45704549-45704571 ATGGCCTTTTTTGTTGTTGTTGG - Intergenic
1167842169 19:52131104-52131126 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1167953751 19:53047938-53047960 CTGACCATTTGTGTTGGTGTTGG - Intronic
1167987406 19:53330352-53330374 CTGGCCATTTGTGTTGGTGTTGG + Intergenic
1168025104 19:53638160-53638182 CTGGCTAATTTTGATGTTTTTGG - Intergenic
1168537177 19:57180793-57180815 CTGGCCAATTTTTTTGTTGGGGG - Intergenic
924997480 2:375734-375756 CAGGGCATGTTTGGTGTTGTTGG + Intergenic
925160888 2:1682776-1682798 CTGGCTAATTTTGGTATTTTTGG - Intronic
925316998 2:2934177-2934199 CTGTGCCTTTTGGGTGTTGTGGG - Intergenic
925481628 2:4281817-4281839 CTGGCCAATGTTGGTATTGCTGG - Intergenic
925786431 2:7435576-7435598 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
925859058 2:8157378-8157400 CTGGTCATCTTTGGTGGTCTTGG + Intergenic
928554701 2:32411637-32411659 CTGGCTACTTTTTGTGTTTTTGG + Intronic
928732059 2:34242816-34242838 TTGGCAATTATTGCTGTTGTGGG + Intergenic
929084625 2:38156256-38156278 CTGGCAGTCTTTGGTGTTTTGGG - Intergenic
929231108 2:39561011-39561033 CTGGGCTTTTTTGTTGTTGTTGG + Intergenic
929456619 2:42070735-42070757 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
929806404 2:45150132-45150154 CTGGGCCTTTTTGGTCTGGTGGG - Intergenic
930963473 2:57289728-57289750 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
931163704 2:59722154-59722176 CTTGCAATTTTAGGTTTTGTGGG - Intergenic
931357115 2:61546928-61546950 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
932373981 2:71218384-71218406 TTGGCCATTTTTATTCTTGTGGG - Intronic
933237474 2:79881571-79881593 CTTGTCATTTTTGATCTTGTAGG + Intronic
934943662 2:98520575-98520597 ATGGCAGTTTTTGTTGTTGTTGG + Intronic
936346721 2:111681113-111681135 CTAGCAATTCTTGGTGTTCTTGG - Intergenic
936668238 2:114623621-114623643 TAGGTCATTTTTGCTGTTGTAGG - Intronic
936784739 2:116081039-116081061 CTGGCAATCCTTGGTGTTGCTGG + Intergenic
937114248 2:119392914-119392936 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
937213851 2:120297780-120297802 CTCGCCATTTTTCCTGATGTTGG + Intergenic
937798650 2:126055597-126055619 CTGAACTTTTTTGTTGTTGTTGG + Intergenic
937971731 2:127554706-127554728 CTGGACTTTTTTGTTGTTGCTGG + Intronic
937981967 2:127621002-127621024 CTGGCCTTTTGTGGTGTTACAGG + Intronic
938808045 2:134824976-134824998 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
939138795 2:138328443-138328465 CTGGCCAATTTTTGTATTTTTGG - Intergenic
940030198 2:149253912-149253934 CTGGACTTTTTTGGTTTGGTAGG + Intergenic
940757736 2:157702918-157702940 CTGGGCTCTTTTGTTGTTGTTGG - Intergenic
940946831 2:159627180-159627202 CTGGACTTTTTTTGTGTGGTAGG - Intergenic
941044297 2:160655061-160655083 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
941108563 2:161391751-161391773 CTGGCTATTTTTTGGGTGGTGGG + Intronic
941479030 2:165983278-165983300 CTGGCCAATTTTTGTGTTTTTGG - Intergenic
942683259 2:178502195-178502217 CTGGTCATTTTTGGATTTTTAGG + Intronic
942770643 2:179514246-179514268 CTGGCCATTGCTGGCTTTGTAGG - Intronic
943423814 2:187703993-187704015 TTGGGCTTTTTTGTTGTTGTCGG - Intergenic
943519030 2:188924447-188924469 CTGGCTATTTTTTGTATTTTTGG - Intergenic
943679931 2:190757664-190757686 CTGGTAATTATTGGTGTTTTGGG + Intergenic
943913080 2:193592980-193593002 CTGGCTATTTTTTGTATTTTTGG - Intergenic
943977792 2:194505974-194505996 CTGGACTTTTTTGTTGCTGTTGG + Intergenic
944014195 2:195013382-195013404 TTGGACATTTTTGTTGTTGGTGG + Intergenic
945882165 2:215336832-215336854 CTGCCCCTTTTAGATGTTGTAGG + Intronic
946260250 2:218483995-218484017 CTGGCTAATTTTTGTGTTTTTGG - Intronic
946293657 2:218765566-218765588 CTGGCAATTTTTTGTATTTTTGG + Intergenic
946784187 2:223225151-223225173 TTGGCCATTTTTTATGTTGATGG + Intergenic
946834065 2:223754746-223754768 CTGGCTAATTTTTGTGTTTTTGG - Intronic
946910081 2:224451556-224451578 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
946998378 2:225422521-225422543 CTGTCCTTTTTTGCTGTTGCTGG - Intronic
947620151 2:231584836-231584858 CCGGCTAATTTTGTTGTTGTTGG + Intergenic
948404479 2:237706787-237706809 CTGGCTAGTTTTTGTATTGTTGG + Intronic
948442874 2:238007552-238007574 TTGGCCATTTTTGGTTTGGGAGG - Intronic
948843273 2:240670098-240670120 CTGGCCATCCTTGGTGTTCCTGG - Intergenic
1169181644 20:3574348-3574370 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1170635166 20:18098163-18098185 CTGGCCATTTATGGTCATGCGGG - Intergenic
1171254374 20:23677242-23677264 CTAGGCTTTTTTGTTGTTGTTGG + Intergenic
1171509116 20:25665777-25665799 TTGTCAATTTTTGGTTTTGTTGG + Intergenic
1171984822 20:31652511-31652533 CTGGCTATTTTTTGTATTTTTGG + Intergenic
1172254810 20:33508254-33508276 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1172413310 20:34742609-34742631 CTGGCTCTGTTTGGTGTTTTGGG + Exonic
1172492386 20:35350533-35350555 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1173274055 20:41563732-41563754 CTGTACTTTTTTGTTGTTGTTGG + Intronic
1173630095 20:44506422-44506444 CTGGCCAGTTTTTGTATTTTTGG - Intronic
1174809652 20:53634856-53634878 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1175753643 20:61515784-61515806 CTGGCTTTTTTTGTTCTTGTCGG + Intronic
1177621880 21:23606226-23606248 CTGGGCTTTTTTCTTGTTGTTGG - Intergenic
1178072848 21:28988303-28988325 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1178323136 21:31621157-31621179 CTGGTCAATTTTTGTGTTTTTGG + Intergenic
1179142975 21:38743684-38743706 CTGGCTAATTTTTGTGTTTTCGG + Intergenic
1181446179 22:22976648-22976670 ATGGCCATTTTTGCTGCTGATGG - Intergenic
1182116443 22:27759246-27759268 CAGGTCATTCTTGGGGTTGTGGG - Intronic
1182955377 22:34419408-34419430 CTGGCTAATTTTGGTATTTTTGG + Intergenic
1183217819 22:36492504-36492526 CCTGGCATTTTTGTTGTTGTTGG + Intronic
1183411576 22:37658003-37658025 CTGGGCATTTTTTGGTTTGTTGG - Intronic
1183947966 22:41337633-41337655 CAGGCCATCTGTGGTGCTGTGGG + Intronic
1184574121 22:45348388-45348410 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1184807302 22:46803362-46803384 GTGGGCATTCTTGGTGCTGTTGG + Intronic
1184998620 22:48228121-48228143 CTGGCCCTTTGTGGTGTGGGGGG - Intergenic
949814535 3:8044061-8044083 CTGGACTTTTTTGTTGTTGTTGG - Intergenic
950763294 3:15254067-15254089 CTGGCCAATTTTTGTATTTTTGG + Intergenic
951388045 3:22066642-22066664 CAGGGCAGCTTTGGTGTTGTAGG + Intronic
951948210 3:28166689-28166711 CTGGCTATTTTTTTTGTTTTTGG + Intergenic
952171954 3:30816705-30816727 CTGGCTACTTTTTGTGTTTTTGG + Intronic
952355562 3:32580049-32580071 CTGGCTAATTTTTGTATTGTTGG - Intergenic
953057983 3:39403521-39403543 CTGGCCAGTTTTTGTATTTTTGG - Intergenic
953895236 3:46793434-46793456 CTGGCCTTTTTTTTTGTTGGTGG - Intronic
953947166 3:47159811-47159833 CTGGCTAATTTTTGTGTTTTTGG - Intronic
954209509 3:49087093-49087115 CTGGCTAATTTTTGTGTTTTTGG - Intronic
954312139 3:49777971-49777993 CTGGCCATTTCTGGTGTGCAGGG + Intronic
954847116 3:53569110-53569132 CTGGCCATTTGTTGTCTTGTTGG + Intronic
954874421 3:53792343-53792365 CTGGCCACTTTGGGTGTCTTGGG - Intronic
955083416 3:55678779-55678801 CAGGCCATTATTGGTGGTGGTGG - Intronic
955459043 3:59159945-59159967 CTTGCCATATTTTGTCTTGTAGG + Intergenic
955582433 3:60438819-60438841 CTAGGCAATTTTGGTGTTCTGGG - Intronic
955682904 3:61520494-61520516 CTGGCCATTTCTGCTGGTTTTGG - Intergenic
955970127 3:64430696-64430718 CTGGCAATCCTTGGTGTTCTTGG - Intronic
956224908 3:66946529-66946551 CTCGCCATTTTTACTGTTCTAGG + Intergenic
956288984 3:67641889-67641911 CAGGCAATCTTTGGTGTTCTTGG + Intronic
956673012 3:71708934-71708956 TGGGCCATTTCTGGTGTCGTTGG - Intronic
957484494 3:80840658-80840680 CTGGGCAATTTGCGTGTTGTGGG - Intergenic
958530625 3:95325651-95325673 CTGGTCTTTTTTGTTGTTTTGGG + Intergenic
959257541 3:104033675-104033697 TTGTCCATTTTTACTGTTGTTGG - Intergenic
959356145 3:105331221-105331243 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
960896241 3:122508707-122508729 GTGGCCATTTTTTTTGTGGTGGG - Intronic
961265915 3:125642629-125642651 CTGGGTATTTTTTGTGTTTTTGG + Intergenic
961611392 3:128142709-128142731 CTGGCCATTTTTGGCTTTGAAGG - Intronic
961765605 3:129208364-129208386 CTGGCCAATTTTTGTATTTTTGG + Intergenic
962512675 3:136117738-136117760 CTGGACATTTTTTGGTTTGTAGG - Intronic
962559116 3:136587791-136587813 CTGGCTAATTTTTGTGTTTTTGG - Intronic
963114760 3:141717985-141718007 CTGGCCAATTTTTGTATTCTTGG + Intergenic
964581545 3:158244754-158244776 CTGGGCTTTTTTGGAGTGGTAGG + Intronic
964713682 3:159698805-159698827 CTGGCTAATTTTTGTGTTTTTGG + Intronic
964910247 3:161772248-161772270 CTGGCCATTGATGCTGCTGTTGG - Intergenic
965538483 3:169849504-169849526 CTGGCCAATTTTTGTATTTTTGG - Intronic
965573556 3:170195257-170195279 CTGGGCTTTTTTGTTGTTGCTGG - Intergenic
966429466 3:179816004-179816026 CTGGCCTTTTTCTGTGTTGCAGG - Exonic
966770177 3:183497248-183497270 CTGGCCAATTTTTGTATTTTTGG - Intronic
966925996 3:184644985-184645007 CTGGCTATTTTTTGTATTCTTGG - Intronic
966998031 3:185303446-185303468 CTGGCTGTTTTTGTTGTTGTTGG + Intronic
967166762 3:186786927-186786949 CTGGCCAATTTTGGTATTTTGGG + Intronic
967345040 3:188445876-188445898 CTGGCCATTTTTTGTGATACAGG + Intronic
968129173 3:196182559-196182581 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
968211992 3:196856415-196856437 TTGTCCATTTTTATTGTTGTTGG - Intergenic
968251107 3:197214923-197214945 TTGGGCATTTGTGGTTTTGTGGG - Intronic
968676367 4:1882993-1883015 TTGGCCATTCTTGGGATTGTGGG + Intronic
968902291 4:3437386-3437408 CTGGACATGTGTGGTGTTGCAGG + Intronic
969124536 4:4936675-4936697 CTGGCCACTGTGGATGTTGTGGG - Intergenic
970541656 4:17086351-17086373 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
971084362 4:23254106-23254128 TTGTGCATTTTTGTTGTTGTTGG + Intergenic
971336109 4:25725475-25725497 CTGGCTATTTTTTGTATTTTTGG + Intergenic
971417548 4:26446823-26446845 CTGGGCTTTTTTATTGTTGTTGG - Intergenic
972064319 4:34921249-34921271 CTGTCCTTTTTTGTTGTTGTTGG - Intergenic
972383260 4:38539078-38539100 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
972574282 4:40337792-40337814 CTGGCAGTCTTTGGTGTTCTTGG + Intronic
974058988 4:57013135-57013157 CTGGCCAATTTTTGTATTTTTGG + Intronic
974347370 4:60699330-60699352 CTGGACTTTTTTTGGGTTGTAGG - Intergenic
975232463 4:71951070-71951092 CTGGACATTTTTGGGTTGGTAGG - Intergenic
976225102 4:82789709-82789731 CTGCCCATTTTTGCAGGTGTTGG - Intronic
978582233 4:110243668-110243690 CTGGCCAATTTTTGTATTTTTGG - Intergenic
979191623 4:117867156-117867178 ATGACCATTTTTGTTGTTGGTGG + Intergenic
979566073 4:122155483-122155505 CTGGCCAATTTTTGTATTTTTGG + Intronic
980010352 4:127588313-127588335 CTGGCTAATTTTTGTGTTTTCGG - Intergenic
980437274 4:132793797-132793819 CTGGGCTTTTTTGTTGTTGTTGG - Intergenic
980623528 4:135342483-135342505 CTGGCCATTATCTGTGTTGGAGG - Intergenic
980632958 4:135461185-135461207 CTGGCCATTTTGTGTGTTCTTGG + Intergenic
981589385 4:146341372-146341394 ATGGCCATTTTTGGTTTTGGGGG - Intronic
983193883 4:164783360-164783382 CTGGCAAATTTTTGTGTTTTTGG - Intergenic
983404689 4:167313110-167313132 TTGTCCATTTTTGGTGTTGGGGG - Intergenic
983683306 4:170377759-170377781 CTGGGTTTTTTTGTTGTTGTTGG - Intergenic
983787356 4:171749979-171750001 CTGGCTATTTTTTGTATTTTTGG + Intergenic
983873042 4:172843895-172843917 CTGGCTAATTTTTGTGTTTTTGG - Intronic
984582403 4:181525247-181525269 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
986522041 5:8630197-8630219 CTGGACATTTTTTGTTTTTTAGG - Intergenic
986755555 5:10832672-10832694 CTGGCCTTCTTTGGTGTGGGTGG + Intergenic
987575885 5:19727428-19727450 CTGACCATCTTTGGTGTTTTTGG - Intronic
988574334 5:32405475-32405497 CTGGCTATTTTTGCTGTGCTGGG - Intronic
988861974 5:35290935-35290957 CTGGCCATATTTGCTGCCGTTGG - Intergenic
989197244 5:38727454-38727476 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
990063409 5:51681177-51681199 CTGTCCATTTTTGCTCCTGTAGG - Intergenic
990889446 5:60632558-60632580 CTGTCCAGCTTTGGTCTTGTGGG - Intronic
990926847 5:61035614-61035636 CTTGTCCTTTTTGGTGTAGTGGG - Intronic
991068998 5:62456171-62456193 CTGGCTAATTTTTGTGTTTTTGG + Intronic
992800313 5:80289686-80289708 TAGGGGATTTTTGGTGTTGTTGG - Intergenic
993291689 5:86080247-86080269 CTGGCCTTTTTTTGGTTTGTAGG + Intergenic
994007441 5:94855472-94855494 CTGGCAATTGTTGCTGTGGTAGG + Intronic
994349602 5:98729321-98729343 CTGGCCAATTTTTGTATTTTTGG - Intergenic
995693519 5:114854386-114854408 CTGGACTTTTTTTTTGTTGTTGG - Intergenic
995990567 5:118233845-118233867 CTGGCCAAGTTTTGTGGTGTAGG - Intergenic
996503896 5:124247125-124247147 CTAGGCTTTTTTGTTGTTGTTGG - Intergenic
996608521 5:125351955-125351977 CTGGCTAATTTTTGTGTTCTTGG + Intergenic
996777156 5:127145022-127145044 CTGGCAATCTTTGGTGTTCTTGG - Intergenic
997249045 5:132374757-132374779 CTGGCCATTTTTTTTTTTTTTGG - Intronic
997948350 5:138222007-138222029 CTGGCCAATCTTTGTGTTTTTGG - Intergenic
998066502 5:139163529-139163551 CTGGCTATTTTTTGTGTTTTTGG + Intronic
998683047 5:144492181-144492203 CTAGGCTTTTTTGTTGTTGTTGG - Intergenic
998925857 5:147125508-147125530 CTGAGCTTTTTTGTTGTTGTTGG + Intergenic
999167129 5:149559157-149559179 CTGGCTAATTTTTGTGTTCTTGG - Intronic
1000028917 5:157384776-157384798 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1000809372 5:165841856-165841878 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1001845806 5:174920022-174920044 TTGGCCATTTTTCTTCTTGTGGG - Intergenic
1003298726 6:4857233-4857255 CTGGCGATGTTTGGTGGTGATGG - Intronic
1003372509 6:5542336-5542358 ATGGACATTTTGGGTGTTTTGGG + Intronic
1003514441 6:6806312-6806334 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1004746803 6:18517478-18517500 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1005483747 6:26279548-26279570 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1005653591 6:27908687-27908709 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1005654907 6:27925781-27925803 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1005974141 6:30784447-30784469 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1006306482 6:33223769-33223791 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1006468505 6:34211363-34211385 CTGGCCAATTTTTGTATTGTTGG - Intergenic
1006755558 6:36412188-36412210 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1006805472 6:36785849-36785871 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1007209248 6:40178582-40178604 CAGGCCATTATTGGTGTTAATGG + Intergenic
1007650748 6:43419299-43419321 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1007816490 6:44528869-44528891 CTGACCATGCTGGGTGTTGTGGG - Intergenic
1008142424 6:47847168-47847190 CTGGTCATATTTGCTGTTGTGGG + Intergenic
1008155866 6:48013203-48013225 CTGGGCTTTTTTGTTGTTGTTGG + Intronic
1008998982 6:57690797-57690819 TTAGCAATTTTTGGTTTTGTTGG - Intergenic
1009615066 6:65993096-65993118 CTGGCAAATCTTGGTGTTCTTGG + Intergenic
1009952088 6:70410031-70410053 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1010250681 6:73704021-73704043 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1010447916 6:75969308-75969330 CTTGCCATTTTTTGTGGTGAGGG - Intronic
1010817767 6:80378957-80378979 CTGGTCTTTTTTGTTGTTGTTGG - Intergenic
1010935226 6:81852244-81852266 CTGGCCAATTTTTGTATTTTTGG - Intergenic
1012016059 6:93853325-93853347 CTGGGCTTTGTTGTTGTTGTTGG + Intergenic
1012250870 6:96979156-96979178 TTGTCAATTTTTGGTTTTGTTGG + Intronic
1013122804 6:107156049-107156071 CTGGCTAATTTTGGTATTTTTGG + Intronic
1014242953 6:119038467-119038489 CTGGCCATTTTGGTTTTGGTGGG - Intronic
1014543133 6:122700286-122700308 CTGGACATATTTGGTGGTGGTGG + Intronic
1014731783 6:125040453-125040475 CTGGGCATTTTTTGGGTGGTAGG - Intronic
1015234510 6:130955153-130955175 CTGGACAGTTTTGGTCTTCTTGG + Exonic
1015321642 6:131881855-131881877 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1016047386 6:139494889-139494911 TTGGTCATTTTTTGTGGTGTAGG + Intergenic
1016823226 6:148365371-148365393 ATGGCCATTTTTTGTTTTATTGG + Intronic
1017867257 6:158454765-158454787 CTGGCTAATTTTGGTATTTTTGG + Intronic
1017987205 6:159454764-159454786 GTTGACATTTTTGGTATTGTTGG + Intergenic
1018708593 6:166480809-166480831 CTGGCCAATTTTTGTATTTTTGG + Intronic
1019680383 7:2344757-2344779 CTGGCTAATTTTCGTGTTGTTGG - Intronic
1019770148 7:2878512-2878534 CTGGCCTTTTTTTGTGGTGGGGG + Intergenic
1019927041 7:4200095-4200117 CTGGCCTTTTTTTGTGGGGTGGG - Intronic
1020226335 7:6283208-6283230 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1020868157 7:13591577-13591599 CTCGCCATTTTTGTTCTTCTTGG + Intergenic
1021071344 7:16245401-16245423 CTGGCCATTTTTGGTGAAGGTGG + Intronic
1021666193 7:22983165-22983187 CTGGCCAATTTTTGTGTTTTTGG - Intronic
1021729077 7:23578948-23578970 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1022062601 7:26813403-26813425 ATAACCATTTTTGTTGTTGTTGG - Intronic
1022097820 7:27151845-27151867 ATGGCCCTATTTGGTTTTGTTGG - Intronic
1022179460 7:27904455-27904477 ATGGCCTTTTTTGGTGATCTGGG + Intronic
1022294225 7:29034699-29034721 CTGGCTATTTTTCGTATTTTTGG + Intronic
1024152580 7:46587935-46587957 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1024443099 7:49444280-49444302 CAGATCATTTTTGCTGTTGTTGG - Intergenic
1024662897 7:51515650-51515672 CTGGTCCTTTTTTTTGTTGTAGG + Intergenic
1026053535 7:66966261-66966283 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1026940262 7:74283640-74283662 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1026986810 7:74559939-74559961 CTGGCTATTTTTTGTATTTTTGG + Intronic
1027167975 7:75849204-75849226 CTGGCCAATTTTTGTATTTTTGG - Intronic
1027266884 7:76499406-76499428 CTGGCCCTTTTTGGTGTAAAGGG + Intronic
1027318700 7:76999266-76999288 CTGGCCCTTTTTGGTGTAAAGGG + Intergenic
1027693391 7:81376281-81376303 CTGGACATTTTTGTTGTTGTTGG + Intergenic
1027999954 7:85481226-85481248 CTTTCCTTTTTTGTTGTTGTTGG - Intergenic
1028338450 7:89687690-89687712 CTGCTCATATTTGGGGTTGTGGG - Intergenic
1028949420 7:96618152-96618174 TTGGGCTTTTTTGTTGTTGTTGG + Intronic
1029184720 7:98730365-98730387 CTTGCCATGTTTGGTGTTAGGGG - Intergenic
1029457287 7:100677681-100677703 CGGGCCCTTTTTGGGGTTGGGGG + Intronic
1029570526 7:101365586-101365608 CTGGCTAATTTTTGTATTGTTGG + Intronic
1030027873 7:105342466-105342488 ATGGCTATATTTGATGTTGTAGG - Intronic
1030354182 7:108524801-108524823 CTGCCATTTTTTGTTGTTGTTGG - Intronic
1030608245 7:111661231-111661253 CTGGCAATTTTTTTTGTTTTTGG - Intergenic
1030718720 7:112843654-112843676 CTGGGCATTTTTTGTTTGGTAGG - Intronic
1030914764 7:115298506-115298528 CTGGCTATTTTCGGATTTGTGGG + Intergenic
1031148082 7:118019650-118019672 CAGGACGTTTTTGTTGTTGTTGG - Intergenic
1032003037 7:128277995-128278017 CTGGCCATTTTTGGTAGAGACGG - Intergenic
1032527043 7:132586356-132586378 TTGGGCATTTTGGGTGTTGACGG + Intronic
1033170006 7:139075599-139075621 CTGGCTAGTTTTTGTATTGTTGG + Intronic
1033736235 7:144224792-144224814 CTGGCTAATTTTGTTGTTGTTGG - Intergenic
1033746819 7:144326163-144326185 CTGGCTAATTTTGTTGTTGTTGG + Intergenic
1033837427 7:145332230-145332252 CTGGCAGTTTTTGGTGTTCCTGG + Intergenic
1033851820 7:145505520-145505542 TTGACCATTTTTGTTGTTGCAGG - Intergenic
1034599311 7:152233971-152233993 CTGGCTAATTTTTGTGTTTTGGG - Intronic
1035825724 8:2642479-2642501 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1037940806 8:22949362-22949384 CTGGGCATTTTAGGTGGCGTGGG - Intronic
1038401641 8:27288507-27288529 CTGGCCATTCTTGGCCTTATTGG - Intronic
1038471415 8:27826238-27826260 ATGGCCCTTTTTGGTTTTCTGGG - Intronic
1039208111 8:35179803-35179825 CTGGGCTTTTTTGTTGTTGTTGG - Intergenic
1039586811 8:38713816-38713838 CTGGAAATTTTTGTTGCTGTGGG - Intergenic
1039634261 8:39145890-39145912 CTGGCTAATTTTGGTATTTTTGG + Intronic
1039661280 8:39470193-39470215 CTAGCCTTTTTTGTTGTTGTTGG + Intergenic
1039672285 8:39614837-39614859 TTGTCCATTTTTATTGTTGTTGG - Intronic
1039798374 8:40934217-40934239 CCTGCCAATTTTTGTGTTGTCGG - Intergenic
1039879764 8:41617706-41617728 AAGGGCATTTTTGATGTTGTTGG + Intronic
1040633489 8:49243858-49243880 CTGGGCTTTTTTGTTGTTGTTGG - Intergenic
1041128314 8:54667850-54667872 CTGGCCTTTTTTTGTTTGGTAGG - Intergenic
1041341125 8:56847026-56847048 CTTGCCATTTTTGTTATTCTCGG - Intergenic
1041615627 8:59903035-59903057 TTGGGCATTTTTGGTTTGGTAGG - Intergenic
1042416998 8:68531971-68531993 CTGGCTTCTCTTGGTGTTGTTGG - Intronic
1044412425 8:91898912-91898934 CTGGCCAATTTTTGTATTTTTGG - Intergenic
1046145646 8:110154611-110154633 CTGGGCTTTTTTGTTGTTGTTGG + Intergenic
1046233126 8:111384085-111384107 CCTGGGATTTTTGGTGTTGTTGG + Intergenic
1046760823 8:118018389-118018411 CTGGCAATCTTTGGTGTTTCTGG - Intronic
1047003127 8:120592975-120592997 ATGGCTTTTTTTGTTGTTGTTGG + Intronic
1047234491 8:123027898-123027920 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1047300244 8:123607989-123608011 CTGGCCAATTTTTGTATTCTTGG + Intergenic
1047383914 8:124390980-124391002 CTGGGCTTTTTTGTTGTTTTTGG + Intergenic
1047434639 8:124825953-124825975 CTGGCAATCTTTGGTGGTGTTGG + Intergenic
1047725713 8:127682464-127682486 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1048312620 8:133337301-133337323 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1048344793 8:133568582-133568604 CTGGTCGCTTTTGGTGGTGTGGG + Intronic
1048450239 8:134527127-134527149 CTGGCCATTTCTGGCTTTGAAGG + Intronic
1048837045 8:138529759-138529781 CTGGCCCTCTTGAGTGTTGTGGG - Intergenic
1049059877 8:140268344-140268366 CTGGCAGCTTTTGGTGCTGTAGG + Intronic
1049486015 8:142862301-142862323 CTGGGCTTTTTTGTTGTTGTTGG + Intronic
1051212267 9:14757391-14757413 CTGGCCAATTTTTTTGTTTTTGG - Intronic
1051298873 9:15626945-15626967 CTGGACATTTTTTGGTTTGTAGG + Intronic
1051610776 9:18959607-18959629 CTGGCCAATTTTTGTATTTTTGG - Intronic
1052274341 9:26660736-26660758 CTGGCGATTTACAGTGTTGTGGG - Intergenic
1052402509 9:28018333-28018355 TTGTCAATTTTTGTTGTTGTTGG - Intronic
1053140456 9:35679558-35679580 CCGGCTATTTTTGGTTTTGTTGG - Intronic
1053478217 9:38397058-38397080 CAGGCCATACCTGGTGTTGTTGG - Exonic
1055041337 9:71876653-71876675 CTTCCCATTTTTGGTGTAATAGG - Intronic
1055113206 9:72579858-72579880 CTGGCTAATTTTCGTATTGTTGG - Intronic
1055314068 9:75015622-75015644 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1055605884 9:77970055-77970077 CTGGCTAATTTTTGTGTTTTTGG - Intronic
1056556077 9:87688949-87688971 CTGTCAATTTTTGTTTTTGTTGG + Intronic
1056958881 9:91104518-91104540 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1057090364 9:92252603-92252625 CTGGCCAATTTTTGTATTTTTGG - Intronic
1057882021 9:98799632-98799654 CAGGCCCTTTTTGGTGTTCCTGG + Intergenic
1058324356 9:103677163-103677185 CTGGCTATTTCTGTTGTGGTGGG - Intergenic
1058399743 9:104601374-104601396 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1058400198 9:104607548-104607570 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1059235631 9:112758489-112758511 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1059235642 9:112758555-112758577 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1059712752 9:116884700-116884722 CTAGCCATCTTTGGCGTTTTTGG + Intronic
1059882125 9:118702829-118702851 AAGGCTATTTTTGTTGTTGTTGG + Intergenic
1060467470 9:123919718-123919740 CTGGCTAATTTTTGTATTGTTGG - Intronic
1060505886 9:124198257-124198279 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1060688812 9:125637932-125637954 CTGGCTAATTTTTGTGTTTTTGG + Intronic
1060854045 9:126900654-126900676 CTGGCCATTTTTTTTGGTGGCGG - Intergenic
1061200025 9:129132642-129132664 CTGGCTAATTTTAGTGTTTTTGG + Intronic
1061569995 9:131471587-131471609 CTAGTCAGTTTTGGTGTTGTAGG + Intronic
1203584019 Un_KI270746v1:46501-46523 CTGGCTAATTTTTGTGTTTTGGG - Intergenic
1187589126 X:20696667-20696689 CTTGACTTTTTTGTTGTTGTTGG - Intergenic
1187733764 X:22283176-22283198 CTGGACTTCTTTAGTGTTGTTGG - Intergenic
1187826846 X:23340080-23340102 CTGGGTAATTTTGTTGTTGTGGG - Intronic
1188316508 X:28681039-28681061 CTGGGCTTTTCTGTTGTTGTTGG + Intronic
1189379234 X:40489951-40489973 CTGGACATTTTTGGGGGTGTGGG + Intergenic
1189617717 X:42800914-42800936 CTGGCTAGTTTTTGTGTTTTTGG + Intergenic
1189996544 X:46644472-46644494 CTGGCCAATTTTTGTATTTTTGG - Intronic
1191086827 X:56577238-56577260 CTTGCCAATTTTTGTTTTGTTGG + Intergenic
1191757863 X:64613768-64613790 CTGGCTAATTTTTGTGTTTTAGG + Intergenic
1192449966 X:71238379-71238401 CTGGCTAATTTTTGTGTTTTTGG + Intergenic
1192662426 X:73055861-73055883 CTGGCCTTTTTTGTGTTTGTTGG - Intergenic
1192670394 X:73134289-73134311 GTGGCAATTTTTCCTGTTGTTGG - Intergenic
1192875994 X:75230231-75230253 CTGGCCACTTTGAGTGTTGGGGG - Intergenic
1193068491 X:77282508-77282530 CTGGACTTTTTTGGTCTGGTAGG - Intergenic
1193470297 X:81892949-81892971 CTGGTCATTTTTGCTATGGTTGG - Intergenic
1193955255 X:87851994-87852016 CAAGCCTTTTTTGTTGTTGTTGG - Intergenic
1194902062 X:99524430-99524452 CTGGGCTTTTTTGTTGTTGGTGG - Intergenic
1196770389 X:119287764-119287786 CTGGCTAATTTTTGTATTGTTGG - Intergenic
1197647066 X:129029139-129029161 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1197920382 X:131586655-131586677 TTGCCAATATTTGGTGTTGTTGG - Intergenic
1199320451 X:146431889-146431911 CTGGCTATTTTTTGTATTTTTGG - Intergenic
1200066513 X:153506678-153506700 CTGGCCATCTGTGCTGTTGGGGG - Intronic
1201251598 Y:12063858-12063880 CTGGCTAATTTTTGTGTTTTTGG - Intergenic
1201320546 Y:12693808-12693830 CAGGCCATTTTTGGCTTTATGGG + Intergenic
1201854353 Y:18524808-18524830 CTGGCAATTTTTTGTTTGGTAGG - Intergenic
1201878968 Y:18795577-18795599 CTGGCAATTTTTTGTTTGGTAGG + Intronic
1201934451 Y:19392643-19392665 CTGGCCTTTGTTTTTGTTGTTGG + Intergenic