ID: 1103841599

View in Genome Browser
Species Human (GRCh38)
Location 12:123869700-123869722
Sequence CCTGAGAAGGAGGAAGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1244
Summary {0: 1, 1: 0, 2: 12, 3: 123, 4: 1108}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103841599 Original CRISPR CCTGAGAAGGAGGAAGGGGC TGG (reversed) Intronic
900285297 1:1896225-1896247 CCTGCAAGGGAGGCAGGGGCTGG - Intergenic
900326003 1:2108992-2109014 CGTGAGACGGAGGCAGAGGCTGG - Intronic
900372409 1:2337814-2337836 TCTGAGAGGGAGGCAGGGGCTGG + Intronic
900382744 1:2392871-2392893 CTTGGGAAGGAGGAAGAGACGGG + Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900512355 1:3066702-3066724 CCTGAGCTGGAGGAGGAGGCAGG + Intergenic
900590066 1:3455412-3455434 CCTGAGAAGGGAGATGGGGAGGG + Intronic
900694129 1:3999721-3999743 TCACAGAGGGAGGAAGGGGCCGG + Intergenic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
900799998 1:4731590-4731612 CTTGAGAAGGAGGGAGAAGCAGG + Intronic
900864790 1:5260566-5260588 CCTGAGAAAGATGAGAGGGCAGG - Intergenic
900913264 1:5617175-5617197 CCTGAGCAGAAGGCAGGGCCAGG + Intergenic
900923959 1:5691602-5691624 TCTGAGCAGGAGGAAGAGGAGGG - Intergenic
901067768 1:6502549-6502571 CCTCAGCCGGAGGAAGTGGCCGG - Intronic
901103791 1:6739664-6739686 CATGAGCAGGATGAAGGGACAGG - Intergenic
901233450 1:7654024-7654046 CCTGAGAATGAGCCAGAGGCGGG + Intronic
901317058 1:8316580-8316602 CCTGGGAAGGAGGTGAGGGCTGG - Intergenic
901420291 1:9146179-9146201 ACAGAGGAAGAGGAAGGGGCTGG + Intergenic
901657645 1:10779485-10779507 CCTGGCAAGGGGGAGGGGGCGGG - Intronic
901689079 1:10960895-10960917 TCTCAGATGGGGGAAGGGGCTGG + Intronic
901704102 1:11060323-11060345 CCCGAGAAGGAAGCGGGGGCCGG - Intergenic
902255423 1:15186071-15186093 GCTGAGTGGGAGGAGGGGGCAGG - Intronic
902434651 1:16390410-16390432 GCTGAGAAGGAGGAGCAGGCAGG - Intronic
902542173 1:17163217-17163239 CCTGCGAAGGAGGAGTGGCCTGG - Intergenic
902661461 1:17906917-17906939 CCTGTGGAGGAGGAGGGAGCTGG + Intergenic
902893878 1:19465312-19465334 CCTCACATGGTGGAAGGGGCTGG - Intronic
902954883 1:19918772-19918794 CCTGAGAAGGGTGAAGGGAGTGG + Intergenic
903003751 1:20284722-20284744 CCAGAGAAGGTGGCAGTGGCAGG - Intergenic
903036547 1:20496684-20496706 CCGGAGCAGGAGGAAGTGGAGGG - Intergenic
903346153 1:22685564-22685586 ACAGGGAAGGAGGAATGGGCTGG - Intergenic
903392047 1:22971510-22971532 CCTGAGAAGGAGCAGGGGTTGGG - Intergenic
903595594 1:24491626-24491648 AATCAGAAGGAAGAAGGGGCAGG - Intergenic
903808778 1:26023038-26023060 GCTGAGGAGGAGGAGGAGGCAGG - Exonic
903867916 1:26411839-26411861 CCTGGGAAGGGGCAGGGGGCAGG + Intronic
903878144 1:26490363-26490385 CCTAAGTAGGGGGAAGGGGAGGG + Intergenic
903954116 1:27013024-27013046 CCTGAGAAGGAGGGCGGGGCAGG - Intergenic
904102212 1:28041065-28041087 CCTGACAAGAAGGAAATGGCTGG + Intronic
904140848 1:28351736-28351758 CCTCAAGAGGAGGGAGGGGCTGG - Intergenic
904464774 1:30701316-30701338 CTTCAGGAGGAGGAAGGGGAGGG - Intergenic
904584416 1:31572008-31572030 ACAGAGGAGCAGGAAGGGGCTGG - Intergenic
904917303 1:33979440-33979462 CCACAGTAGGAGGAAGGGGCAGG - Intronic
904941735 1:34168399-34168421 CAGGAGGAGGAGGATGGGGCTGG + Intronic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905140508 1:35840267-35840289 ACTCAGAAGGTGGAAGAGGCAGG - Intronic
905262373 1:36729002-36729024 CCTGAGGGGGATGAAGGGCCAGG + Intergenic
905306404 1:37021792-37021814 ACTGAGAGTGAGGATGGGGCAGG - Intronic
905370493 1:37480210-37480232 CCTGAGCAGGAGGAGGGAGGTGG - Intronic
905492138 1:38352986-38353008 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
905792587 1:40798132-40798154 CCTCAGAAGAATGAGGGGGCTGG - Intronic
906074637 1:43042979-43043001 CCTGTGAAAGAGGAAGGGGGAGG - Intergenic
906139371 1:43524635-43524657 CCTGAGAAGCAGGAGTGGGTAGG + Intergenic
906530010 1:46518327-46518349 CATGAGAAGGAGGTGGGGGCAGG + Intergenic
906536117 1:46551841-46551863 CCTGAGGAGGAAGAACGAGCTGG + Intergenic
906551294 1:46668330-46668352 CCTGAGGAGGAGGAGGAGGCGGG - Exonic
906994625 1:50778668-50778690 GAAGAGAAGGAGGAAGGGGAGGG + Intronic
907306092 1:53513888-53513910 GCAGGGAAGGAGGAAGGTGCTGG + Intronic
907317508 1:53581858-53581880 CCTAGGGAGGAGGAAGGGGGTGG - Intronic
907605004 1:55807276-55807298 CTTGAGAAGGAAGAATGGGAAGG + Intergenic
907629619 1:56067158-56067180 GCTAAGAAGCAGGAAGGGGCAGG - Intergenic
907902129 1:58750638-58750660 CCTGAGAAAGCAGAAGGGGAGGG - Intergenic
908216943 1:61963701-61963723 GCTGAGGAGGAGGAAGAGGCAGG + Intronic
908353160 1:63306231-63306253 GAGGAGAAGGAGGAAGGGGAAGG + Intergenic
908474590 1:64474921-64474943 CCTGGGAGGGAGGGAGGAGCAGG + Intronic
908792699 1:67798576-67798598 GAGGAGAAGGAGGAAGGGGAGGG - Intronic
909377515 1:74957104-74957126 CCTGTGAAGGAGGATTGGGTAGG - Intergenic
909926855 1:81447968-81447990 CCGGAGCAGGAGGAAGAGACAGG - Intronic
911055568 1:93705574-93705596 CCTGAGAAGGGAGCAGTGGCTGG - Intronic
911095296 1:94049943-94049965 CCAGAGAGGAAGGCAGGGGCAGG + Intronic
911189797 1:94936405-94936427 CATGAGAAAGAGAAAGTGGCAGG - Intergenic
911642753 1:100306427-100306449 CCAGAGCAGGAGGAATGGGGGGG - Intergenic
911811197 1:102284315-102284337 CCAGAGCAGGAGGAAGTGGGTGG + Intergenic
912490025 1:110057668-110057690 CCTGTGGAGGAGGCTGGGGCAGG + Intronic
912817115 1:112838170-112838192 CCTGGGGAGGGGAAAGGGGCTGG - Intergenic
912843477 1:113059534-113059556 CCTTGGAAGGATAAAGGGGCAGG + Intergenic
913048067 1:115090001-115090023 CCCGAGGAGGGGGGAGGGGCCGG - Intergenic
913174003 1:116257272-116257294 ACTCAGAGGGAGGGAGGGGCAGG - Intergenic
913178874 1:116299891-116299913 GCTGAGAGAAAGGAAGGGGCTGG - Intergenic
913519892 1:119634996-119635018 CCGGACAAAGGGGAAGGGGCTGG + Intronic
914513286 1:148352971-148352993 GCAGAGAAGGAGGAGGAGGCAGG + Intergenic
914689141 1:150010385-150010407 TCTGAGAAGCCGGGAGGGGCGGG + Intronic
915555842 1:156660234-156660256 CCTGAGGAGGCGGGAGGGGAAGG + Intergenic
915562228 1:156693994-156694016 CCAGAGAAGGTGGAAGGGCAAGG - Intergenic
915929637 1:160051868-160051890 GGTGAGAAGGAGGAACGGGTCGG - Intronic
915930872 1:160060185-160060207 CTTAAGAAGGAGGATGGGGTAGG + Intronic
916101133 1:161394224-161394246 TCTGGGGAGGAGAAAGGGGCTGG - Intergenic
916180573 1:162079989-162080011 CCTGACAAGGATTAAAGGGCTGG - Intronic
916417964 1:164610293-164610315 CCTTTGAAGCAAGAAGGGGCTGG + Intronic
916648923 1:166816906-166816928 CCTGCCAACTAGGAAGGGGCAGG + Intergenic
916704805 1:167338175-167338197 GCTGAGAAGGAGGAACAGGAGGG - Intronic
916718777 1:167467132-167467154 ACTGAAAAGGATAAAGGGGCCGG - Intronic
916891648 1:169117526-169117548 CCTGATAAGTAGGAAGGACCAGG + Intronic
917355577 1:174123515-174123537 CCAGAGCAGGAGGAAGGTGGGGG - Intergenic
917802075 1:178580564-178580586 CCTGAGGAGGAGGGATGGGGAGG - Intergenic
917969353 1:180197114-180197136 CCAGACAAGGAGCAAGGGGTGGG - Exonic
918424406 1:184393400-184393422 CCTGAGAAACAGGCAGAGGCAGG - Intronic
919349152 1:196426865-196426887 CCAGAGCAGGAGGAAGAGGGTGG - Intronic
919557710 1:199080943-199080965 AGTGAGAATGATGAAGGGGCAGG - Intergenic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
919816495 1:201443992-201444014 CCTGAGAGAGGGGAAGGGGCAGG + Intergenic
919935461 1:202247923-202247945 GCTGGGGAGGAGGAGGGGGCAGG - Intronic
920092423 1:203464117-203464139 CCAGAGAGGGAGGAAGGAGGAGG + Intergenic
920315579 1:205073820-205073842 CCTTGGCAGCAGGAAGGGGCTGG - Exonic
920353434 1:205352789-205352811 CCAGTGAAGGAGGGAGTGGCAGG + Intronic
920405180 1:205703782-205703804 CCTAAAAAGGAGGGAAGGGCAGG - Intergenic
920451253 1:206062711-206062733 CCTGAGAAAGGGGACGGGGGAGG + Intronic
920608020 1:207409020-207409042 TGTGAGAAGGAGGTGGGGGCTGG - Intergenic
920653128 1:207853376-207853398 CAAGAGAAGAGGGAAGGGGCTGG + Intergenic
920724753 1:208423670-208423692 ACAGGGAAAGAGGAAGGGGCGGG + Intergenic
920803011 1:209207192-209207214 CCTGACAAGGAGGAAGCAGAGGG + Intergenic
920847532 1:209606587-209606609 CCTGAGACGGATGAATTGGCTGG - Intronic
920864810 1:209743178-209743200 CAAGAGAAGGAGGAAGGTGAAGG + Intergenic
921030121 1:211329015-211329037 CCTCAGACGGAGGAAGAGGTGGG - Intronic
921046048 1:211478856-211478878 CCAGAGGAAGAGGATGGGGCAGG + Exonic
921925693 1:220708396-220708418 TCTGAGAAGAAGGGAGGGGCTGG + Intergenic
921983372 1:221283182-221283204 CCAGGCAAGGAGGAAGGGGAAGG - Intergenic
922213989 1:223506314-223506336 CCTGGGAGGTAGGAAGAGGCAGG - Intergenic
922471540 1:225880154-225880176 CCTGAGACGGAGGTAAGGTCAGG + Intronic
922507712 1:226136061-226136083 ACTTTCAAGGAGGAAGGGGCAGG + Intergenic
922588541 1:226754207-226754229 GCTGAGAAGGAGGCAGGCTCTGG + Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
922704220 1:227780529-227780551 CCTGAGGAGGATGAAGGGGCTGG + Exonic
922936912 1:229430347-229430369 CCTGGGAAGGAGGCAAGGGAGGG - Intergenic
922983924 1:229851406-229851428 CCTGGGAGGGAGACAGGGGCTGG - Intergenic
923047588 1:230366996-230367018 CCTGACGAGGAGGAAGGTGGGGG + Intronic
923211134 1:231805473-231805495 CCAGAGCAGGAGGAGGGGGGTGG + Intronic
923366720 1:233268874-233268896 CCTGAGAGAGAAGAAGGGGAGGG - Intronic
923497771 1:234540171-234540193 CCTGGGAAGGAGCCTGGGGCTGG - Intergenic
923555871 1:234999995-235000017 ACTGAGGAGGAGGAAAGGGATGG - Intergenic
923766849 1:236900458-236900480 CCACAGAAGGAGGAAGTGGAAGG + Exonic
924033328 1:239909275-239909297 CCTTAGGAGGAGGAAGGCGAGGG + Exonic
924644279 1:245862964-245862986 CCAGAGAAGGAGGTAGAGGGAGG - Intronic
1062876726 10:948664-948686 GCTGAGAAGGAGGCAGGGATGGG - Intergenic
1063086062 10:2818532-2818554 ACTGAGAGGGAGGGAGGGGATGG + Intergenic
1063470113 10:6277624-6277646 CCAGAGCAGGAGGGAGGTGCGGG - Intergenic
1063652236 10:7949184-7949206 ACAGAGAAAGAGGAAGGGGCTGG + Intronic
1063818016 10:9799262-9799284 GCTGAGAAGGAGGAAGAGGAGGG + Intergenic
1063907288 10:10794319-10794341 CCTGAGAAGAAGGCAAGAGCCGG + Intergenic
1064404284 10:15047341-15047363 CCTGGGATGGAGGAAGAGCCTGG - Intronic
1064431951 10:15278917-15278939 CCTGGCGAGGAGGAATGGGCAGG + Intronic
1065588170 10:27240600-27240622 CCGGGGGAGGAGGAAGGAGCCGG - Intronic
1065740335 10:28791521-28791543 AGTGAGAAGGAGGGAAGGGCTGG + Intergenic
1065865631 10:29912831-29912853 CTGGAGCAGGAGGAAGGGGCTGG - Intergenic
1066237118 10:33496246-33496268 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1066242375 10:33550839-33550861 CTTGGGAAGGAGGAGGGGGAAGG - Intergenic
1066389553 10:34967799-34967821 GGTGAGAAGGAGGGAGGGCCCGG + Intergenic
1066507982 10:36065283-36065305 ACTGAGGAGGTGGAAGAGGCAGG - Intergenic
1067060432 10:43075565-43075587 CCTGATAGGTAGGGAGGGGCTGG - Intergenic
1067132022 10:43574027-43574049 CCTGAGAATGAGGTCGGGGAAGG - Intronic
1067158562 10:43803151-43803173 CCTCACATGGAGCAAGGGGCCGG + Intergenic
1067424877 10:46200206-46200228 CTGGAGTAGGAGGAAAGGGCAGG + Intergenic
1067555550 10:47267399-47267421 TCAGAGAGGGAGGAAGTGGCTGG + Intergenic
1067587642 10:47485738-47485760 CATGAGAAGGAGAGAGGGCCAGG + Intergenic
1068224398 10:54087927-54087949 CCTGAGCAGGAGGAAGAGAGAGG - Intronic
1068419504 10:56771645-56771667 AATAAGAATGAGGAAGGGGCAGG + Intergenic
1068492138 10:57737651-57737673 CCTGTGAAGGTGTGAGGGGCTGG - Intergenic
1068644428 10:59450153-59450175 CCTCACAAAAAGGAAGGGGCTGG - Intergenic
1068725723 10:60300462-60300484 CCTAGGAAGGAGGTAGGAGCTGG + Intronic
1068744403 10:60513932-60513954 GCTGAGGTGGAGGAAGGGGAAGG - Intronic
1068772891 10:60841697-60841719 GCTGACAAGGAGCAGGGGGCGGG + Intergenic
1068882878 10:62068468-62068490 TCTGAGGAGGAGGAGGTGGCTGG - Intronic
1068891356 10:62151296-62151318 CCAGAGCAGGAGGAAGGGGATGG - Intergenic
1069387287 10:67895421-67895443 CCTGACACGGAGGATGGGGAGGG + Intronic
1069629951 10:69891568-69891590 CCTGGGAATGGGGTAGGGGCGGG - Intronic
1069781249 10:70957108-70957130 TCTGAGAAGGGGGCAGGGGGTGG - Intergenic
1070404903 10:76085967-76085989 CATGAGAAGGAGGAGGTGGGAGG - Intronic
1070819689 10:79347657-79347679 CCGGAGGAGGAGGAAGAGGACGG - Exonic
1070861365 10:79666424-79666446 CTGGAGTAGGAGGAAAGGGCAGG + Intergenic
1070875885 10:79809176-79809198 CTGGAGTAGGAGGAAAGGGCAGG - Intergenic
1070979063 10:80630021-80630043 CCTGTGAAGGACAAAGGGGGAGG + Intronic
1071091850 10:81928336-81928358 CCTGAGAAAGAGGAGGGAGGTGG - Intronic
1071511410 10:86264719-86264741 GCTCTGAAGGAGGCAGGGGCTGG - Intronic
1071642815 10:87331309-87331331 CTGGAGTAGGAGGAAAGGGCAGG - Intergenic
1071797435 10:89021553-89021575 CCAGGGAAGGAGCAAGGGTCAGG - Intergenic
1072313221 10:94177309-94177331 CATGAGAAGGGGGAATGGGGAGG - Intronic
1072439275 10:95439403-95439425 CCAGAGAAGGAGGAAGGGAGGGG - Intronic
1072621361 10:97081554-97081576 TCTCAGAAGAAAGAAGGGGCTGG + Intronic
1072687192 10:97544932-97544954 GCTGAGGAGGAGGAAAGGGAGGG + Intronic
1073158663 10:101370407-101370429 CAGGATAAGGAAGAAGGGGCGGG - Intronic
1073190814 10:101649641-101649663 CCTGACAAGGAGAAAGAAGCTGG - Intronic
1073280380 10:102349670-102349692 CCTAAGTAGGGGGAAAGGGCAGG - Intronic
1073424744 10:103449630-103449652 GCTTAGAAGGAGGAAGGTGGGGG + Exonic
1073639848 10:105240796-105240818 ACTGAGAAGGGGGACTGGGCTGG - Intronic
1074396710 10:113104045-113104067 CCTGAGAATTAGGATGGGCCAGG + Intronic
1074968112 10:118511299-118511321 CCTGAGGAGGAGGAAAGGGAGGG + Intergenic
1074983022 10:118634798-118634820 CTTGGGAAGGATGAAGGGTCTGG - Intergenic
1075007104 10:118839106-118839128 CCTGGGGAGGAGGAAGGGATGGG + Intergenic
1075237437 10:120743746-120743768 CATGATAAGGAGGCAGAGGCTGG + Intergenic
1075778915 10:125004707-125004729 CCTCAGAGGGAGGGAGGGGATGG - Intronic
1075802526 10:125161518-125161540 CCTGAGAAGGCAGAAGCGGCCGG - Intergenic
1076136235 10:128047058-128047080 CTGGAGAAGGGTGAAGGGGCCGG - Intronic
1076140829 10:128077542-128077564 CCTGAGAGGGCAGATGGGGCTGG + Intronic
1076195909 10:128518053-128518075 CCTCAGAAGGGGAAAGGAGCAGG + Intergenic
1076444320 10:130501529-130501551 CCCCAGAAGCTGGAAGGGGCAGG - Intergenic
1076569057 10:131420423-131420445 CCTCAGCAGGAGGAAGAGGAGGG - Intergenic
1076683057 10:132185208-132185230 CCAGAGGAGGACGAAGGGGTGGG + Intergenic
1077081340 11:725968-725990 CCTGGGCAGAAGGAAAGGGCTGG + Intronic
1077161203 11:1113464-1113486 CCTGAGTGGGCAGAAGGGGCGGG - Intergenic
1077178755 11:1203060-1203082 CCTGAAAAGGAGGCTGGGGGAGG - Intergenic
1077198053 11:1291402-1291424 ACTGGGAAGGAGGAACTGGCGGG - Intronic
1077259330 11:1607416-1607438 CCTGAGAAGGTTGAAGTGGTGGG + Intergenic
1077303241 11:1856658-1856680 ATTCTGAAGGAGGAAGGGGCTGG + Intronic
1077753953 11:5005409-5005431 CCTTAAAAGGGGGAAGGGGGAGG - Intergenic
1077874670 11:6294098-6294120 CAAGAGAAGGAGGCAGGGGCAGG + Intergenic
1077922555 11:6652590-6652612 CCTGTGGAAGAGGAAGGGGATGG + Intronic
1078313474 11:10270491-10270513 GCTGAGGAGGAGGAAGAGGAAGG + Intronic
1078328245 11:10397834-10397856 GCCAAGAAGCAGGAAGGGGCTGG + Intronic
1078405074 11:11063458-11063480 CCAGAGATGGAGGTAGGGCCTGG - Intergenic
1078415384 11:11160651-11160673 GCTTAGAATGGGGAAGGGGCAGG - Intergenic
1078434402 11:11312515-11312537 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1078811987 11:14777294-14777316 TTTGAGAAGGAGAAAGGGGGTGG + Intronic
1079159300 11:17977487-17977509 CCTTTGAAGCAGGAAAGGGCAGG - Intronic
1079200788 11:18375843-18375865 CCTGAGAAGAGGTAAGGGGCAGG + Intergenic
1079311971 11:19374899-19374921 ACTGAGAATCAGGAAGGGGATGG - Intronic
1079353842 11:19714215-19714237 CCTGGGGAGGAGGAAAGGTCGGG + Intronic
1079455059 11:20629241-20629263 GTTGAGAAGGACAAAGGGGCAGG - Intronic
1079572814 11:21965658-21965680 ACTGGGTTGGAGGAAGGGGCAGG - Intergenic
1080305556 11:30831112-30831134 GCTGAGAAGGAGGAGGGAGGAGG + Intronic
1080603934 11:33848304-33848326 CCAGAGCAGGAGGAAGGTGGCGG - Intergenic
1081599636 11:44484200-44484222 CCTGAGGAGGAGGGAGGGAATGG + Intergenic
1081681423 11:45008153-45008175 CCAGAGAAGGAGGAGGTAGCTGG - Intergenic
1083307975 11:61770602-61770624 CCAGAGAGGGAGGTAGGGACCGG + Intronic
1083372350 11:62192443-62192465 CCTGAGAAGGAGGAACATGCAGG - Intronic
1083378239 11:62243672-62243694 CATGAGAAGGAGGAACATGCAGG - Intronic
1083599751 11:63939340-63939362 TCCGCGAAGCAGGAAGGGGCGGG - Intronic
1083674804 11:64319302-64319324 CCTCAGGAGGAGGAAGAGGAAGG - Intronic
1083727123 11:64634414-64634436 CCAGAGATGGGGGAAAGGGCAGG + Intronic
1083934327 11:65862475-65862497 CCTGTGAAGGAGGGAGCGGAGGG - Exonic
1083991529 11:66249021-66249043 CCTAAGAAGGCAGAATGGGCTGG - Intergenic
1084065528 11:66701721-66701743 CCTGAGAGGGTGGAAGAGCCAGG + Exonic
1084094825 11:66904212-66904234 CCTGAGAAGGGGCAGGGTGCAGG - Intronic
1084148774 11:67278499-67278521 CCTGGGAAAGAGGTTGGGGCTGG - Intronic
1084187550 11:67482901-67482923 CCTGTCAAGGAGGAAGGGCCGGG - Intergenic
1084404009 11:68960663-68960685 CCTGGGCAGGAGGCAGGGGTGGG + Intergenic
1084427967 11:69095906-69095928 CAGGAGGAGGAGGAAGAGGCTGG + Intergenic
1084438156 11:69156007-69156029 CCACAGATGGAGGAAGGGCCAGG + Intergenic
1084559120 11:69892871-69892893 GCTGGGAAGGAGAGAGGGGCTGG - Intergenic
1084691370 11:70728906-70728928 CCTGAGAAGGAATGAAGGGCCGG + Intronic
1084950549 11:72662919-72662941 CCTGGGCTGGAGGAAGGGCCTGG - Intronic
1085037050 11:73307122-73307144 ACTCAGACGGAGGCAGGGGCGGG + Intergenic
1085128420 11:74017735-74017757 CCAGAGAAGGAGCCAAGGGCCGG - Intronic
1085182894 11:74550928-74550950 TCTGAGCTGGAGGAAGGGGCAGG + Intronic
1085276378 11:75302813-75302835 CCTGAGCAGGGGGTGGGGGCAGG - Intronic
1085310040 11:75510753-75510775 CCGGAGGAGGAGGAGGGGGGAGG - Intronic
1085349851 11:75791385-75791407 CCTGAGGAGCAGGAAGGTCCCGG - Intronic
1085479023 11:76806425-76806447 CCTGTGAAGACGGAAGAGGCTGG + Intergenic
1086282869 11:85210922-85210944 CCTGTGAAAGATGAAGGGGAGGG - Intronic
1087433218 11:98080022-98080044 CCAGAGCAGGAGGAAGGAGCAGG - Intergenic
1087601978 11:100328551-100328573 CCAGAGAAGAAGGAAGAGACAGG + Intronic
1088544023 11:110941927-110941949 GCTGAGGAGGAGGAAGGGAGGGG + Intergenic
1088812422 11:113400674-113400696 CCTCTCAAGGTGGAAGGGGCAGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1089163520 11:116457671-116457693 CCTGAGGAAGGGGAAGAGGCAGG + Intergenic
1089209427 11:116790417-116790439 ACTGGGACTGAGGAAGGGGCCGG - Exonic
1089563085 11:119355669-119355691 TCTGAGAAGGGGGCGGGGGCAGG + Exonic
1089813172 11:121148175-121148197 CCTGAGACTGAGGATGAGGCAGG - Intronic
1089858028 11:121564298-121564320 CCTAAGAGGTAGGCAGGGGCAGG - Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090080877 11:123611812-123611834 CCTGAGGAGGGGGATGAGGCTGG + Intronic
1090168716 11:124579370-124579392 CCTGAGGAGGAGGAAGAAGAGGG + Intergenic
1090215051 11:124954374-124954396 CCGGAGAAAGAGGGAGGGGCGGG - Intronic
1090743794 11:129691340-129691362 CCTGAGCAGGAGGCTGGGGGAGG - Intergenic
1090861179 11:130653957-130653979 ACTGAGAGGGTGGAAGGGGTGGG - Intergenic
1091218804 11:133918926-133918948 CTGGAGAAGGAAGGAGGGGCAGG + Intronic
1091223578 11:133944993-133945015 CCTGAGAACAAGGAATGGGTTGG + Intronic
1091238394 11:134036750-134036772 CCTGGGAAAGAGGAAGGGAAAGG + Intergenic
1091314665 11:134605079-134605101 CCAGAGAAGGAACAAGGGGTGGG + Intergenic
1091635550 12:2194096-2194118 CAGGAGGAGGAGGACGGGGCAGG - Intronic
1091636285 12:2199334-2199356 ACTGAGGAGGAGGAAGGGGAGGG - Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091834794 12:3577943-3577965 CCTCTGGAGGAGGATGGGGCTGG - Intronic
1092061104 12:5551246-5551268 CGTGAGAAGGAGGCAGGGAAGGG + Intronic
1092217577 12:6693960-6693982 CCTGAGGAGGGGGAAAGGGCAGG + Exonic
1093764019 12:22942129-22942151 CCAGAGCAGGAGGAAGGAGTAGG - Intergenic
1094145784 12:27227001-27227023 GCTGAGATAGAGGAAGGGGCTGG - Intergenic
1094635905 12:32227068-32227090 ACTGTGAAGGAGGAGGTGGCTGG + Intronic
1095385477 12:41644994-41645016 CCTGAGAAGCAGGAGTGTGCAGG - Intergenic
1095709085 12:45269095-45269117 CCAGAGAAGAAGGGAGGGCCTGG - Intronic
1095905066 12:47369154-47369176 CCTGAGAAGGTGAGGGGGGCTGG + Intergenic
1095958954 12:47821649-47821671 CAACAGAAGGAGAAAGGGGCTGG - Intronic
1096016478 12:48280741-48280763 CCAGAGAAGGAGGAAGGACGAGG - Intergenic
1096108096 12:49010433-49010455 ACTGAAAAGGGGGAAAGGGCTGG + Intronic
1096394165 12:51253004-51253026 TCTGAGAAAGAGAAAGGGGTCGG + Intronic
1096408540 12:51360937-51360959 CCTGAGAAAGAGGAAAGGAGGGG - Intronic
1096491656 12:52015911-52015933 CCTGAGGGGGAGGATTGGGCTGG + Intergenic
1096497109 12:52044969-52044991 CCTGAGAGGGAGGGAGGGAGGGG + Intronic
1096498616 12:52052594-52052616 CCACAGGAGGAGGAAGAGGCGGG - Intronic
1096537677 12:52286002-52286024 CCTCAGGAGCAGGAAGGGCCAGG - Exonic
1096679024 12:53242499-53242521 CCTGGCAAGGAGGCAGGAGCTGG + Intergenic
1096691421 12:53324465-53324487 CCTGAGAAGGGGAAGTGGGCAGG + Intronic
1097178572 12:57157854-57157876 GCAGAGAAGGAGGCAGGGGTTGG + Intronic
1097712850 12:62934530-62934552 CTTGAGGATGAGGATGGGGCGGG + Exonic
1097728394 12:63100077-63100099 CCTGAGAAAGCAGAAGGGCCTGG - Intergenic
1097925366 12:65121352-65121374 CGAGAGCAGGAGGAGGGGGCAGG + Exonic
1098391100 12:69970918-69970940 CCAGAGCAGGAGGAAGGGAGGGG - Intergenic
1098483356 12:70991899-70991921 CCAGGGAAGGAGGCAGGGGAAGG - Intergenic
1099184559 12:79503518-79503540 CCTGAGACAGAGGGAGGGGTGGG + Intergenic
1099944103 12:89224552-89224574 CCTGAGAATGTGGTGGGGGCAGG - Intergenic
1101292095 12:103381223-103381245 CATGAGAAGTAGGAAGGGAAGGG - Intronic
1101387170 12:104268150-104268172 AGAGAGAAAGAGGAAGGGGCCGG - Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102122158 12:110450122-110450144 CCCGAGAAGGAGGGAGGCGAGGG - Intronic
1102351092 12:112192765-112192787 GCTGAGAAGGAGGGATGGGTGGG + Exonic
1102547248 12:113665930-113665952 TCTTAGGAGGTGGAAGGGGCTGG - Intergenic
1103327695 12:120132380-120132402 CCTGTGAGGCAGGGAGGGGCGGG + Intronic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103729821 12:123020030-123020052 CCTGCGAGGCAGGAAGTGGCAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1104021469 12:124994740-124994762 CTTGAGAAGGAGGAAGTTACTGG + Intronic
1104041627 12:125134620-125134642 CCTGAGAGGGAGAAAGAGCCGGG + Intronic
1104103861 12:125640528-125640550 CCAGAGAAGGAGGCAGGTCCAGG + Intronic
1104187693 12:126448526-126448548 ACAGAGAAGGAGGAAGAGACTGG + Intergenic
1104248113 12:127062250-127062272 CCAGAGATGGAGGGAGAGGCAGG - Intergenic
1104323528 12:127774230-127774252 AGTGAGCAAGAGGAAGGGGCAGG - Intergenic
1104538086 12:129637541-129637563 CCAGACCAGGAGGAAGGGGGTGG - Intronic
1104658438 12:130591598-130591620 CCCCAGAAGCTGGAAGGGGCTGG - Intronic
1105418177 13:20231382-20231404 CCTGGGGAGCAGGAAGGGTCAGG - Exonic
1106220020 13:27738685-27738707 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1107097531 13:36552645-36552667 CCTGAGAAGAAGGATGGGAAAGG + Intergenic
1107298425 13:38939752-38939774 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
1107303359 13:38991299-38991321 CTGGAAAGGGAGGAAGGGGCAGG - Intergenic
1107408135 13:40134297-40134319 CCTGAGAGAGAGGAGGGAGCAGG - Intergenic
1107835980 13:44412888-44412910 TGTGAGACAGAGGAAGGGGCTGG + Intergenic
1108092095 13:46859627-46859649 CCAGAGCAGGAGGAAGGTGAGGG - Intronic
1108252132 13:48577925-48577947 TCTCAGAAGGAGGAAGGGAAGGG - Intergenic
1108316770 13:49244173-49244195 GCAGAGGAAGAGGAAGGGGCTGG + Intergenic
1108351766 13:49594595-49594617 CCTGAGGAGGTGAAAGGGACAGG - Intergenic
1108478563 13:50843995-50844017 CCTTCGAAGGAGGTGGGGGCGGG - Intergenic
1108479510 13:50854123-50854145 CCGGAGCAGGAGGAAGAGACAGG - Intergenic
1108712471 13:53047230-53047252 CTTGACATGAAGGAAGGGGCTGG + Intronic
1109272393 13:60268837-60268859 AGTGAGAAAGGGGAAGGGGCCGG + Intergenic
1109450713 13:62511290-62511312 CCTGAGAAGTTGGAAGAGACTGG - Intergenic
1109600918 13:64627456-64627478 TCAGAGAAGGAGCAAGGGGTGGG - Intergenic
1109786473 13:67182136-67182158 CCTGAGAAGGAGGATATAGCAGG - Intronic
1110583075 13:77155384-77155406 ACTTTGAAGGAGGAAAGGGCTGG + Intronic
1110868709 13:80425158-80425180 CCAGAGCAGGAGGAAGAGACAGG + Intergenic
1111299683 13:86331730-86331752 CCTTAGAAGCAGCAAGGTGCAGG - Intergenic
1111834461 13:93370629-93370651 CCTGTTATGGAGGAAGAGGCTGG + Intronic
1112630700 13:101158452-101158474 GCAGAGAAGGAGAAAGGGGTGGG + Intronic
1112924677 13:104659580-104659602 CCAGAGCAGGAGGAAGAGGGAGG - Intergenic
1112934710 13:104783150-104783172 TCTGAGATTGAGGAATGGGCAGG + Intergenic
1113285643 13:108845487-108845509 AATGGGAAGGAGGAAGAGGCAGG + Intronic
1113758477 13:112831183-112831205 GCTGGGAAGGAGGATGAGGCAGG + Intronic
1113814855 13:113162939-113162961 CCTGAGCAGGAGGAGGGTGGGGG - Intronic
1113847265 13:113399477-113399499 CCTGGGCAGGAGGGAGGGTCTGG - Intergenic
1114042987 14:18695985-18696007 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114047278 14:18886425-18886447 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1114539846 14:23446736-23446758 CCTGAGAAGTAGACAGGGCCAGG - Intergenic
1114553288 14:23546612-23546634 CCTGGGGAGGAGGGATGGGCAGG + Intronic
1114617398 14:24075629-24075651 CCTGAGAGTGTGGTAGGGGCAGG - Intronic
1115094539 14:29618970-29618992 AATGAGGAGGAGGAAGGGGGAGG + Intronic
1115916409 14:38320517-38320539 CCAGAGCAGGAGGAAGGTGAGGG + Intergenic
1116309415 14:43304201-43304223 GCTGAGAAGAAGGAAGTGGAGGG + Intergenic
1116715325 14:48418642-48418664 CTTGTGAAGGTGGAAGGAGCTGG + Intergenic
1116798129 14:49413584-49413606 CCTGAGGAGGTGAAAGGGGCAGG - Intergenic
1117496667 14:56312491-56312513 CCAGAGCAGGAGGAAGGTGGAGG + Intergenic
1117554304 14:56868926-56868948 CCTGATTAGGAGGTAGGGGAAGG - Intergenic
1117950058 14:61073859-61073881 GCTGAGAAGAAGGCAGGGGAGGG - Intronic
1119019310 14:71093758-71093780 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1119431114 14:74568426-74568448 CATGAGCCGGAGGAAGGGGTGGG + Intronic
1119614701 14:76091462-76091484 CCTGAGAAAGGGGAGAGGGCAGG - Intergenic
1119709261 14:76809532-76809554 CCTGAGCAGGAGGAATGTGAGGG - Exonic
1119738822 14:77000724-77000746 GCTGAGCGGGAGGAAGAGGCTGG - Intergenic
1119768864 14:77207778-77207800 CCTCAGGAGAAGAAAGGGGCAGG - Intronic
1119772471 14:77228892-77228914 CCTGACAAGGGGGCAGGGGTGGG + Intronic
1120145755 14:80976655-80976677 CCTGATCAGGAGGAAGAAGCAGG - Intronic
1120319808 14:82945123-82945145 GCTGAGAAGGAGGAAGAGAAGGG + Intergenic
1120403189 14:84059257-84059279 GATGAGAAGGAGGAAGGCGAGGG - Intergenic
1120459569 14:84777571-84777593 CCTGAGCAGGAGGAAGAGTTGGG + Intergenic
1120673984 14:87397476-87397498 AATTAGAAGGAGGAAGGGGGAGG - Intergenic
1120689388 14:87575917-87575939 CATGAGATGGAGGAAGTGCCTGG + Intergenic
1120826711 14:88962690-88962712 GCTGGGAAGACGGAAGGGGCTGG + Intergenic
1121489339 14:94346605-94346627 CCTGAGCTGGAAGAAAGGGCTGG + Intergenic
1121690878 14:95876515-95876537 GCGGGAAAGGAGGAAGGGGCTGG - Intergenic
1122056576 14:99102469-99102491 CCAGAGCAGGAGGAAGAGGGAGG - Intergenic
1122110878 14:99501177-99501199 CATGAGGAGGAAGAAGGGGTAGG + Exonic
1122353805 14:101111958-101111980 TCGGCGAAGGAGGAAGGGGAAGG - Intergenic
1122373362 14:101241934-101241956 TCCGAGAAGGTGGCAGGGGCTGG - Intergenic
1122601319 14:102923246-102923268 TATGAGAAGTAAGAAGGGGCTGG - Intronic
1122832054 14:104403182-104403204 CCAGAGAAGGAGGAAGGGTGGGG - Intergenic
1123416071 15:20096335-20096357 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1123525411 15:21103444-21103466 CCTGAGAAGGAGGATCTGGATGG - Intergenic
1124022002 15:25933729-25933751 CCTGAGATGGGGCAGGGGGCGGG - Intergenic
1124138220 15:27053963-27053985 CTTCAAAAGGAGGGAGGGGCCGG + Intronic
1124395950 15:29301827-29301849 CCTCACATGGTGGAAGGGGCTGG - Intronic
1124492345 15:30165758-30165780 CCAGAGCAGGAGGAAGAGGCAGG - Intergenic
1124751191 15:32372559-32372581 CCAGAGCAGGAGGAAGAGGCAGG + Intergenic
1124781303 15:32637751-32637773 CATCAGAAAGAGGAAGGGCCTGG + Exonic
1124843068 15:33262980-33263002 TCTGAGAGTGAGGATGGGGCAGG - Intergenic
1125720673 15:41843733-41843755 CCTGAGCAGGAGGAAGCAGGTGG + Exonic
1125758432 15:42081535-42081557 CCTGAGCAGGAGGAAGCAGGTGG - Exonic
1126400518 15:48264208-48264230 CCTGTAAAGGAGGAAAGGGATGG + Intronic
1126736049 15:51733195-51733217 GCTGAGAAGGAGGTAAGGGAGGG - Intronic
1127666901 15:61156606-61156628 TCTGAGAAGGAGGAAAGTTCTGG + Intronic
1127905254 15:63371523-63371545 CCTGAACAGGATGGAGGGGCTGG + Intronic
1127985848 15:64069837-64069859 CCTTTGGAGGAGGAAGGGGCAGG - Intronic
1128053260 15:64681865-64681887 CCTGAGGAAGAGGTAGGGTCAGG - Exonic
1128073702 15:64813013-64813035 CCTGCGGAAGGGGAAGGGGCTGG + Intergenic
1128092360 15:64927498-64927520 TCTGAGAAGGGGTAAGGGACGGG + Intronic
1128094482 15:64943656-64943678 CCTGAGAAGGAGGAGGGAGGGGG - Intronic
1128219885 15:65961634-65961656 CCTGGGAAGGAAGAAGTGGCTGG - Intronic
1128582505 15:68819379-68819401 CCTGAGGAGGGGGAAGGTGAGGG - Intronic
1128614618 15:69099439-69099461 CCTGTGAAGGGGGATGGGGGTGG + Intergenic
1129193418 15:73951003-73951025 CCTGAGGAGCAGGAATGTGCTGG - Intronic
1129327552 15:74809133-74809155 CTGGAGGAGGATGAAGGGGCTGG + Intergenic
1129513651 15:76143141-76143163 CCTGAGAAGGCGGGAGGGGAAGG - Intronic
1129718523 15:77865375-77865397 CCTTAGATGGTGGAAGGGTCTGG + Intergenic
1129889979 15:79065537-79065559 CATTGGCAGGAGGAAGGGGCAGG + Intronic
1130402977 15:83574349-83574371 CCTGAGATGGAAGAAGAGGATGG - Intronic
1131077849 15:89507287-89507309 ACGGAGAAGGAGGAAGAGGAGGG - Intergenic
1132056293 15:98651860-98651882 TCAGAGATGGAGGGAGGGGCAGG - Intronic
1132354177 15:101159203-101159225 CTTGAGACAGGGGAAGGGGCTGG - Intergenic
1132481790 16:169951-169973 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132482658 16:174208-174230 GTGGGGAAGGAGGAAGGGGCTGG + Intergenic
1132686983 16:1166361-1166383 GCTGAGAGGAAGGCAGGGGCCGG - Intronic
1132847294 16:2006467-2006489 CCTGAGGGTGAGGAGGGGGCTGG + Intronic
1133005974 16:2882291-2882313 CGTGAGAAGGCGGAAGGTGCGGG + Intergenic
1133102222 16:3486400-3486422 CCTGAGGAGGAGGGAGAGGGAGG + Exonic
1133231621 16:4369707-4369729 CCTGAGCGGGAGGGATGGGCTGG - Intronic
1133237307 16:4393216-4393238 CCTGAGAAAGTGAAGGGGGCCGG + Intronic
1133729857 16:8569781-8569803 CCTGAGACGGAGGCAGGACCAGG - Exonic
1134038684 16:11051450-11051472 ACTTGGAAGGAGGAAGGGGCCGG - Intronic
1134048894 16:11123196-11123218 CCTGAGAAAGGGACAGGGGCTGG - Intronic
1134398663 16:13889078-13889100 CCGGAGAAGGAGAAAGGGGAGGG - Intergenic
1134562013 16:15219040-15219062 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1134922551 16:18130666-18130688 CCTGAGGAGGGGGAAGTGGGTGG - Intergenic
1134997472 16:18750948-18750970 GCTGAGAAGTGGGCAGGGGCCGG + Intergenic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135748475 16:25037360-25037382 CTTGAGAATGAAGAAGGGGTGGG - Intergenic
1135986050 16:27185129-27185151 CCAGAGCAGGAGGAAGCGGCAGG + Intergenic
1136381343 16:29897273-29897295 CCTTGGGAGGAGGTAGGGGCTGG - Intronic
1136511304 16:30739572-30739594 GGTGAGGAGGAGGAAGGGGATGG + Exonic
1136539822 16:30923197-30923219 CCTGGGAAGGAGGTCGGGTCGGG + Intronic
1136545292 16:30950928-30950950 TCTCTGCAGGAGGAAGGGGCTGG + Intronic
1137668432 16:50265632-50265654 GCTGTGATGGAGGAAGGTGCAGG + Intronic
1138028692 16:53542104-53542126 TGTGTGAAGGTGGAAGGGGCAGG - Intergenic
1138198987 16:55075048-55075070 CCGGTGAAGGAGCAAGGGGTTGG + Intergenic
1138212237 16:55173304-55173326 CCTGTGAAGGGGGAAGGAGTGGG + Intergenic
1138694352 16:58797866-58797888 CCTCATATGGTGGAAGGGGCAGG + Intergenic
1139322159 16:66123614-66123636 GTTGAGAGGGAGGAAGGGGAGGG + Intergenic
1139469815 16:67172101-67172123 CCAGAGAAGGAGGCAGAGGAGGG + Intronic
1139500538 16:67360718-67360740 CCTCAGATGGATGGAGGGGCTGG + Intronic
1139531338 16:67544133-67544155 TTCCAGAAGGAGGAAGGGGCTGG - Intronic
1139915930 16:70428533-70428555 CCTAGCAGGGAGGAAGGGGCAGG - Intronic
1139923868 16:70475128-70475150 CCTGAAGGGAAGGAAGGGGCTGG + Intronic
1139956795 16:70697082-70697104 TCTGAGGGGCAGGAAGGGGCCGG - Intronic
1140343072 16:74184464-74184486 CCTGGGGAGGAGGCAGAGGCAGG + Intergenic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1141381094 16:83577651-83577673 GCTGAGGAGGAGAAAGGGGTAGG + Intronic
1141382886 16:83591606-83591628 TCAGAGAAGGAAGAAGGGCCTGG - Intronic
1141489643 16:84363484-84363506 CATGAGAAGCTGGAAGAGGCAGG - Intergenic
1141876047 16:86825255-86825277 CCTGAGAGTGAGGGAGGGGCGGG - Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1141928005 16:87181904-87181926 CCTGTGAAGGGGGCCGGGGCCGG + Intronic
1142303801 16:89274502-89274524 CGTGAGAGGTAGGTAGGGGCAGG + Intronic
1142329201 16:89440130-89440152 CTGGAGAAGTAGGAAGAGGCAGG - Intronic
1142527856 17:557253-557275 CGTGAGAAGGAGGCAGAGGCTGG - Intronic
1142637350 17:1266318-1266340 CTTGAGCAGAAGGAAGAGGCAGG + Intergenic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142885034 17:2907250-2907272 ACTGAGAATGAGGGAGGGGTAGG + Intronic
1142966562 17:3585547-3585569 ACTGAGAAGCGGGAAGGGGGCGG + Intronic
1143098140 17:4489448-4489470 CCTGAGAAGGAGGCAGCAACTGG + Intergenic
1143391314 17:6560892-6560914 GATGAGAAGGAGGAAGAGGAGGG - Intergenic
1143465127 17:7131390-7131412 CCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1143565313 17:7717255-7717277 ACTAAGAAGGGGGAAGGAGCAGG + Intergenic
1143770454 17:9165216-9165238 CCAGAGAGGCAAGAAGGGGCAGG + Intronic
1143836326 17:9695772-9695794 ACTGAGGAAGAGGAAGGGGAGGG - Intronic
1144353535 17:14422588-14422610 CCTGCGAAGGAGAAAGGAGATGG - Intergenic
1144409297 17:14985002-14985024 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1144816815 17:18040363-18040385 CCTGGAACTGAGGAAGGGGCAGG - Intronic
1144889209 17:18484456-18484478 CTTGGGAGGGAGGAAGGGGTGGG - Intronic
1145142999 17:20459840-20459862 CTTGGGAGGGAGGAAGGGGTGGG + Intronic
1145252632 17:21304816-21304838 CCTGACAATGAGGGCGGGGCGGG - Intronic
1145323933 17:21783093-21783115 CCTGACAATGAGGGCGGGGCGGG + Intergenic
1145779192 17:27550825-27550847 CTTGAGAAGGAGGATGGGGAGGG + Intronic
1145837529 17:27965862-27965884 CCTCACATGGTGGAAGGGGCAGG + Intergenic
1145904576 17:28509190-28509212 ACAGAGAGGGAGGGAGGGGCAGG - Intronic
1145973074 17:28968313-28968335 GCTGAGAAGGAGGCAGGACCAGG + Intronic
1146185144 17:30719800-30719822 GCTGAGCTGGAGGATGGGGCAGG + Intergenic
1146575462 17:33987274-33987296 CCTAAGAGGGAAGAAGGAGCTGG - Intronic
1147042789 17:37731177-37731199 CCAGAGATGGAGGAGGTGGCCGG + Intronic
1147673618 17:42190757-42190779 CCTGAAGAGGAGGAAGGGAGAGG + Exonic
1147710917 17:42463991-42464013 GCTGAGGAGGAGGAAGGGGAGGG + Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1147992491 17:44343688-44343710 GCTGAGGATGAGGCAGGGGCAGG - Intergenic
1148196188 17:45715086-45715108 CCAGAGCAGGGGCAAGGGGCAGG + Intergenic
1148200225 17:45745387-45745409 GCTGAGAAGGATGAAGCGGTAGG + Intergenic
1148209612 17:45800315-45800337 CCTGAGAAGGCAGAAGGACCTGG + Intronic
1148444211 17:47727798-47727820 CCAGAGAGGGGGGAAGGGGAGGG - Intergenic
1148539861 17:48471939-48471961 CCAGAGGTGGAGGAGGGGGCTGG - Intergenic
1148761187 17:50001480-50001502 CCTGAGTAGGTGGGAGGGGAAGG + Intergenic
1148771754 17:50071432-50071454 CCTGCGGAGGAGGCAGGTGCTGG + Exonic
1148778428 17:50108736-50108758 CCTCAGGAGGTGGGAGGGGCTGG - Intronic
1148784757 17:50140618-50140640 CCTGAGCTTCAGGAAGGGGCGGG + Intronic
1148787431 17:50152161-50152183 CCTGAGATGCAGGAAGCAGCTGG - Intergenic
1148806921 17:50268588-50268610 CCCAAGAATGAGAAAGGGGCTGG + Intergenic
1148844979 17:50524547-50524569 CCAGATTAGGAAGAAGGGGCAGG - Intronic
1148856234 17:50580613-50580635 CCTGAGCAAGAAGAAGGTGCAGG - Intronic
1148980924 17:51574302-51574324 GGTGAGAAGGAGGAAGGGAAAGG + Intergenic
1149247414 17:54727291-54727313 CCTGAAAAGGAGGAAGAGAAAGG - Intergenic
1149310254 17:55386328-55386350 CTGGAGAGGGAGGAAGAGGCGGG - Intergenic
1149455025 17:56780740-56780762 GCTGAGAGGAAGGAAGGGGGTGG + Intergenic
1149596666 17:57868342-57868364 CCGGAGAGGGAGCAGGGGGCAGG + Intronic
1149852754 17:60050200-60050222 CCTCAGGTGGTGGAAGGGGCAGG - Intronic
1149994006 17:61397398-61397420 CCTGGGAAGGGGGAGGGGGCCGG + Intergenic
1151215218 17:72572354-72572376 CCTGAGCCAGAGGAAGAGGCTGG - Intergenic
1151242713 17:72770589-72770611 CCTGAGAAGGACCAAGGGGAGGG - Intronic
1151326727 17:73384202-73384224 CCCTAGAAGGAGGGAAGGGCAGG + Intronic
1151527287 17:74679406-74679428 CCAGAGAAGGAGGAAGGATCTGG - Intronic
1151615170 17:75205422-75205444 CCGGAGACGGCGGGAGGGGCAGG - Intergenic
1151801359 17:76381808-76381830 CCTGAGGAGGAGGAAGCAGCAGG - Intronic
1152029342 17:77832003-77832025 CCTGAGAACGAGGCGGGGGCAGG - Intergenic
1152183418 17:78839932-78839954 CTTTAGAAGGAGGAGGGAGCGGG - Intronic
1152227386 17:79098742-79098764 ACTGAGGAGGGGTAAGGGGCTGG - Intronic
1152236536 17:79141965-79141987 CCTGAGAAAGAGGAGGAGACGGG + Intronic
1152297532 17:79476839-79476861 ACAGAGAAGGAGGAAGAGGAGGG + Intronic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1152552056 17:81034939-81034961 CCGGAGAAGGGGGAGGGGGGCGG - Intergenic
1152558725 17:81067367-81067389 CCTGAGCAGGGGAAGGGGGCGGG + Intronic
1152587230 17:81194502-81194524 CCACAGGAGGAGGCAGGGGCAGG - Intronic
1152676727 17:81645148-81645170 CCTGGGGAGAGGGAAGGGGCTGG - Exonic
1152699858 17:81813452-81813474 CCTGGGGAGGGGGACGGGGCAGG - Exonic
1152732540 17:81979425-81979447 CATGAGAAGCTGGAAGAGGCAGG - Intronic
1152754185 17:82080258-82080280 GCTGAGCAGATGGAAGGGGCGGG + Intronic
1152868040 17:82735823-82735845 CCTGGGAAGGCGGAGGGGTCGGG + Intronic
1153000423 18:450449-450471 CCAGAGCAGGAGGAAGGTGGGGG - Intronic
1153501010 18:5750077-5750099 CCTGAGAATGATGAAGATGCTGG + Intergenic
1153680643 18:7497352-7497374 GAGGAGAAGGAGGAAGGGGGAGG + Intergenic
1154025733 18:10705657-10705679 GCTGAGCAGGAGGAGGAGGCAGG - Exonic
1154373158 18:13784762-13784784 GCTGAGGAGGAGGAAGTGGAGGG - Intergenic
1155109305 18:22698027-22698049 CCTGTGAAGGATAAAGGGGAGGG - Intergenic
1155294324 18:24371508-24371530 CCTGAGAAGCAGGAAGGGATGGG - Intronic
1155350477 18:24901061-24901083 CCAGAGAAGTTGGAAGGGTCAGG - Intergenic
1156266134 18:35490081-35490103 CCTGAGAAGGAAGGTGGAGCTGG + Intronic
1156502247 18:37567047-37567069 CCGGAGGGGGAGGAAGGCGCTGG + Intergenic
1157118140 18:44881736-44881758 TTTGAGATGGAGGCAGGGGCAGG + Intronic
1157235439 18:45961009-45961031 CCTGAGAAGGAGAAAGCTGTGGG - Intronic
1157281871 18:46351567-46351589 CCTGCTTAGCAGGAAGGGGCTGG - Intronic
1157301482 18:46482913-46482935 GCTGAGAAGGAGCCAGGGGAGGG - Intronic
1157445520 18:47743760-47743782 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
1157511728 18:48280182-48280204 TCAGAGAAGGAGGAGTGGGCAGG + Intronic
1157583649 18:48787639-48787661 CCTGAGAAGGAAGAAGAGGCAGG + Intronic
1157836394 18:50907230-50907252 CCAGGGCAGGAAGAAGGGGCTGG - Intronic
1157880162 18:51313806-51313828 CCTGATAAGGATGGAGGGCCTGG - Intergenic
1158123438 18:54076025-54076047 CCTGAGAAAGAGGGAGGAGATGG - Intergenic
1158220544 18:55146262-55146284 CCTGGGGAGGAGGTGGGGGCTGG - Intergenic
1158488975 18:57893172-57893194 TCTGGGAAGGAGCAAGGGGCTGG + Intergenic
1158517671 18:58144347-58144369 CCAGAGCAGGAGCAAGGGGTTGG + Intronic
1158803123 18:60936803-60936825 CTGGAGCAGGAGGAAGAGGCAGG + Intergenic
1158907101 18:62024370-62024392 CATGAGAACAGGGAAGGGGCTGG - Intergenic
1159031451 18:63236700-63236722 GCCGAAGAGGAGGAAGGGGCCGG + Intronic
1159100107 18:63949231-63949253 CCTGGGCAGGAGGGCGGGGCGGG - Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1159900376 18:74039484-74039506 CAGGAGCAGGAGGAAGGGGGAGG - Intergenic
1159931400 18:74316024-74316046 CCTCAGGGGGAGGAAAGGGCGGG - Exonic
1160190793 18:76712618-76712640 TCTGAGAAGGAGCAGGGAGCGGG - Intergenic
1160191346 18:76716761-76716783 TCTGAGAAGGAGCAGGGAGCTGG - Intergenic
1160222494 18:76987488-76987510 GAAGAGAGGGAGGAAGGGGCAGG - Intronic
1160422522 18:78756763-78756785 CCAGAGAAAAAGGAAGGGGCGGG + Intergenic
1160495972 18:79375634-79375656 CCTGAGTGAGGGGAAGGGGCCGG + Intronic
1160657929 19:282809-282831 CCTGAGGAAGGAGAAGGGGCAGG + Exonic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1160836771 19:1128287-1128309 CCTGTGCCGGAGGCAGGGGCGGG + Intronic
1160949726 19:1659690-1659712 CCTGAAAAGGACAAGGGGGCTGG - Intergenic
1161188256 19:2937652-2937674 CCTGCGAAGGAGGACAGTGCAGG + Intronic
1161436537 19:4267040-4267062 CTTGAGAAAGAGTTAGGGGCAGG - Intronic
1161440042 19:4285841-4285863 GAAGAGAAGGAGGAAGGGCCGGG - Intronic
1161806133 19:6444122-6444144 CCTGGGCGGGAGGATGGGGCAGG - Intronic
1161965573 19:7546108-7546130 CCTAAGAAGGAAGGAGGGGGAGG + Intronic
1162113469 19:8413752-8413774 TCTGAGAAGGAGGTTGGGGAAGG - Intronic
1162646414 19:12053246-12053268 CCCGTGTAGGATGAAGGGGCAGG - Intergenic
1162973634 19:14195889-14195911 ACTGAGCTGGAGGATGGGGCAGG - Intronic
1163029849 19:14537085-14537107 CCTGAGGAGGAGGAGGGGGCAGG + Intronic
1163144963 19:15373824-15373846 CCAAGGAAGGAGGCAGGGGCGGG - Exonic
1163163912 19:15482321-15482343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1163204905 19:15795213-15795235 GCAGAGAAGAAGGAAGGGGGAGG - Intergenic
1163252668 19:16135534-16135556 CCAGAGAAAGAGGAAGGAGTAGG - Intronic
1163282992 19:16328405-16328427 CCTGAGAATGGGGAAGGTGAGGG - Intergenic
1163296440 19:16415844-16415866 CCTGAGAATCAGGACCGGGCAGG - Intronic
1163430166 19:17262694-17262716 CTTGGGAAGCAGGAAGGGGCAGG - Exonic
1163999280 19:21082371-21082393 CCCGAGAGAGGGGAAGGGGCGGG + Intronic
1164017995 19:21269729-21269751 CCTGAGAGAGCGGAAGGGGCTGG - Intronic
1164162192 19:22634497-22634519 CCCGAGAGAGGGGAAGGGGCTGG + Intronic
1164226439 19:23250195-23250217 CCGGAGAGAGAGGGAGGGGCTGG - Intronic
1164506539 19:28865873-28865895 TCTGGGAAGGAGTAGGGGGCAGG + Intergenic
1164645212 19:29854295-29854317 ACTCAGAAGGAGGAAGAGGGTGG + Intergenic
1164649895 19:29884195-29884217 GGAGAGAAGGAGGAAGGGGAGGG - Intergenic
1164823221 19:31265853-31265875 GCTGAGAAGGGTGGAGGGGCAGG + Intergenic
1164871437 19:31647579-31647601 CCAGAGCAGGAGGAAGAGGGTGG + Intergenic
1165258155 19:34592434-34592456 CCTGAGCAGGAGGGAGGGACAGG + Intergenic
1165369897 19:35398579-35398601 CGTGGGAATGAGGCAGGGGCAGG - Intergenic
1165396335 19:35565753-35565775 CATTAGAAGGAGGACTGGGCCGG + Intergenic
1165829441 19:38723266-38723288 CCTGAGGAGGGGTAGGGGGCAGG - Intronic
1165892873 19:39125491-39125513 CCCCAGAAGGAGTTAGGGGCTGG - Intergenic
1166193802 19:41193530-41193552 CCTAGGGAGGAGGCAGGGGCAGG + Intronic
1166374189 19:42317903-42317925 CCCGAGAGGGAGGCAGGGACAGG - Intronic
1167425426 19:49427635-49427657 CCTGAGTCTGAGGGAGGGGCTGG + Intronic
1167453000 19:49583401-49583423 GGTCTGAAGGAGGAAGGGGCTGG - Intronic
1167628397 19:50607519-50607541 ACTGAGAAAGAGGATGGGGACGG - Intergenic
1167664384 19:50815313-50815335 GCTGAGAATGGGGAATGGGCAGG + Intergenic
1167685704 19:50954759-50954781 ACAGGGAAGGAGGAAGGGGTGGG - Intergenic
1167756815 19:51417847-51417869 CCTGTGTAGGAGGAGAGGGCAGG + Intergenic
1168107057 19:54172083-54172105 CCTGGGGAGGAGCAGGGGGCTGG + Exonic
1168382532 19:55936197-55936219 CCTGAAAAGGAGGAATGAGGAGG + Intergenic
1168503580 19:56914186-56914208 GCGGAGAAGGAGGAAGAGGAGGG + Intergenic
1168677157 19:58286881-58286903 GCAGAGAGGGAGGAAGGGGTGGG - Intronic
1168705946 19:58470373-58470395 CCTGAGAAGGGGGACAGGGGCGG + Intronic
925128724 2:1479425-1479447 CCTGAGGAGACAGAAGGGGCAGG - Intronic
925295624 2:2774638-2774660 CATGATAAGGTGGATGGGGCTGG + Intergenic
925347317 2:3179992-3180014 CCGGGGAAGGAGGAAGAGACAGG - Intergenic
925350054 2:3194717-3194739 CCATGGAAGCAGGAAGGGGCCGG + Intronic
925425913 2:3748477-3748499 CCTGACAAGGGGGAAGTGGGAGG + Intronic
925481269 2:4277002-4277024 CCTGAGCAGGAGGAGGGAGCGGG - Intergenic
926280850 2:11444585-11444607 CCTGAGAAGGAATAATGGGGCGG - Exonic
926696208 2:15771509-15771531 GAAGGGAAGGAGGAAGGGGCCGG - Intergenic
927446180 2:23163954-23163976 CCTGAGGAGTAGGAAGAGGGGGG - Intergenic
927561649 2:24077563-24077585 CCAGTGAAGGAGGATGGGGCAGG - Exonic
927696069 2:25240606-25240628 GCTGAGAAGGTGGAGGGGACAGG + Intronic
927874914 2:26648799-26648821 CCAGAGCAGGAATAAGGGGCTGG - Intergenic
928093095 2:28388252-28388274 CCAGAGAAGGAGGTAGGAGGTGG + Intergenic
928148376 2:28804052-28804074 CCTGAGAAGGAGGATGTGCAGGG + Intronic
928404821 2:31006645-31006667 CCTGGGAAGGATGAAGGAGGAGG + Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929161422 2:38836321-38836343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
929174440 2:38961962-38961984 CCAGAGGAACAGGAAGGGGCGGG + Intronic
929431740 2:41893198-41893220 CCGGGGAGGGAGGAAGGGGAAGG - Intergenic
929461844 2:42107863-42107885 CTTGAGTAGGTGAAAGGGGCAGG - Intergenic
929474082 2:42227686-42227708 GCAGAGGAGGAGGAAGGGGGCGG - Intronic
930632552 2:53769544-53769566 CTTTAAAAGGAGAAAGGGGCTGG + Intronic
931129797 2:59322290-59322312 CCTGTGAAAGAGGATGGGCCAGG - Intergenic
931259548 2:60605250-60605272 CCATAGGAGGAGGAGGGGGCTGG - Intergenic
931529399 2:63197148-63197170 GCTGAGAAGGAGGAAGAGGAGGG - Intronic
931627453 2:64269832-64269854 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
932024127 2:68116513-68116535 CGTCAGCAGGAGGCAGGGGCTGG + Intergenic
932082888 2:68731615-68731637 CCTAAGAAGGATGAAAGGGGTGG - Intronic
932429568 2:71666038-71666060 AATGAGAAGGAGGAGGGGGTGGG - Intronic
932493075 2:72133744-72133766 CCTGCGATGGAGGAAGGGGCTGG - Intronic
933850720 2:86364548-86364570 CCAGAGCAGGAGCAAGGGGGTGG + Intergenic
934026175 2:88003268-88003290 CCTGAGGAGGAGGCACGGGGAGG - Intergenic
934574769 2:95392925-95392947 CAGGATGAGGAGGAAGGGGCTGG + Intergenic
934843320 2:97645494-97645516 CCTGGGGAGGAGGACAGGGCCGG - Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
934990145 2:98914882-98914904 CCTGAGAGAGAAGAAGGGGAAGG + Intronic
935090422 2:99890568-99890590 CCGGAGCAGGAGGAAGAAGCGGG + Intronic
935123244 2:100200008-100200030 CCAGAGCAGGAGGAAGAGGGAGG - Intergenic
935524426 2:104148032-104148054 CCTCACATGGTGGAAGGGGCTGG - Intergenic
935997441 2:108789017-108789039 ACTGAGAAAGAGAAAAGGGCAGG + Intronic
936028582 2:109053384-109053406 CCTGAGAGAGAGGAATGGCCTGG + Intergenic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
937114765 2:119397283-119397305 CCTGAGGAGGAGGAACAGGCTGG + Intergenic
937141056 2:119600818-119600840 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
937344110 2:121112823-121112845 CCTGAGCTGGGGGATGGGGCAGG - Intergenic
938424657 2:131174971-131174993 CCTGAGAAGAAGGAGAGAGCTGG + Intronic
938645385 2:133325151-133325173 CCTGGGAGGGAGGAAGGCACTGG + Intronic
938981206 2:136528957-136528979 CTTGAGAAATAGGCAGGGGCAGG - Intergenic
938985558 2:136571982-136572004 CTGGAAAGGGAGGAAGGGGCCGG - Intergenic
939018676 2:136932701-136932723 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
939853363 2:147326637-147326659 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
939875494 2:147572869-147572891 TCTGAGAAGGTGGAAAGGGATGG - Intergenic
940143400 2:150520962-150520984 TCAGAGCAGGAGGAAGGAGCTGG - Intronic
940599116 2:155835141-155835163 CCTGCAAAAGAGGAAGGGGAGGG + Intergenic
940750408 2:157621351-157621373 CCTGAGAAGGAGCAAAGTGTTGG + Intronic
941104819 2:161340914-161340936 CCTGAGGAGGAGGACGGAGAAGG - Intronic
941144342 2:161824930-161824952 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
941293900 2:163711926-163711948 CCAGAGAGCGAGGGAGGGGCAGG - Intronic
941432301 2:165427079-165427101 CCTGGGAAGGAGGTGGGGGATGG + Intergenic
941905378 2:170713928-170713950 GCGGGGAAGGAGGAAGAGGCGGG - Exonic
942199450 2:173556365-173556387 CAGGAGGAGGAGGAAGGGGGAGG - Intergenic
942271645 2:174281592-174281614 TCTGAGAATGAGGAATGGGGTGG + Intergenic
942350780 2:175050699-175050721 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
942448364 2:176092957-176092979 GATGAGGAGGAGGAAGAGGCCGG - Exonic
943363402 2:186947144-186947166 CTAGAGAATGATGAAGGGGCTGG - Intergenic
944320779 2:198339442-198339464 CCTGAAAAGGAGGCAAGGGGAGG + Intronic
944389856 2:199206770-199206792 CCTGAGCAGGCGGCAGGTGCTGG - Intergenic
944414972 2:199471309-199471331 CCTGGGAAGGAGCCAGGGGTAGG - Intergenic
944483699 2:200182003-200182025 TCTTGGAAGGGGGAAGGGGCAGG - Intergenic
944553932 2:200869537-200869559 CCAAAAAAGGAGGAAGGGGCAGG + Intergenic
944783738 2:203046662-203046684 CCTCACACAGAGGAAGGGGCAGG + Intronic
945109896 2:206352454-206352476 CGAGAGGAGGAGGAAGGGGAAGG - Intergenic
946084413 2:217156600-217156622 CCTATGAAGAAGGAAGGGACTGG - Intergenic
946325091 2:218980958-218980980 CCCGAGAAGGAGGGTGGCGCGGG - Intergenic
946416868 2:219544124-219544146 CCTGAGGAAGGGGAAGGCGCAGG - Exonic
946587923 2:221211186-221211208 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
946762412 2:223007647-223007669 CCTGAAAAGCTGGTAGGGGCTGG - Intergenic
947210241 2:227701707-227701729 CCAGAGAAGGAGGCAAGGGCTGG + Intronic
947373765 2:229474790-229474812 CCTGAGAAGGAGCAAGGTGGTGG - Intronic
947650696 2:231784117-231784139 ACTGAGAAGGGGGAGGGGGTGGG + Intronic
947660206 2:231860877-231860899 CTTGACAAGAACGAAGGGGCAGG - Intergenic
947794478 2:232885415-232885437 ACCGAGCTGGAGGAAGGGGCCGG - Intronic
947895732 2:233670242-233670264 GCTGAGAAGGAGGAAGAGGTGGG + Intronic
948003549 2:234589101-234589123 TGGGAGCAGGAGGAAGGGGCAGG + Intergenic
948212259 2:236203496-236203518 CCTGAGAAGGAGGCTGGCACAGG + Intronic
948213302 2:236210798-236210820 CCTGTGAAGGAGGCAGTGGAGGG + Intronic
948296282 2:236863050-236863072 CCTGAGAAGAAGGCAGGGCAGGG - Intergenic
948308032 2:236964250-236964272 CCTGAAGGGGAGGAAGGTGCTGG - Intergenic
948317703 2:237041656-237041678 CCTCACATGGTGGAAGGGGCAGG + Intergenic
948705903 2:239792356-239792378 CCTGGGAAGGCAGAAGGGGCTGG - Intronic
948773764 2:240269410-240269432 CCTGACCAGGAGCAAGGAGCTGG - Intergenic
1168910322 20:1441913-1441935 TGTGAGAAGGAGGTAGGGGGAGG + Intergenic
1169276529 20:4236851-4236873 CTCTAGAAGGTGGAAGGGGCCGG + Intronic
1169586496 20:7091542-7091564 CCTCAGAAGGTGGAATGGACAGG - Intergenic
1169677669 20:8172831-8172853 CCAGAGAAGCAGCATGGGGCAGG + Intronic
1170705276 20:18738745-18738767 GCAGGGAGGGAGGAAGGGGCTGG + Intronic
1171017253 20:21553184-21553206 CCTGAGAGGGATGGAGGGGGAGG - Intergenic
1171173207 20:23033788-23033810 CCTGAGAAAGAGGAAGGAGATGG - Intergenic
1171284629 20:23926755-23926777 CAAGAGCAGGAGGTAGGGGCTGG - Intergenic
1172044554 20:32071226-32071248 CCTGAGAGGTGGGTAGGGGCAGG + Intronic
1172106749 20:32521720-32521742 CCAGAGCAAGAGGAAAGGGCTGG - Intronic
1172199939 20:33118331-33118353 CCAGGGAAGGAGGAAGAGACTGG + Intergenic
1172231209 20:33337498-33337520 GCTGAGGAGGAGGACGGGGGAGG + Intergenic
1172598243 20:36165400-36165422 GCTCAGAAAGAGGAAGTGGCTGG + Intronic
1172635610 20:36407829-36407851 CCGCAGAAGTAGGCAGGGGCAGG + Intronic
1172654499 20:36528580-36528602 CCTGTGAGGTAGGGAGGGGCAGG - Exonic
1173186611 20:40845063-40845085 CCTTTGAAGGGAGAAGGGGCTGG - Intergenic
1173225823 20:41161940-41161962 CATGAGAGGGAGGAAGGAGGAGG - Intronic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173570323 20:44071635-44071657 CCCAAGAAGGAGGAAGGCCCTGG - Intergenic
1173823816 20:46034926-46034948 CCTGAGAAGGGAGAGGGGTCAGG - Exonic
1173909740 20:46657811-46657833 CCAGAGCAGGAGCAAGGCGCTGG + Intronic
1174107442 20:48172570-48172592 CCAGAGAGGGAGGGAGGAGCTGG + Intergenic
1174143628 20:48434907-48434929 CTTGGGAAGGAGGATGGGGTTGG - Intergenic
1174218019 20:48932115-48932137 CCTGAGAAGGCGGATAGGGATGG + Intronic
1174517621 20:51104794-51104816 CCTGTGACGGGGGAGGGGGCTGG + Intergenic
1174872535 20:54196350-54196372 ACTGATAGGGAGGAAGGGGAGGG + Intergenic
1174962380 20:55173069-55173091 ACTGATAAGTAAGAAGGGGCAGG - Intergenic
1175133702 20:56807807-56807829 AATGAGTAGGAGGAAGGGACAGG - Intergenic
1175192986 20:57223980-57224002 CCTGAGAAGGTAGGTGGGGCTGG - Intronic
1175522593 20:59611692-59611714 CCGGAGAGGGAGGCAGGGGTAGG - Intronic
1175740818 20:61418732-61418754 CCTGAGATGGAGGTATGGACAGG + Intronic
1175887178 20:62298815-62298837 CCTGAAAAGCACGAAGGTGCTGG - Intergenic
1175898986 20:62352640-62352662 CCTGAGAATGGGGGAGGGGCGGG - Intronic
1176090536 20:63316482-63316504 CAGGGGAGGGAGGAAGGGGCAGG - Intronic
1176140873 20:63544523-63544545 GCTGAGCAGGAGGATGAGGCCGG - Intronic
1176264229 20:64200396-64200418 CCTGAGAAGCAGGAAGGAAACGG - Intronic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176674052 21:9760643-9760665 CCTTAGTAGGAGGAAGGAGGGGG - Intergenic
1177121700 21:17145079-17145101 CCTGAGAATCAGGAATGGACAGG + Intergenic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178371232 21:32029128-32029150 GCTGAGAAGGAGGAAGAGCAGGG - Intronic
1178600247 21:33988386-33988408 CTGGAGCAGGAGGAAGGTGCAGG + Intergenic
1178972245 21:37190428-37190450 CTTGAAAATGAAGAAGGGGCCGG - Intronic
1179106859 21:38408805-38408827 CATGTGTAGGAGGAAGGGGAGGG + Intronic
1179388101 21:40961079-40961101 CCTGAGATGGAGGAATGGGGTGG + Intergenic
1179492310 21:41748758-41748780 CTTGAGCAGGAGGAAGGGCGAGG + Intronic
1179550259 21:42139336-42139358 CTGGAGCAGGAGGAAGGGGTTGG + Intronic
1179580967 21:42343689-42343711 CCAAAGGAGGAGGAAGGGGGTGG + Intergenic
1179802143 21:43816180-43816202 CAGGAGAGGGAGGCAGGGGCCGG - Intergenic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1179897027 21:44368939-44368961 CCTGAGGAGGCGGCAGGGACCGG + Intronic
1179997431 21:44980468-44980490 CCTGAGAAGAAGGGGAGGGCCGG - Intergenic
1180197984 21:46208766-46208788 CCTGGGCAGGAGGCAGGAGCAGG + Intronic
1180465811 22:15609080-15609102 CCTGAGAAGAAGGAGCGAGCTGG + Intergenic
1180747719 22:18102676-18102698 CATGATAAAGATGAAGGGGCTGG - Exonic
1180751875 22:18130365-18130387 CTAGAGAAGGAGGACAGGGCTGG - Intronic
1181275467 22:21685110-21685132 TCTGAGAAGGCAGAAGGGGAGGG + Intronic
1181425320 22:22833686-22833708 TCTGAGAGGGAGGTGGGGGCAGG + Intronic
1181652875 22:24270692-24270714 CCGGAGATGGGGGAAGGGGAGGG + Intergenic
1181802775 22:25358256-25358278 TCTGTGAAAGAGGAAGGGACGGG - Intronic
1182082446 22:27538893-27538915 ACAGGGAAGGAGGAAGGGGGAGG - Intergenic
1182172152 22:28242211-28242233 CATTAGAAGGAGTAAAGGGCCGG - Intronic
1182270438 22:29149888-29149910 CCTGTGAAGGGGAACGGGGCTGG + Intronic
1182345863 22:29664308-29664330 CCTGAGAGGGAGGAAGGGGTGGG - Intronic
1182352448 22:29706518-29706540 GCAGAGAAGGAGGAAGAGGGAGG + Intergenic
1182543619 22:31059665-31059687 CCTGAGAAGGAGGATCTGGATGG + Intergenic
1182586807 22:31348083-31348105 ACAGAGAAAGAGAAAGGGGCCGG + Intergenic
1182733464 22:32513620-32513642 GCTGAGAAGGAAGATGAGGCAGG + Exonic
1182799645 22:33021233-33021255 CCTGTGAAGTAGGAAGGGCAGGG - Intronic
1182871820 22:33654328-33654350 CTTGAGGAAAAGGAAGGGGCCGG - Intronic
1183130709 22:35832481-35832503 GCTGGGAAGGAGGCAGGGGATGG + Intronic
1183189774 22:36314382-36314404 CTTGAGAAGGAGGGTGGGGCAGG + Intronic
1183541656 22:38432670-38432692 CCTAAGAAGGATCAATGGGCCGG + Intronic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1183772347 22:39938050-39938072 CATAAGAAGAAGGAAGTGGCTGG + Intronic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
1184265117 22:43342610-43342632 CCGGGGAAGGAGGAGGAGGCCGG - Intronic
1184272014 22:43389708-43389730 CCTGACAAGGGGGAAGAGGGAGG - Intergenic
1184273999 22:43399992-43400014 CCTGACCAGGAGGAAGGGGAGGG + Intergenic
1184391988 22:44207950-44207972 CCTGAGCAGGTGGAAGGAGCTGG - Exonic
1184413312 22:44338138-44338160 CCCTTGGAGGAGGAAGGGGCTGG - Intergenic
1184541727 22:45130390-45130412 CTTGAGAAGGTGGGAGGGTCTGG - Intergenic
1184605046 22:45567947-45567969 AGTGGGAGGGAGGAAGGGGCTGG + Intronic
1184641995 22:45877720-45877742 CCTGCGCAGGAGGGAGGAGCAGG + Intergenic
1184693596 22:46128239-46128261 GCTCAGGAGGAGGATGGGGCTGG - Intergenic
1184851733 22:47124980-47125002 CCTGTAAAGGAGGGAGGGGCAGG + Intronic
1184954606 22:47877385-47877407 GATGAGCAGGAGGAAAGGGCAGG - Intergenic
1185080096 22:48704942-48704964 CCTGAGATGGTGCAGGGGGCTGG + Intronic
1185093917 22:48795517-48795539 TGGTAGAAGGAGGAAGGGGCAGG - Intronic
1185156040 22:49194100-49194122 CCTGAGAAGGAGGCATAGGAAGG + Intergenic
1185257858 22:49846238-49846260 CCAGGCAGGGAGGAAGGGGCCGG - Intergenic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
949201045 3:1379690-1379712 CCTGAGGAGGAGGTGGGGGGTGG + Intronic
949501171 3:4681161-4681183 GCAGTGAGGGAGGAAGGGGCAGG + Intronic
949942727 3:9167147-9167169 CCTGGGCAGGAGAAAGGGGGAGG + Intronic
949965131 3:9349248-9349270 CATGTGCAGGAGGGAGGGGCAGG - Intronic
949986161 3:9542913-9542935 GCTGAGAAGGAAGGAGGGTCAGG + Intronic
950009166 3:9710453-9710475 GCTGAGAATGAGGATGGGGGAGG + Intronic
950390647 3:12693950-12693972 CCTGAGAAGTTGGTGGGGGCTGG + Intergenic
950571787 3:13804915-13804937 CCTGAGGAGGAGGAAGAGGAGGG - Intergenic
950580864 3:13861281-13861303 CCTGGGCAGGAGGGAGGGGCAGG - Intronic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
950972329 3:17201713-17201735 CCAGAGAAGGAGGAAGTGAGGGG - Intronic
951194137 3:19804704-19804726 CCTAGGAAGGGGGAAGGGGGAGG + Intergenic
951607652 3:24453733-24453755 TCTGGGAAGAGGGAAGGGGCCGG - Intronic
951913460 3:27775249-27775271 CCTCAGGAGGAGGTAGGGACAGG - Intergenic
952316992 3:32239684-32239706 CCTGGGAAGGAGGCAGGGCATGG + Intronic
952405911 3:33005014-33005036 CCTGAGAAGGAGCAAAGAGAGGG + Intronic
952811215 3:37405025-37405047 CATGAGAAAGAGGAAAGGCCTGG - Intronic
952817270 3:37456528-37456550 GCAGAGAAGGAGGAGGGGACGGG - Intronic
953195720 3:40731407-40731429 CCTGAGCAGGTGGAAGTGGTAGG + Intergenic
953899943 3:46834165-46834187 CCTGCGAGGGACGAGGGGGCAGG + Intergenic
954336118 3:49918781-49918803 CCTGAGTAGGTGAGAGGGGCTGG - Intronic
954448085 3:50557350-50557372 GCTGAGCTAGAGGAAGGGGCTGG - Intergenic
954641437 3:52100972-52100994 CCTTTGAATGAGGAAGGAGCAGG + Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954879243 3:53822692-53822714 CCTGGGCAGGAGGAAGGAGCTGG + Intronic
955382549 3:58451463-58451485 GCTGAGGAGGAGGAAGAGGAAGG + Intergenic
955403926 3:58613491-58613513 CCAGAGCAGCAGGCAGGGGCTGG - Intronic
956268758 3:67427675-67427697 CCTGAGAAGCACAAAGGGTCAGG + Intronic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
957381946 3:79442811-79442833 CCTGAGAAGCAGGATGGTTCAGG - Intronic
957720793 3:83995718-83995740 CAGTAGCAGGAGGAAGGGGCAGG + Intergenic
958114342 3:89196020-89196042 TGGGAGAAGGAGGAAGGGGAAGG - Intronic
958119822 3:89270956-89270978 GCTGAAAAGGAGGAAGGGGAGGG + Intronic
958119888 3:89271907-89271929 GCTGAAAAAGAGGAAGGGGAAGG - Intronic
958906573 3:99948519-99948541 CCTGAGAAGGGGGAGGGGAAGGG + Intronic
959110004 3:102111576-102111598 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
959120411 3:102225484-102225506 GCTCAGAAGGGGGAAGGTGCAGG + Intronic
959770186 3:110085665-110085687 CCTCACATGGTGGAAGGGGCAGG - Intergenic
959989710 3:112617442-112617464 CCTGAGATGGATTTAGGGGCTGG + Intronic
960216088 3:115039224-115039246 CCTAAGAAGGGGGAAGAGGAAGG + Intronic
960471964 3:118076441-118076463 CCAGAGAATGAGGGAGGGGTGGG + Intergenic
960616928 3:119604602-119604624 GCTGAGAAGGGGGAAGGAGTTGG + Intronic
960967087 3:123112892-123112914 CCTGGGGAGGAGGCTGGGGCTGG - Intronic
960972665 3:123150700-123150722 CTGGAGAAGGAAGAGGGGGCGGG - Intronic
961166885 3:124769715-124769737 TCTGAGAGGGAGAAGGGGGCTGG - Intronic
961599204 3:128046096-128046118 CTTGAGAAGGAGAAAGGGGAGGG - Intergenic
963062825 3:141238914-141238936 GCTGAGAAGGAGGAAGAGGAGGG + Intronic
963076495 3:141352297-141352319 CCCCAGAAGGAGGCAGGTGCTGG - Intronic
963234944 3:142947313-142947335 CCACAGGAGGAGGAAGGGGCAGG + Intergenic
963788754 3:149561860-149561882 CCTGGAAAGGAGAAAAGGGCTGG + Intronic
964092674 3:152894734-152894756 CCTGTGAAGGATGAAGGGAAAGG - Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964414672 3:156434792-156434814 CCTGAGAAAGAAGAAGGAGTTGG + Intronic
966003838 3:174983604-174983626 CCTCACATGGTGGAAGGGGCAGG + Intronic
966905890 3:184525700-184525722 CCTGGGAAAGAGAAAGCGGCCGG - Intronic
966985884 3:185179960-185179982 GCTGAGAAGGAGGATGGAGAAGG + Intergenic
967078108 3:186023532-186023554 CCTGAGAAGGTGGAAGTGGGTGG + Intergenic
967192662 3:186998508-186998530 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
967576826 3:191104482-191104504 CCAGAGTAGGAGGAAGAGTCAGG + Intergenic
968022497 3:195405851-195405873 CCAGAGCAGGAGCCAGGGGCAGG + Intronic
968356119 3:198108942-198108964 CCTGAGGAGGAGAAAGACGCGGG - Intergenic
968551620 4:1226343-1226365 CCTGGGGAGGAGGAGGGGGCAGG + Intronic
968649287 4:1754049-1754071 CCTGGGGAGGAGCACGGGGCTGG - Intergenic
968762210 4:2448642-2448664 CCTGGGCAGGAGCAAGGTGCAGG + Intronic
969052799 4:4385375-4385397 CCTGAGACGGGGGGCGGGGCGGG + Intronic
969211051 4:5687521-5687543 GCAGGGAAGCAGGAAGGGGCAGG + Intronic
969520275 4:7674145-7674167 CCAGGGAAGGATGATGGGGCAGG - Intronic
969573586 4:8024153-8024175 CCTGAGAAGGAAGGAGGGAGGGG - Intronic
970020941 4:11567947-11567969 CCTGAGCAGGAGGAAGAGAGAGG + Intergenic
970236531 4:13964368-13964390 GCTGAAAAGGAGGAAGAGGAGGG - Intergenic
970354239 4:15236407-15236429 CGTGAGAAGGGGAAAGGGGCTGG + Intergenic
970898772 4:21134212-21134234 ACTAAGAAGGAGGAAGAGGAGGG - Intronic
970926526 4:21458765-21458787 GCTGAGAATGAGGATGGGACAGG - Intronic
971143064 4:23946003-23946025 CCTGGGGAGGAGGGAGGGTCCGG - Intergenic
971196006 4:24472082-24472104 CCCGAGAAAGAGGCAGGAGCCGG - Intergenic
971297632 4:25412056-25412078 CCTGAAAGGGAGGAAGGTTCTGG - Intronic
971327366 4:25655479-25655501 CTTGAGGAGAAGGCAGGGGCGGG + Intronic
971367390 4:25988336-25988358 CCTGAGAACGAGGAGGGTGAAGG - Intergenic
971648496 4:29239579-29239601 ACTGAGAAGGTGGAAGTGGAAGG - Intergenic
972166858 4:36297139-36297161 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972913897 4:43852238-43852260 GCTGAGGAGGAGGAAGAGGCAGG + Intergenic
973267582 4:48226449-48226471 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
973575381 4:52282780-52282802 GCTGAGGAGGAGGAATGGGAGGG - Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
974637393 4:64582674-64582696 GTTAAGAAGGAGGAAGGGGGCGG + Intergenic
975007915 4:69313487-69313509 CCAGAGTAGGAGGAAGGTGGAGG - Intronic
975329571 4:73099089-73099111 CTGGAGAAGGAGGAAGAGGAGGG + Intronic
976194551 4:82520410-82520432 CCTGAGAAAGAGGAAGGATGGGG - Intronic
977034170 4:91928299-91928321 CTGGAGCAGGAGGAAGGGGGTGG - Intergenic
977096791 4:92756093-92756115 CCTGGGAAGGATGCAGGGGTGGG - Intronic
977631814 4:99251420-99251442 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
978311957 4:107394521-107394543 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
978598576 4:110404519-110404541 GCTGAGTAGGAGGAAGAGGAGGG + Intronic
978754287 4:112285956-112285978 CTCGAGAGGAAGGAAGGGGCGGG - Intronic
980394243 4:132188929-132188951 CCTAAAAAGGAAGAAGGAGCAGG - Intergenic
980784324 4:137532638-137532660 ACGGAGAAGGAGGAAGGCGGGGG + Intergenic
980842959 4:138288474-138288496 CCTGAGAACCAGGAAGAGACAGG + Intergenic
981157140 4:141451806-141451828 CCTTACATGGAAGAAGGGGCAGG + Intergenic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981455468 4:144948206-144948228 CCTGAGAAGAAGGAGTGGCCTGG - Intergenic
981573603 4:146179150-146179172 CCTGAGTAGGAGTCAGGGGAGGG + Intronic
982521668 4:156425007-156425029 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
982691573 4:158553431-158553453 CCTGAGTAGGAGAGAGGGGATGG + Intronic
982715323 4:158801189-158801211 CCTGGGGAGGCGGTAGGGGCCGG + Intronic
985168476 4:187123223-187123245 ACTGAGGAGGAGGAAGGAGAGGG - Intergenic
985305816 4:188538363-188538385 CATGACAAGGAGGCAGGGGGTGG + Intergenic
985655122 5:1127430-1127452 CCGCAGAAGTTGGAAGGGGCAGG + Intergenic
985658876 5:1145761-1145783 CCTCTGCAGAAGGAAGGGGCTGG + Intergenic
985727647 5:1524255-1524277 GCGGGGAGGGAGGAAGGGGCGGG + Intergenic
985780698 5:1869399-1869421 CCTGGGCAGGAGCAGGGGGCAGG + Intergenic
985966603 5:3342846-3342868 ACTGAGGAGGAAGAAGAGGCAGG - Intergenic
985992340 5:3573899-3573921 ACAGAGAAGGTGGAAGGGACAGG + Intergenic
986110271 5:4709513-4709535 CCTGAGAAGGACAAGGGGTCAGG + Intergenic
986285308 5:6354524-6354546 CGGGAGAAGGAGGCAGAGGCTGG + Intergenic
986613878 5:9597110-9597132 ACAGAGGAGGAGGAAGGGGAAGG - Intergenic
986680685 5:10230784-10230806 CCTGGGGAGGAGGAAGTGCCAGG - Intronic
986773501 5:10994339-10994361 CCGGGGAAGGAGGAGGGGGGCGG + Intronic
986773509 5:10994358-10994380 GCGGGGAAGGAGGAAGGGGCCGG + Intronic
987213058 5:15704118-15704140 GCTGAGAAGGAGGAGGGTGGAGG + Intronic
987265240 5:16246555-16246577 TCTGGAAAGTAGGAAGGGGCAGG - Intergenic
987327613 5:16826574-16826596 CCTGTGCGGGAGGAAGGAGCGGG + Intronic
987505030 5:18757681-18757703 TCTGAGGAGGAGGAAGAGGAGGG + Intergenic
987999846 5:25333949-25333971 GCTGGGAAGGATGAAGGGGTGGG + Intergenic
988006492 5:25418476-25418498 CTGGAGCAGGAGGAAGGGGAGGG + Intergenic
988539202 5:32094080-32094102 CCTGAGAAGGAGGGAGGGGTTGG + Intronic
989128381 5:38079209-38079231 CCCATGAAGGAGGCAGGGGCTGG - Intergenic
989193146 5:38690685-38690707 CTGGAGCAGGAGGAAGGGGGTGG + Intergenic
989373638 5:40736089-40736111 CCTGAGAAGGCACAAGGGGATGG + Intronic
989666453 5:43859680-43859702 CCTGGGAAGGATAAAGGGGCTGG + Intergenic
990182750 5:53180706-53180728 CTAGAGCAGGAGGAAGGGGTGGG - Intergenic
990524157 5:56608260-56608282 TCTGAGAGGGTGGCAGGGGCAGG - Intergenic
990545210 5:56815522-56815544 CCTGCGAGGGAGGGAGGGGGCGG - Intergenic
990874226 5:60466797-60466819 ACTGAGAACAACGAAGGGGCAGG - Intronic
991188218 5:63836104-63836126 CCTGGGAAGGAGGACAGTGCAGG - Intergenic
991223504 5:64242969-64242991 CCTGAGAAGCACAAAGGGTCAGG + Intronic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991309108 5:65215256-65215278 CTTGTGAGGTAGGAAGGGGCAGG - Intronic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
992448651 5:76856045-76856067 CCGGAGGAGGAGGAAGGAGGAGG - Intronic
992458853 5:76941712-76941734 CATGAGAAGGGGGAAGGGAGGGG - Intergenic
992613069 5:78524147-78524169 CCTGAGAAGGAGGCTGGGTGTGG - Intronic
992684008 5:79181658-79181680 CCAGAGGAGGAGGAAGCTGCAGG - Intronic
992741196 5:79775008-79775030 CCTGTGAAGAAGCAAGGAGCAGG - Intronic
992865638 5:80954454-80954476 CAGGAGAATCAGGAAGGGGCTGG + Intergenic
993084896 5:83351136-83351158 CCGGAGAAGGAGGAAGCGGGGGG - Intronic
993442897 5:87978500-87978522 CCTGTGATGGAGGAAGGGTTTGG - Intergenic
993699098 5:91097237-91097259 CCTCACATGGTGGAAGGGGCAGG + Intronic
993831119 5:92759257-92759279 CCTGAGAAGGATGAAGGAGAAGG - Intergenic
995479484 5:112580494-112580516 CCTGAGAATGCTGAAGGGTCTGG + Intergenic
995525822 5:113049843-113049865 CCTGAGAAGTAGGCAAGAGCTGG - Intronic
995551251 5:113283887-113283909 GCTGAGGAGGAGGAAGAGGGAGG - Intronic
996238894 5:121170518-121170540 CCAGAGCAGGAGGAAGTGGCAGG + Intergenic
996663817 5:126034839-126034861 CTGGAGAAGGAGGAATGGCCTGG - Intergenic
997343062 5:133161692-133161714 CATGAGAAGGAGGCAGAGGGAGG + Intergenic
997434136 5:133862030-133862052 ACTGAGAAGCAGGAGGGGCCAGG + Intergenic
997475923 5:134142430-134142452 CCTCAGAAGTAGGAGGGGGTGGG + Intronic
997526471 5:134556118-134556140 GCTGACAGGGAGGAAGGGGCAGG - Intronic
997621150 5:135297009-135297031 CCTGAGATGGAGGGAGGTGGGGG - Intronic
997688804 5:135811213-135811235 CCTGGGAAGGAGGATGGGCAGGG + Intergenic
997690512 5:135824757-135824779 ACTGAGAAGGAGGCACGGGCTGG + Intergenic
997803273 5:136888423-136888445 CTGGAGAAGGAGGATAGGGCTGG + Intergenic
998097471 5:139404304-139404326 CCTGAGAAGCCGGCAGGGCCCGG + Intergenic
998306282 5:141080277-141080299 CCAGAAAAGTAGGCAGGGGCTGG + Intergenic
998575899 5:143316189-143316211 CCAGAGAAGTAGGAAGGTCCTGG + Intronic
998675218 5:144400325-144400347 CCTGAGAGGGAGGAAGGAGGTGG + Intronic
999150764 5:149424457-149424479 CATGTGAAGGAGGCAGGGGTTGG + Intergenic
999287396 5:150402349-150402371 CCTGAGCAGGGGGCAGGGGAGGG - Intronic
999311599 5:150555193-150555215 GCTGTGACGGAGGAAGGGACAGG - Exonic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999378167 5:151101345-151101367 CCAGAGACTAAGGAAGGGGCAGG - Exonic
999382191 5:151129178-151129200 CTACAGAAGGAGGCAGGGGCTGG - Intronic
999774398 5:154800437-154800459 CCTCAGAAGAAGGAAGGGAGAGG + Intronic
1000198654 5:158986128-158986150 GCTGGGAAGGAGACAGGGGCTGG - Intronic
1000312836 5:160061888-160061910 CCTGTGGAGGAGGAAAGGCCGGG + Intronic
1001076062 5:168628912-168628934 CCTGAGAAGGCAGAAGGGTGGGG + Intergenic
1001266436 5:170277846-170277868 AAAGAGAAGGAGGAAGGGGAGGG + Intronic
1001422128 5:171596223-171596245 CCTGGGAAGGAGGAATGAGATGG - Intergenic
1001548708 5:172586896-172586918 CCTGCGCAGGAGGCAGGGCCTGG - Intergenic
1001548780 5:172587160-172587182 CCTGAGCAGGAGGCGGGGCCTGG + Intergenic
1001591591 5:172869190-172869212 CCTGGGGAGGAGGAAGGAGGAGG + Intronic
1001814906 5:174660402-174660424 ACTGGGAAGGAGGTGGGGGCAGG - Intergenic
1001884819 5:175279921-175279943 CCTAGGAAGGAGGAAAGGTCAGG + Intergenic
1001993430 5:176135085-176135107 ACTGATAAGGAGGGAGAGGCTGG + Intergenic
1002435147 5:179226914-179226936 CCTGAGCAGGAGGAATGGGCAGG + Intronic
1002532802 5:179858696-179858718 CCGGAGGAGGAGGAGGGGGCTGG + Intronic
1002558499 5:180063030-180063052 GGTGGGGAGGAGGAAGGGGCTGG + Intronic
1002614471 5:180442205-180442227 CCTGGGAGGGAGGAAGGGACAGG + Intergenic
1002645162 5:180649301-180649323 CCTCGGGATGAGGAAGGGGCGGG - Intronic
1002723708 5:181281566-181281588 CCTGAGCCGTAGGAGGGGGCTGG + Intergenic
1002928685 6:1619463-1619485 CCTGAGAGGGGGGAGGGGGATGG - Intergenic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003247878 6:4399688-4399710 CCTATGAAGGGGGAAGAGGCTGG - Intergenic
1003407961 6:5838928-5838950 CTGGAGAATGAGGATGGGGCGGG + Intergenic
1004434468 6:15577223-15577245 CCAGAGAGGGAGCAAAGGGCTGG + Intronic
1004498183 6:16184353-16184375 GCCGAGAATGAGGAAGGGGAGGG + Intergenic
1004520734 6:16358929-16358951 CCTGACAACTCGGAAGGGGCAGG - Intronic
1004649346 6:17593563-17593585 GAAGAGAAGGAGGAAGGGGGAGG - Intergenic
1005105814 6:22223263-22223285 CTTGAGAGGGAGGGAGGGACAGG - Intergenic
1005186981 6:23173576-23173598 TCTGAGAAGGAGGCACTGGCTGG - Intergenic
1005215371 6:23521286-23521308 CCTGAGAGAGGTGAAGGGGCAGG - Intergenic
1005932067 6:30491402-30491424 CCTGAGATGGAGTAAGGAGGGGG + Exonic
1005952232 6:30640513-30640535 CCTGTGAGGAAGGAAGCGGCGGG - Exonic
1006396468 6:33790460-33790482 CCTGAGGTGGAGCAAGTGGCAGG - Intergenic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006740003 6:36301377-36301399 GCTGAGGAGGCGGCAGGGGCCGG - Intronic
1007176514 6:39901421-39901443 CATGAGGAGGAGGAAGGAGGAGG + Exonic
1007340179 6:41186292-41186314 CCTGACAAGTGGGAAGAGGCTGG - Intergenic
1007687136 6:43673654-43673676 CAGGAGAGGTAGGAAGGGGCTGG - Intronic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008124048 6:47648946-47648968 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1009339387 6:62534368-62534390 CCTGTGAAGGAGAAAGGAGAAGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010991205 6:82482310-82482332 AGAGAGAAGGAGGAAGGGGCTGG - Intergenic
1011195491 6:84774949-84774971 CCTGAGACGGCGGGAGGTGCTGG - Intergenic
1011528016 6:88287668-88287690 ACTGAGAAGCTGGAAGAGGCTGG - Intergenic
1011587762 6:88945082-88945104 CCTGAGAAGGAGGCAGGGGTTGG - Intronic
1011798592 6:90983753-90983775 CACCAGAAGCAGGAAGGGGCAGG - Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1012948866 6:105496231-105496253 ACTGAGATGGAGGCAGGGACTGG + Intergenic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1013481140 6:110553806-110553828 CCTGTGTAGAAGGATGGGGCTGG - Intergenic
1013680589 6:112521457-112521479 CCCAAGGAGGAGAAAGGGGCTGG - Intergenic
1013760275 6:113510276-113510298 CCAGAACAGGAGGAAGGGACCGG - Intergenic
1014271494 6:119341348-119341370 GCTGAGGAGGAGGGAGGGCCTGG + Intronic
1014493058 6:122086522-122086544 CCAGAGCAGGAGGAAGAGGTGGG + Intergenic
1014700882 6:124686444-124686466 CCAGAGCAGGAGGAAAGGGGAGG + Intronic
1015376322 6:132514054-132514076 CTTGAGAATTAGGAAGTGGCTGG + Intergenic
1015758663 6:136633593-136633615 AATCAGAAGGAAGAAGGGGCTGG + Intronic
1016554808 6:145324527-145324549 CCCGAGAGTCAGGAAGGGGCTGG + Intergenic
1016642481 6:146365430-146365452 CCTGAAAGTGACGAAGGGGCTGG - Intronic
1017000915 6:149996422-149996444 CCTGCAGAGGAGGAGGGGGCAGG + Intergenic
1017023287 6:150159123-150159145 CCTGAGCAGGTGGAAAGGGCTGG - Intronic
1017467803 6:154710960-154710982 ACAGGGAAGGAGGATGGGGCTGG - Intergenic
1017484460 6:154890054-154890076 CGTGAGGAGGAGGTAGAGGCTGG + Intronic
1017534044 6:155327573-155327595 CCTCAGAAAAATGAAGGGGCTGG + Intergenic
1018554151 6:165033331-165033353 CAAGAGAGGGAGCAAGGGGCAGG + Intergenic
1018690335 6:166339301-166339323 TCTAGGGAGGAGGAAGGGGCAGG - Intronic
1018768854 6:166955682-166955704 CCTGGGAAGGAGTAGGGGGTAGG - Intronic
1018898576 6:168038779-168038801 CCTGACCAGGTGGGAGGGGCAGG - Intronic
1018938918 6:168295069-168295091 GCAGAGGAGGAGGAAGGGGCAGG - Intronic
1018959466 6:168437480-168437502 CTTAAGAAGGAAGAAGAGGCCGG + Intergenic
1018970524 6:168525721-168525743 CATGTGAAGGTGGAAGAGGCAGG + Intronic
1019018242 6:168896226-168896248 CCTGAGAAGAAGGCAGGAACCGG + Intergenic
1019161927 6:170074704-170074726 CCTGAGAAGGAGGGACAGCCTGG + Intergenic
1019223996 6:170495835-170495857 CGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019224059 6:170496115-170496137 CGTGAAAAGGAGGATGGGGTTGG + Intergenic
1019409581 7:900719-900741 GCCGGGGAGGAGGAAGGGGCTGG - Intronic
1019441961 7:1052104-1052126 GCTGGGAAGGTGGAAGGAGCTGG - Intronic
1019606165 7:1911304-1911326 CCTGAGGAGGAGGGAGAGGAGGG - Intronic
1019611742 7:1940191-1940213 CCTGGGAAGGAGGAGGGGAGGGG + Intronic
1019742832 7:2683313-2683335 CCCCAGAAGCAGGAAGAGGCAGG - Intronic
1020047143 7:5048842-5048864 CCAGAGCAGGAGGAAGAGGGAGG + Intronic
1020074854 7:5251166-5251188 CACGAGAAGCTGGAAGGGGCAGG - Intergenic
1020080450 7:5283415-5283437 TCCGAGAACGAGGAAGGGGCCGG - Intronic
1020346346 7:7168234-7168256 GCTGAAGAGGAGGGAGGGGCTGG + Intronic
1021171182 7:17399543-17399565 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1021451774 7:20788924-20788946 GCCCAGAAGGAGGAAGGGGTGGG + Intergenic
1021628876 7:22623914-22623936 CAGCAGAAGTAGGAAGGGGCAGG + Intronic
1021758769 7:23882628-23882650 CCAGAGCAGGAGGAAGGTGGAGG + Intergenic
1021806202 7:24358456-24358478 CCGTACGAGGAGGAAGGGGCAGG + Intergenic
1021942773 7:25695840-25695862 TGTGTAAAGGAGGAAGGGGCTGG - Intergenic
1022148670 7:27575472-27575494 GCTGAGAAGGAAGACTGGGCTGG + Intronic
1022163497 7:27735059-27735081 CCTGAGAAGGTGGGAGGTGTTGG + Intergenic
1022438642 7:30413860-30413882 GCTGAGAATGGGAAAGGGGCAGG - Intergenic
1022441462 7:30436617-30436639 CCTGAGGACAAGGAAGGGGCAGG + Intronic
1022802853 7:33792477-33792499 CCAGAGCAGGAGGGAGGGTCTGG - Intergenic
1023146149 7:37153011-37153033 TCAGAGAAGGAGTGAGGGGCAGG + Intronic
1023974929 7:45021701-45021723 GCTGAGGAGGAGAATGGGGCAGG + Intronic
1024246175 7:47472034-47472056 CCTGAGAAGGTGGAAGAGGCAGG - Intronic
1024658263 7:51470657-51470679 CCCGAGAAGGAGGATGGGGTTGG + Intergenic
1024979448 7:55145206-55145228 CCTGAGAGAGAGCAGGGGGCGGG - Intronic
1025198464 7:56948764-56948786 TCCGAGAACGAGGAAGGGGCCGG + Intergenic
1025673487 7:63628169-63628191 TCCGAGAACGAGGAAGGGGCCGG - Intergenic
1025752797 7:64307740-64307762 CGTGGGACAGAGGAAGGGGCAGG - Intronic
1026117764 7:67510636-67510658 CCAGAGCAGAAGGAAGAGGCGGG - Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026634782 7:72072073-72072095 CCTGAGAAAGAGAAAAGGGTAGG + Intronic
1026715035 7:72781454-72781476 CCTGAGCTGGAGGCTGGGGCAGG - Intronic
1026775189 7:73226788-73226810 CTCCAGAAGGAGGAAGAGGCCGG + Intergenic
1026898767 7:74025954-74025976 CCTGGGAAGGAGGAAGGCAGGGG - Intergenic
1026977033 7:74505337-74505359 CCTCAGATGGAGGGAGAGGCAGG - Intronic
1027016046 7:74780159-74780181 CTCCAGAAGGAGGAAGAGGCCGG + Intronic
1027050741 7:75019785-75019807 CCTGAGATGCAGGCAGGGGCCGG + Intronic
1027071983 7:75165778-75165800 CTCCAGAAGGAGGAAGAGGCCGG - Intergenic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1027221505 7:76217047-76217069 CCTCAGCAGGTGGAAGGGGCCGG + Intronic
1027358462 7:77383565-77383587 ACAGAGAAGGAGGAATGGGGTGG - Intronic
1027418268 7:77995239-77995261 CCAGCGAGGGAGGAAGGTGCCGG + Intergenic
1028121302 7:87059327-87059349 CCTGGCAAGGAGGAAGCGGGCGG + Exonic
1028307711 7:89286978-89287000 GCTGAGAAGGAGGAAAAGGAGGG - Intronic
1029551144 7:101237713-101237735 CCTGAGCCCGAGGAAGAGGCAGG - Exonic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029601438 7:101565799-101565821 ACTCAGAAGGAGGCAGAGGCTGG - Intergenic
1030169599 7:106588241-106588263 TTTGAGAAAGAGGATGGGGCAGG - Intergenic
1030205968 7:106953094-106953116 TCTGAGCAGGAGGAAGTGGGTGG - Intergenic
1030558540 7:111056846-111056868 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1031072148 7:117173674-117173696 ACAGAGAGGGATGAAGGGGCTGG - Intronic
1031441911 7:121805079-121805101 CCTGGGCAGGGGGAAGGGGTTGG - Intergenic
1031557470 7:123195506-123195528 CCCTAGAAGGAGGAAGTGGTAGG - Intronic
1032062347 7:128735631-128735653 CTGGAGCAGGAGGAAGGGGCGGG + Intergenic
1032655834 7:133928749-133928771 CATTAGAAAGAGGAAGGGGATGG + Intronic
1032803575 7:135335490-135335512 CCTGAGAAGGTGGAGGGGTATGG - Intergenic
1032948716 7:136882440-136882462 GCTGAGAAGAAGGAGGGGGAAGG - Intronic
1033658883 7:143390556-143390578 CCTGGGAAGAAGGAAGGGTGAGG - Exonic
1033790790 7:144790569-144790591 CCAGAGCAGGAAGAAGTGGCAGG + Intronic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034733344 7:153406977-153406999 TCTGCAAAGGAGGAAGGGGTTGG - Intergenic
1034849396 7:154479903-154479925 GCTGAGAAGGAGGATGGGGAGGG - Intronic
1035133306 7:156675674-156675696 ACTGAGGAGGAGGCGGGGGCGGG - Exonic
1035835060 8:2741233-2741255 ACTGGAAAGGAGGAAGTGGCAGG + Intergenic
1036221997 8:6929053-6929075 ACTGGGAAGGAGGCAGGGACAGG - Intergenic
1036444588 8:8810490-8810512 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1036469619 8:9040835-9040857 CTTGACAATGAGGCAGGGGCAGG - Intronic
1036993031 8:13620709-13620731 GCTGAGAAGGAAGAATGGGAAGG + Intergenic
1037374468 8:18212830-18212852 CCTAAGAGGGAAGACGGGGCTGG - Intronic
1037586555 8:20280678-20280700 GCAGGGAGGGAGGAAGGGGCAGG + Intronic
1037590218 8:20305542-20305564 ACTGAGAAAGAGGGAGGGGAAGG - Intergenic
1037757360 8:21719773-21719795 CATGAGCAGGAGGGAGGGGAAGG - Intronic
1037952607 8:23028693-23028715 CCTGAGAAGGTGTCAGGGGAAGG + Intronic
1037963455 8:23116529-23116551 CCTGAGAAGGTGTCAGGGGAAGG - Intronic
1037974670 8:23200851-23200873 CCTGAGAAGGCGTCAGGGGAAGG + Intronic
1038265929 8:26040101-26040123 GCTGTGAAGGAGGTAGTGGCAGG + Exonic
1038582045 8:28756229-28756251 ACTGACTAGGAGGAAGGAGCAGG - Intergenic
1039879753 8:41617671-41617693 CCTGAGAAGGAGCCCAGGGCAGG - Intronic
1040970017 8:53125568-53125590 TCTGGGATGGAGGAAGGGCCGGG + Intergenic
1041360580 8:57049437-57049459 GCTCAGAATGGGGAAGGGGCAGG - Intergenic
1041601171 8:59718784-59718806 GCAGAGAAGGAGGAAGGGAAGGG + Intergenic
1041794192 8:61729092-61729114 CCTGAGAAGGCTGAAAGGGCAGG + Intergenic
1041928719 8:63265048-63265070 ACAGAGAAGGGTGAAGGGGCAGG + Intergenic
1042102507 8:65288693-65288715 CCTGAGAAGGATGTAGGAGTGGG - Intergenic
1042154168 8:65823609-65823631 CCTGAGAATGTGGAATGGGAGGG - Intronic
1042194960 8:66223905-66223927 CCTGTGAAGGATAAAGGGGAGGG + Intergenic
1042657866 8:71120113-71120135 CCAGAGTAGGAGGAAGTGGGGGG + Intergenic
1043379132 8:79684068-79684090 TCTGAGAAGCAGGAGGAGGCAGG - Intergenic
1043533502 8:81175586-81175608 CCAGAGCAGGAGCAAGGGGATGG + Intergenic
1043745468 8:83869153-83869175 CCTGCCAACCAGGAAGGGGCGGG - Intergenic
1043796304 8:84546065-84546087 TGTGAGAAGGAGGAAGTGGCAGG + Intronic
1044551523 8:93517967-93517989 CAAGAGAGGGAGGAAGGGCCAGG + Intergenic
1044666833 8:94640838-94640860 CGGGAGGGGGAGGAAGGGGCGGG - Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045098952 8:98825906-98825928 CCAGAGAAGGTGGACGGAGCCGG + Intronic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045215640 8:100145872-100145894 GCAGAGCCGGAGGAAGGGGCGGG - Intergenic
1045382741 8:101643540-101643562 CCCGAGAAGGAGCAAAGGCCTGG + Intronic
1046752592 8:117941048-117941070 TGTGAGAAGCAGGATGGGGCAGG - Intronic
1047321058 8:123783651-123783673 CCTGAGAAGGAGGAATGCCTAGG - Intronic
1047636367 8:126767597-126767619 CCTGAGCAGGAGGAAGTTGGGGG - Intergenic
1047706373 8:127503662-127503684 CCTAAGAAGGAGGAAGGGAGTGG + Intergenic
1047765536 8:127986940-127986962 CCTTACAAGGAGGAGGGGACAGG + Intergenic
1047796815 8:128265803-128265825 CTTGTGAATGTGGAAGGGGCAGG + Intergenic
1048378652 8:133844911-133844933 CCAGAGCAGGAGCAAGGGGTGGG - Intergenic
1048570956 8:135655558-135655580 CTGGAGACAGAGGAAGGGGCTGG + Intronic
1048586177 8:135776163-135776185 CCAGAGGAGGGGGAGGGGGCTGG + Intergenic
1048750532 8:137668622-137668644 ACTGAGAAGGTTGAAGGGGATGG + Intergenic
1048886739 8:138915043-138915065 CCGGAGAGGGAGGAAGCAGCTGG - Intergenic
1049085454 8:140474889-140474911 CATAAGATGGAGGAGGGGGCTGG + Intergenic
1049121992 8:140747559-140747581 CGGGAGGAGGAGGAAGGGGAGGG + Intronic
1049281683 8:141752766-141752788 TCTGAGAAGGTGACAGGGGCGGG + Intergenic
1049322739 8:142005695-142005717 CGTGAGAGGTAGCAAGGGGCCGG - Intergenic
1049334604 8:142076527-142076549 CATGAGAAGGAGCCGGGGGCAGG - Intergenic
1049420484 8:142514215-142514237 CCTGAGATGGTGGTAGAGGCGGG + Intronic
1049434318 8:142579433-142579455 CCTGGGAAGGAGGGAGGAGGAGG + Intergenic
1049543780 8:143220251-143220273 CCTAAGGAGGAGGAAAGGGATGG - Intergenic
1049600311 8:143504497-143504519 CCAAAGACGGAGGAGGGGGCAGG - Intronic
1049649981 8:143761304-143761326 CCGGAGCAGCAGGCAGGGGCCGG - Intergenic
1049713972 8:144080876-144080898 GCTGAGCAGGAGGCAGGGCCTGG + Intergenic
1049841730 8:144777577-144777599 CCTGGGAAGGAGACAGGGACTGG + Exonic
1050112818 9:2234403-2234425 CCTGAGAAGCAGGGAGAGGCGGG - Intergenic
1050482043 9:6097477-6097499 GCTCAGAATGGGGAAGGGGCAGG - Intergenic
1050526339 9:6549799-6549821 CCTTAGAGGTAGCAAGGGGCTGG - Intronic
1050568436 9:6912177-6912199 GCAGGAAAGGAGGAAGGGGCAGG - Intronic
1050935025 9:11385666-11385688 CATGAGCAGGAGGAAGGAGGGGG - Intergenic
1051408928 9:16768970-16768992 GCTGAGAAGTAGGTAGGGGGCGG + Intronic
1051685768 9:19656902-19656924 CCTGAGGAGGTGGGAGGGGAGGG - Intronic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1052989586 9:34511317-34511339 CCTGAGAAGATGGGTGGGGCAGG + Intronic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053042405 9:34885704-34885726 CCTGAGCAAGAGCATGGGGCTGG - Intergenic
1053233774 9:36434231-36434253 CCTGAGAAAGGGGAAGGGAGGGG + Intronic
1054866953 9:70012734-70012756 TCAGAGAAGGAGAAAGGGGGAGG - Intergenic
1055075741 9:72213317-72213339 CCTGAGAATGGGGATGGGGGAGG + Intronic
1055205478 9:73724182-73724204 GCTGAGAAGGAGGAAGAGGAGGG - Intergenic
1055463252 9:76539158-76539180 TCTGGGAAGGGGGAGGGGGCTGG - Intergenic
1055577614 9:77675977-77675999 GCAGAGAAGGAGTAAGGAGCAGG + Intergenic
1055672827 9:78624334-78624356 CCAGAGATGGAAGAAAGGGCAGG + Intergenic
1055681565 9:78721048-78721070 GCTGAGGAGGAGGATGGGGAGGG + Intergenic
1055951367 9:81732770-81732792 GCTGGGAATGAGGAAGGGGCTGG + Intergenic
1056512828 9:87321869-87321891 ATGGAGTAGGAGGAAGGGGCTGG - Intergenic
1056893786 9:90521952-90521974 CCTGAGAAGGAGGAATGAGAAGG - Intergenic
1056906046 9:90648750-90648772 CCCCAGTAGGAGGAGGGGGCAGG - Intergenic
1056919400 9:90772742-90772764 ACTGAGAAGCAGGAAGGAGTAGG + Intergenic
1057165133 9:92919846-92919868 CCTGAGAAGCAAGGATGGGCAGG - Intergenic
1057573316 9:96219869-96219891 CCTGAGAGGTCGGAAGAGGCGGG + Intergenic
1057709687 9:97428151-97428173 CCTAACAAGGAGGAAGAGGGTGG - Intronic
1058743271 9:107965672-107965694 CCTCGGAAGGAGTAAGGGACAGG - Intergenic
1059176909 9:112175786-112175808 GCTGTGATGGAGGGAGGGGCTGG + Intergenic
1059176919 9:112175857-112175879 GCTGTGATGGAGGTAGGGGCTGG - Intergenic
1059343610 9:113613448-113613470 CATGAGGAGGAGGAAGGGTGTGG + Intergenic
1059692101 9:116695595-116695617 CAGGAGAAGGAGGAAGTGGAGGG - Intronic
1059825793 9:118027510-118027532 CCAGGGCAGAAGGAAGGGGCGGG - Intergenic
1060200646 9:121650280-121650302 CCTGACCAGGGGGGAGGGGCAGG - Intronic
1060493773 9:124103150-124103172 CCAGTGAAGGAAGCAGGGGCTGG - Intergenic
1060680064 9:125554362-125554384 CCTAGGATGGAGGAAGGGGTTGG + Intronic
1060707300 9:125815842-125815864 AATGAGAAGGAGGTAGGAGCCGG - Intronic
1060830263 9:126709346-126709368 CAGGAGAAGCAGGAAGGAGCAGG + Intergenic
1060903388 9:127281604-127281626 CCAGAGTAGGGGGAAGGGGTAGG - Intronic
1061009299 9:127945753-127945775 CCTGGAAGGCAGGAAGGGGCAGG + Exonic
1061196793 9:129110957-129110979 CCTGTGGAGGAGGAAGGAGGAGG + Intronic
1062482596 9:136759417-136759439 CCTGGGAAGGGGCAGGGGGCAGG - Intergenic
1062502261 9:136856634-136856656 CCTGAGAAGGTGGAAGCTCCGGG - Intronic
1185575073 X:1164888-1164910 GCTGACCAGGAGCAAGGGGCCGG - Intergenic
1185774871 X:2794156-2794178 CCAGGGAAGGAGGGAAGGGCAGG + Intronic
1186462646 X:9760592-9760614 CCTGATCAGCAGGATGGGGCAGG + Intronic
1186517754 X:10179227-10179249 CCTGCGAGGGTGAAAGGGGCCGG + Intronic
1186670634 X:11764237-11764259 CCGGGGAGGGTGGAAGGGGCAGG + Intronic
1186976978 X:14917913-14917935 CCTGAGAAGGCTGAAAGTGCGGG + Intronic
1187377808 X:18772246-18772268 GCTGAGGAGGAGGAAGAGGCGGG + Intronic
1188079927 X:25826492-25826514 GCTAAGAAGGAATAAGGGGCAGG + Intergenic
1188114162 X:26223347-26223369 ACTGAGATGGTGGCAGGGGCTGG - Intergenic
1188156399 X:26748296-26748318 CTGGAGAAGGAGGAAGAGGAGGG + Intergenic
1188348098 X:29093322-29093344 CCAGAGCAGGAGGAGGGGGGTGG + Intronic
1189208121 X:39259310-39259332 GCTGAGAAGAAGGAAGGGGGAGG - Intergenic
1189300125 X:39946513-39946535 CATGAGAAGGAGGAAAGGGAAGG - Intergenic
1189751988 X:44231537-44231559 TCTGAGAAGGATAAAGGGGGAGG - Intronic
1190054651 X:47174630-47174652 CCAAAGAAGGAGGGAGGGGATGG - Intronic
1190491883 X:50990618-50990640 GCAGAGAGGGAGGCAGGGGCTGG - Intergenic
1190501279 X:51081062-51081084 GCAGAGAGGGAGGCAGGGGCTGG + Intergenic
1190634000 X:52416974-52416996 CCTGAGAAGGTGGGAGGCGTGGG + Intergenic
1190712765 X:53081807-53081829 GCTGGGATGGGGGAAGGGGCAGG + Intergenic
1190895427 X:54613803-54613825 CCTGTGGAGGTGGCAGGGGCAGG + Intergenic
1192125639 X:68498737-68498759 CCTGAGAACGGGAAATGGGCGGG + Exonic
1192178759 X:68902478-68902500 CCTCTGAAGTAGCAAGGGGCTGG - Intergenic
1193547428 X:82846921-82846943 CCAGAGCAGGAGGAAGTGGGAGG - Intergenic
1194078882 X:89433009-89433031 ACTGAGATGGTGGAAGGGGGAGG - Intergenic
1195322023 X:103728159-103728181 CCAGAGAAGAAGGAAGGAGAGGG + Exonic
1195385255 X:104308129-104308151 GCTGAGAAGGAGGAAGGCAAGGG - Intergenic
1195513468 X:105744731-105744753 CCTGAGAATAAGGAAGTGGTAGG - Intronic
1195650443 X:107278069-107278091 CCAGAGCAGGAGGAAGTGGGGGG - Intergenic
1195688330 X:107604453-107604475 CCAGAGAGGGAGAAAGGTGCAGG - Exonic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196654366 X:118201645-118201667 CCAGAGAATGAGGCAGGGGATGG - Intergenic
1196794707 X:119492820-119492842 CCTGACAAGAATGCAGGGGCAGG - Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1197033670 X:121849244-121849266 CAGGAGGAGGAGGAAGGGGGAGG - Intergenic
1197906096 X:131427346-131427368 GATGAGAAGGAGGAAGGAGGAGG - Intergenic
1198313160 X:135439027-135439049 CGTGGGAAAGAGGAAGGGGACGG + Intergenic
1199600833 X:149540269-149540291 CGTGAGAAGTAGGGCGGGGCTGG - Intergenic
1200104200 X:153703329-153703351 CTTGGGAAGGAGGCAGGGCCAGG - Intronic
1200374282 X:155763287-155763309 ACTGAGAAGTTGGAAGGGGGAGG - Intergenic
1200431506 Y:3088331-3088353 ACTGAGACGGTGGAAGGGGGAGG - Intergenic
1201607306 Y:15801111-15801133 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic