ID: 1103841560

View in Genome Browser
Species Human (GRCh38)
Location 12:123869475-123869497
Sequence ACACTCACTCCTGGCTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 170}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103841555_1103841560 -7 Left 1103841555 12:123869459-123869481 CCAGTCCCCAGCTGGCACACTCA 0: 1
1: 0
2: 2
3: 32
4: 266
Right 1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 170
1103841550_1103841560 28 Left 1103841550 12:123869424-123869446 CCATGCAGCCACAAAGACAGATG 0: 1
1: 0
2: 2
3: 44
4: 704
Right 1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 170
1103841552_1103841560 2 Left 1103841552 12:123869450-123869472 CCATAAATCCCAGTCCCCAGCTG 0: 1
1: 0
2: 0
3: 27
4: 219
Right 1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 170
1103841551_1103841560 20 Left 1103841551 12:123869432-123869454 CCACAAAGACAGATGTCTCCATA 0: 1
1: 0
2: 2
3: 29
4: 261
Right 1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 170
1103841554_1103841560 -6 Left 1103841554 12:123869458-123869480 CCCAGTCCCCAGCTGGCACACTC 0: 1
1: 0
2: 1
3: 22
4: 290
Right 1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG 0: 1
1: 0
2: 0
3: 20
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103841560 Original CRISPR ACACTCACTCCTGGCTCCAA AGG Intronic
900336544 1:2166772-2166794 ACACACAGTCCTGACCCCAAGGG - Intronic
901777566 1:11570810-11570832 TCCCTCTCTCTTGGCTCCAAAGG - Intergenic
904235409 1:29113386-29113408 ACTCTCAACCCTGCCTCCAAGGG - Intronic
904971255 1:34421026-34421048 ACACCCAGTCCTGACTCGAAAGG - Intergenic
905305540 1:37015425-37015447 CCACTGCCACCTGGCTCCAAAGG + Intronic
907505803 1:54917311-54917333 ACTCTCAATCCTGACTCAAAAGG - Intergenic
909817468 1:80014403-80014425 CCACTTACCCCTAGCTCCAATGG + Intergenic
912644913 1:111383376-111383398 ATATTCACTCCTGGCTTCCAGGG - Intergenic
912974440 1:114315198-114315220 ACAGACACACCTGGCTGCAAGGG - Intergenic
915141087 1:153769071-153769093 ACCCTCCCTCCTGGCTACAGTGG + Intronic
915180819 1:154057893-154057915 ACCCTCACGCCAGGCTCAAATGG + Intronic
916743914 1:167669812-167669834 ATGCTCACTCCTGACTGCAAGGG + Intronic
917284811 1:173412955-173412977 ATACTCACTCCTGCATCCAAGGG + Intergenic
921216004 1:212937269-212937291 ACTCTCACTCCAGGGCCCAAAGG + Intergenic
922894236 1:229088213-229088235 ACACTGACTCCTGACCCCAGGGG - Intergenic
1062958025 10:1552806-1552828 ACACTCACCCCTGGCGGAAATGG + Intronic
1063690686 10:8284258-8284280 CCACAAATTCCTGGCTCCAATGG - Intergenic
1064281059 10:13951804-13951826 ACTCTGACTCCTGGGTTCAAGGG - Intronic
1064730697 10:18327843-18327865 ACCCTCAGTCCTAGCTCCAGAGG - Intronic
1065796462 10:29312710-29312732 GCACCCCCTCCTGGCTCCCATGG + Intronic
1067064503 10:43096179-43096201 ACTCCCACTCCTGGCACCATGGG - Intronic
1068543569 10:58322922-58322944 TCTCTCACTCCTGGCTGCAGGGG + Intergenic
1069930416 10:71877931-71877953 CCAGTCACCCCTGGCTCCCAGGG + Intergenic
1070459041 10:76646283-76646305 TCAGGCACTCTTGGCTCCAAAGG + Intergenic
1072188076 10:93060938-93060960 ACGCTCACTCCCGGCTCCGCGGG - Intergenic
1073421173 10:103424914-103424936 TCACTCACTCATGGCCCCACTGG - Intronic
1073445864 10:103579998-103580020 CCACTGACTCTTGGCTCCCAGGG + Intronic
1074049717 10:109870739-109870761 ACAATCATGCCTGCCTCCAAGGG + Exonic
1074556406 10:114495114-114495136 ACTCTCACCTCTTGCTCCAAAGG - Intronic
1076602889 10:131670491-131670513 ACACTCAGTGCTGACTCCACAGG + Intergenic
1076909963 10:133382382-133382404 GCCCTAACTCCTGTCTCCAAGGG + Intronic
1078092680 11:8277065-8277087 ACATTTAATCCTGGATCCAAGGG - Intergenic
1078261997 11:9718305-9718327 ACAAGCACTCCTGGCCCCAGAGG - Intronic
1080272649 11:30467221-30467243 ACCCTCACCCCTGTCTCCAAAGG - Intronic
1080706586 11:34701292-34701314 CCACCCATTCCTGGCTCCCACGG - Intergenic
1085302125 11:75464896-75464918 AGACTCAGTCCTGCCTCCCATGG + Intronic
1085781907 11:79417246-79417268 AGACTAAGTCCTGGCACCAAGGG + Intronic
1088369306 11:109072033-109072055 ACATAGACTCCTGCCTCCAAAGG - Intergenic
1088515496 11:110628304-110628326 ACACTCAATCCTTCATCCAAGGG + Intronic
1088724185 11:112619881-112619903 ACACACACCCCTACCTCCAAGGG - Intergenic
1088742353 11:112777463-112777485 ACACTCACTCCTGCTTCCCCTGG + Intergenic
1090831845 11:130425926-130425948 ACCCCCACACCTGGCTCCTAGGG - Intronic
1090909992 11:131110574-131110596 ACACTCACTACTGGCCACAGAGG - Intergenic
1092151923 12:6254933-6254955 TCACTCACTCCTGTGGCCAAAGG + Intergenic
1093767963 12:22986478-22986500 GCATTCACTCCTGGCTTCAGTGG - Intergenic
1097016680 12:55992309-55992331 ACACTGAGCCCTGGCTCCCAAGG + Exonic
1098653339 12:73002028-73002050 ACCCTCACTCCTGCCTGCCAGGG - Intergenic
1102990514 12:117312401-117312423 ACAGTCATTCCTGCCTCAAAGGG - Intronic
1103841560 12:123869475-123869497 ACACTCACTCCTGGCTCCAAAGG + Intronic
1104482303 12:129118438-129118460 ACACACTGTCCTGGCTCCAAGGG - Intronic
1106505209 13:30365094-30365116 GCGCTCACTCCTGGCTTCAATGG - Intergenic
1107838206 13:44429192-44429214 ACGGTCACTCCTAACTCCAAGGG + Intergenic
1108432998 13:50373012-50373034 ACAATCACTTCTGGGTCAAATGG + Intronic
1108936223 13:55884407-55884429 ACACTCTCTCCTGGCTTGCAAGG + Intergenic
1109023549 13:57130897-57130919 ACAATCAATCCTGGCTGAAATGG - Intergenic
1109271513 13:60260824-60260846 AAACTCACTCGTGCCTGCAAAGG - Intergenic
1112676740 13:101710417-101710439 ACAGTTACTCCTGGTTCCAGTGG + Intronic
1114392978 14:22330012-22330034 ACTCTCACTACTGGCACCAATGG - Intergenic
1115738461 14:36361269-36361291 ACTCTCACTCCTACCTCCCAGGG + Intergenic
1116511226 14:45749422-45749444 ACCCTCACTCCTCCCACCAAAGG + Intergenic
1121199572 14:92106303-92106325 ATACTCCCTCCCGGCTCCCAGGG + Intronic
1124993749 15:34701879-34701901 ACACCCAGCCCTGGCTCCCATGG - Intergenic
1126744733 15:51814467-51814489 AGACACAGTCCTGCCTCCAAGGG - Exonic
1127538814 15:59917174-59917196 ACTCTCCCTCCTGGATTCAAGGG - Intergenic
1130326032 15:82880913-82880935 ACACTCACCCTTGGCTCCCAGGG - Intronic
1131737376 15:95348214-95348236 ACACTGGCTCCTGGTCCCAATGG + Intergenic
1131901223 15:97089901-97089923 GCCCTCACTCCTGGCACCAGTGG + Intergenic
1133413764 16:5589908-5589930 ACACTCACACCTGGGGCCACTGG + Intergenic
1134382531 16:13741097-13741119 ATACTCAATCCTAGCTGCAAGGG - Intergenic
1136567026 16:31076692-31076714 CCACTGACTCCTGGGGCCAAAGG + Exonic
1137502039 16:49019193-49019215 ACACAGGCTCCTGCCTCCAAGGG + Intergenic
1139490242 16:67282093-67282115 ACACTCACCCCAGGCTCCATGGG - Exonic
1141777514 16:86134230-86134252 CCGCTCACTCCTGGGACCAAGGG + Intergenic
1142804893 17:2366235-2366257 ACACACACCCCTGGGCCCAAGGG + Intronic
1144801711 17:17933350-17933372 ACAGTCACCCCTAGCTGCAAGGG + Intronic
1145792800 17:27638342-27638364 ACACACACACCTGGTTCCACTGG - Exonic
1145807666 17:27746211-27746233 ACACACACACCTGGTTCCACTGG - Intergenic
1147334086 17:39716389-39716411 CCACGCACTCCTGGCCCCGAAGG - Exonic
1147535904 17:41323297-41323319 ACTCTCACTCCTGGGTCCCAGGG - Intergenic
1148880281 17:50719960-50719982 ATCCTCCCTCCTGGCTCCATGGG - Intronic
1150452914 17:65284155-65284177 ACACTATCACCTGGCTCCGAGGG - Intergenic
1151550808 17:74821527-74821549 ACAATCCCTCCTGGCACCCAGGG - Intronic
1152562466 17:81085462-81085484 GCACTCGCTCCTGGCTCCAGAGG + Intronic
1152584725 17:81183795-81183817 ACACCCACTAATGGCACCAAGGG - Intergenic
1152594236 17:81230502-81230524 ACACGCACACCGGGGTCCAAGGG - Intronic
1152783256 17:82235742-82235764 ACCCTCACAGCTGGCTCTAAAGG - Exonic
1153050903 18:902306-902328 CGACTAACTGCTGGCTCCAAGGG - Intergenic
1153080450 18:1217638-1217660 ACTCTCTGTCCTGGCTCCAAAGG - Intergenic
1154331689 18:13434904-13434926 ACCCTCTGGCCTGGCTCCAATGG - Intronic
1155889141 18:31244695-31244717 ACACTAACTCCTTTCTCCATTGG - Intergenic
1156489816 18:37489457-37489479 ACACTCACTGCTCTCTCCTAGGG + Intronic
1158934774 18:62354461-62354483 ACTCGCAGTCCTGGCTCCAGTGG - Exonic
1161331371 19:3689299-3689321 ACACTGAGCCCTGGCTCCAGGGG - Intronic
1161964587 19:7541103-7541125 CCACCCATTCCAGGCTCCAAGGG + Intronic
1162642220 19:12020552-12020574 ACACTCACTCCTCTCTCGAAAGG - Intronic
1163677386 19:18662169-18662191 ACATGCACACCTGCCTCCAAGGG + Intronic
1165942683 19:39423123-39423145 CCTGTGACTCCTGGCTCCAAGGG + Exonic
925187782 2:1861011-1861033 ACACTCACTCCTAGCCCCAGAGG + Intronic
928262723 2:29782312-29782334 AAACTCATGCCTGGCTCCAGAGG - Intronic
928689421 2:33783731-33783753 TCACTCCCTCCTGGATCCAGTGG + Intergenic
930178639 2:48327527-48327549 ACTCTCCCTCCTGGGTTCAAGGG + Intronic
937115145 2:119399479-119399501 ACACCCACTGCTGGGTCCAGGGG + Intergenic
939140955 2:138354068-138354090 TCTCTCACTCTTGGCTCCCAGGG - Intergenic
942308781 2:174634802-174634824 CCAGGCACTCCTGACTCCAAAGG + Intronic
942620616 2:177841587-177841609 CCACTCACTCATGCATCCAATGG - Intronic
944602936 2:201321534-201321556 GCACTCACACCAAGCTCCAATGG - Intronic
946034059 2:216727827-216727849 CCACTCACTCCAGCCCCCAAAGG - Intergenic
947172499 2:227325413-227325435 ACACTCACCCCTGGGCCCACAGG - Exonic
947965710 2:234279888-234279910 ACACACACTTCAGGCCCCAAGGG - Intergenic
948044002 2:234928742-234928764 ACACCAAGTACTGGCTCCAAGGG + Intergenic
948163045 2:235840838-235840860 ACACTCTCTCATGTCTTCAATGG - Intronic
948375923 2:237520137-237520159 ACAGTCCCACCTGGCTCCCAAGG + Intronic
948832736 2:240606158-240606180 ACACTCACTCAGGGATCCCAGGG + Intronic
1172176793 20:32977377-32977399 TCACTCCCTCCTTGCTCCCATGG + Intergenic
1173258464 20:41412142-41412164 ACCCTCAGTCCTGGCTCCTTGGG + Exonic
1174918991 20:54682259-54682281 ACACTCATTCCTGACATCAAAGG - Intergenic
1180634454 22:17253325-17253347 AAAATCATTCCTGGCTACAAAGG + Intergenic
1181632248 22:24157317-24157339 AAACTCAGTCCTGCCTCTAAAGG + Intronic
1184374777 22:44104809-44104831 ACCCTCACTTCTGACACCAATGG + Intronic
1184649043 22:45911278-45911300 ACGCTCCCTCCTGGCTCCAGGGG - Intergenic
1203331222 22_KI270738v1_random:90814-90836 CCACTCTCTTCTGGCTTCAAGGG - Intergenic
949367928 3:3303002-3303024 TCAGACACTCCTGGCTCCAGCGG - Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
955129937 3:56156379-56156401 GGAATCACTCCTGGCTCCATGGG - Intronic
958116212 3:89221267-89221289 ACATTTACTTCTGACTCCAAGGG + Intronic
958178156 3:90023103-90023125 GCAGTCACTTATGGCTCCAATGG - Intergenic
958917295 3:100063961-100063983 ACATTCAGTACTGGCACCAATGG - Intronic
959062948 3:101632639-101632661 GAACTCACTCCTGGCTCCCCTGG + Intergenic
959192180 3:103128597-103128619 AAACTTGCTCCTTGCTCCAAAGG - Intergenic
966792211 3:183683550-183683572 ATTCACACTCCTGGCTCAAATGG - Exonic
970639854 4:18051856-18051878 ACACACACTTCTGGCTCCCATGG - Intergenic
973987604 4:56370144-56370166 AGTCTCACTCCTGGCCTCAAGGG - Intronic
977033384 4:91917018-91917040 ACAGTCTCTCCTGTTTCCAAAGG + Intergenic
977997768 4:103515340-103515362 GGACTCATTCCTGGCCCCAAGGG - Intergenic
978439689 4:108720424-108720446 ACACTCATTCCTATCTCCAAAGG + Intergenic
978625298 4:110678558-110678580 ACACTAACTCCTTTATCCAAGGG - Intergenic
978727739 4:111989874-111989896 ACACTCCCTACTGGCAACAAAGG - Intergenic
978922248 4:114199081-114199103 CCACTCTCTCCTGGCTCATAAGG + Intergenic
978923586 4:114216687-114216709 CCACTCATTCCTGGCTTCCAGGG + Intergenic
983271994 4:165573282-165573304 ACACTCATTCCCAGCTCAAATGG + Intergenic
985305250 4:188532581-188532603 ACACTTCCTCCTGTCTACAATGG - Intergenic
986308561 5:6533536-6533558 ACACTGAGCCCTGGCTCCCACGG - Intergenic
992019462 5:72607627-72607649 AAACTCACACCTGCCTCCCAGGG + Intergenic
993147243 5:84111097-84111119 ACACTCACTCCTGCTGCCATAGG + Intronic
994148374 5:96420400-96420422 ACACTCCCACTTTGCTCCAAAGG + Intronic
998232357 5:140368941-140368963 ACACCCACACCTTGCTCCACTGG - Intronic
1005983490 6:30855469-30855491 ACAGCCACACCTGGCTGCAAGGG - Intergenic
1006277564 6:33017887-33017909 ACCTTCACTCCTGCCTCCACTGG + Intergenic
1008484184 6:52017334-52017356 ACACTCTCTGATGGCTCCATCGG + Intronic
1008499386 6:52165625-52165647 AAACTCACCCCTGGGTTCAAGGG + Intergenic
1009927701 6:70139866-70139888 ATATTTAGTCCTGGCTCCAATGG - Intronic
1013241281 6:108248161-108248183 ACACACACTCCTGGCCCCTCAGG + Intronic
1013997342 6:116324101-116324123 CCCCTCACCCCAGGCTCCAAAGG + Intronic
1015866771 6:137735074-137735096 ACACTTCCTCCTGGCTCTATGGG + Intergenic
1017491318 6:154947988-154948010 CCACTCTCTCCTGGCTCGTAAGG + Intronic
1018245146 6:161815495-161815517 ACTTTCACTTCTGGCTACAATGG + Intronic
1018603612 6:165574439-165574461 TCCCTCAATCCTGGCTCCAGTGG - Intronic
1018978459 6:168583266-168583288 TCACTCCTTCCTGGCTCCAGTGG + Intronic
1018978471 6:168583307-168583329 TCACTCCTTCCCGGCTCCAATGG + Intronic
1021039621 7:15846005-15846027 ACACTCACTGCTGTTTCTAAAGG - Intergenic
1021723574 7:23529222-23529244 ACCTTCACTCCCAGCTCCAAAGG + Intronic
1022517157 7:30983394-30983416 ACACTCACTGCTGACACTAATGG - Intronic
1022526081 7:31038203-31038225 CGACTCACACCTGGCTGCAAGGG + Intergenic
1022893271 7:34722935-34722957 ACACTCACTTCAGGCTAAAATGG - Intronic
1023162583 7:37311623-37311645 ACGGTGACTCCTGGCTCCACAGG - Intronic
1028255859 7:88597204-88597226 ACACACACTGCAGACTCCAAAGG + Intergenic
1028538859 7:91920480-91920502 ACAGTCACTCCTTGCTGCAAAGG + Intergenic
1036484620 8:9168173-9168195 ACAGTCATTCCTCTCTCCAATGG - Intergenic
1036662650 8:10717833-10717855 ATGCTCATTCCTGGCTCAAATGG - Intergenic
1037083573 8:14817898-14817920 ACACTCACACCTGGCTCAACAGG + Intronic
1037151492 8:15640747-15640769 AAATTCTCTCCTGGATCCAAGGG + Intronic
1038407765 8:27334691-27334713 ACACTCATGCCTGGCTCACACGG + Intronic
1040304212 8:46203646-46203668 ACACTGCCACCTTGCTCCAAAGG - Intergenic
1043131996 8:76473228-76473250 ACACTCATTCCTGGCCCCCAAGG - Intergenic
1044515547 8:93134325-93134347 ACACTCACTGTTGCCTCCATAGG + Exonic
1045939644 8:107724988-107725010 ACAGTAACTCCTGCCCCCAAAGG + Intergenic
1045959597 8:107951726-107951748 TCACTCACTCCCGGCCCCCAAGG + Intronic
1047251590 8:123185229-123185251 AAAGTCCCTCCAGGCTCCAAAGG + Intronic
1048261677 8:132950419-132950441 AGACTCTCTCCTGCCTCCCAGGG + Intronic
1054261233 9:62867039-62867061 ACCCTCACCCCTGGCTCACAAGG - Intergenic
1055933567 9:81584378-81584400 ACCTTCACTCCTGGCTTCAGAGG + Intronic
1056634586 9:88320917-88320939 ACCCTCTCTCCTGGCGCCGATGG - Intergenic
1056682936 9:88735645-88735667 AAGCCCACTTCTGGCTCCAAGGG - Intergenic
1057574203 9:96228447-96228469 ACACCCACACCTAGCTGCAAGGG - Intergenic
1057878144 9:98773204-98773226 GCACTCACTGCTGCCTCCTAGGG - Intronic
1060525669 9:124320031-124320053 ACATTCAATCCTGGTTCCCAGGG - Intronic
1189329506 X:40134710-40134732 ATTCTGGCTCCTGGCTCCAAAGG - Intronic
1193776105 X:85643673-85643695 ACAATCACTCCTGGCTTGAAAGG - Intergenic
1193970655 X:88047328-88047350 AAACTCTGTCCTGGCTCTAAGGG + Intergenic
1196899369 X:120367963-120367985 ACACTCACTTGGGGCTCCAAGGG + Intronic
1198432024 X:136576852-136576874 ACACTAATTCTTGCCTCCAAGGG - Intergenic