ID: 1103844632

View in Genome Browser
Species Human (GRCh38)
Location 12:123892871-123892893
Sequence AGCAGAAATATCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 7, 3: 72, 4: 312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103844629_1103844632 -9 Left 1103844629 12:123892857-123892879 CCTCCCTTGCAACAAGCAGAAAT 0: 1
1: 0
2: 1
3: 9
4: 175
Right 1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG 0: 1
1: 0
2: 7
3: 72
4: 312
1103844625_1103844632 23 Left 1103844625 12:123892825-123892847 CCTGGCCTTGACCTATTAGATGC 0: 1
1: 2
2: 16
3: 123
4: 577
Right 1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG 0: 1
1: 0
2: 7
3: 72
4: 312
1103844627_1103844632 12 Left 1103844627 12:123892836-123892858 CCTATTAGATGCCAGTAGCAACC 0: 3
1: 41
2: 284
3: 776
4: 1255
Right 1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG 0: 1
1: 0
2: 7
3: 72
4: 312
1103844628_1103844632 1 Left 1103844628 12:123892847-123892869 CCAGTAGCAACCTCCCTTGCAAC 0: 1
1: 0
2: 0
3: 8
4: 154
Right 1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG 0: 1
1: 0
2: 7
3: 72
4: 312
1103844626_1103844632 18 Left 1103844626 12:123892830-123892852 CCTTGACCTATTAGATGCCAGTA 0: 1
1: 2
2: 18
3: 144
4: 639
Right 1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG 0: 1
1: 0
2: 7
3: 72
4: 312
1103844624_1103844632 24 Left 1103844624 12:123892824-123892846 CCCTGGCCTTGACCTATTAGATG 0: 1
1: 2
2: 22
3: 143
4: 655
Right 1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG 0: 1
1: 0
2: 7
3: 72
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103844632 Original CRISPR AGCAGAAATATCTCCAGACA TGG Intronic
900884885 1:5408103-5408125 ACCAAAAGTGTCTCCAGACATGG + Intergenic
902175442 1:14646688-14646710 AACAAAAATGTCTCCAGACATGG + Intronic
902176384 1:14653988-14654010 ACCAAAAATATCTCCAGGCCAGG + Intronic
905352859 1:37359541-37359563 ACCGGAAATGTCTCCAGTCATGG + Intergenic
905751136 1:40465090-40465112 GTCAAAAATGTCTCCAGACATGG + Intergenic
905775795 1:40666301-40666323 ACCAAAAATGTCTCCAGACATGG - Intergenic
908217517 1:61969512-61969534 AACAGACATTTCTCCAAACATGG - Intronic
908258261 1:62319681-62319703 TGCAGAAACAGCACCAGACAAGG + Intergenic
908458643 1:64328196-64328218 AGGAGAAATTTCTCCAGGGAAGG - Intergenic
908600141 1:65729873-65729895 AGCAGAAAGATCTCTATACCAGG - Intergenic
909373646 1:74915519-74915541 AACAGACATATCTCCAAAGAAGG - Intergenic
909789925 1:79663252-79663274 ACCAGAAATTTATACAGACAGGG - Intergenic
910977239 1:92919686-92919708 AGTAAAAATTTATCCAGACAAGG + Intronic
910993722 1:93081679-93081701 AGTAGAAATTTCTCCAGTGATGG + Intronic
911231096 1:95362528-95362550 AGAAAAGATCTCTCCAGACAAGG + Intergenic
911693528 1:100862325-100862347 ACCAAAAATCTCTCCAGACGTGG + Intergenic
912702005 1:111885010-111885032 ACCAAAAATGTCTCCAGACATGG + Intronic
913720686 1:121590327-121590349 AACAGAAATATATCCACACTTGG + Intergenic
915607467 1:156961850-156961872 ACTAAAAATGTCTCCAGACATGG - Intronic
916618346 1:166468408-166468430 AAGAGAAATACCTCCAAACACGG + Intergenic
917713871 1:177713847-177713869 AGCATAAGTGTCTTCAGACATGG - Intergenic
918199797 1:182256305-182256327 AAAAAAAATAACTCCAGACATGG - Intergenic
918417504 1:184326818-184326840 ACCAAAAATGTCTCTAGACATGG + Intergenic
918867497 1:189921515-189921537 GGCAGAAATTCCCCCAGACAAGG + Intergenic
920217690 1:204373061-204373083 AGAAAAAATATAGCCAGACATGG - Intronic
921028915 1:211319199-211319221 ATCAAAAATGTCTCCAGACATGG + Intergenic
921124668 1:212166776-212166798 AGCAGACATTTTTCCAAACAGGG + Intergenic
921511310 1:216034082-216034104 AGGAAAAATATCTGAAGACAAGG + Intronic
922732374 1:227957080-227957102 AGAAGAAATAAGTCCAGGCATGG - Intergenic
922850675 1:228731234-228731256 AGCACAAATATATCCACATAAGG + Intergenic
924862140 1:247936251-247936273 AGCAGAAATATTTCTACAAATGG - Intergenic
1063810354 10:9697824-9697846 AGAAGACAGATCTTCAGACATGG - Intergenic
1063869483 10:10402204-10402226 AGCAGAAATAACGGCAGATAAGG + Intergenic
1064789766 10:18944101-18944123 AGAAGAAATAACTCCACAAAAGG + Intergenic
1064815011 10:19251228-19251250 TGGAGAATTATCTCCAAACAGGG - Intronic
1066314945 10:34235867-34235889 AGCTGAAATGTTTCCAAACATGG + Intronic
1067059312 10:43069800-43069822 AGCAGAAGACTCTCCAGATAGGG + Intergenic
1067217150 10:44312596-44312618 AGCAGAAGTGTCTCAAGTCATGG + Intergenic
1067696409 10:48538516-48538538 AGCAGAAGACTCTCCAGACCTGG + Intronic
1068163401 10:53297636-53297658 AGCAGAAAGCTGTCCAGTCATGG + Intergenic
1069064068 10:63924088-63924110 TCCAGAAATATCCCCACACACGG - Intergenic
1069767495 10:70874019-70874041 AGCATCAGTATCTCCAGAAATGG - Intronic
1070618174 10:77985498-77985520 ACCAGAAATAGGTACAGACAGGG + Intronic
1071542569 10:86500555-86500577 ATCAGAAATATCTCCAATCAAGG - Exonic
1072024056 10:91436339-91436361 AGAAGAAATAACTAAAGACACGG - Intronic
1072305269 10:94101031-94101053 TGCAGAAATAGCTCCCCACAGGG - Intronic
1072772846 10:98156970-98156992 ACCAAAAATATTTTCAGACATGG - Intronic
1072986517 10:100145632-100145654 AACAGACATTTCTTCAGACAAGG - Intergenic
1074313375 10:112341404-112341426 ATGAGAAATGTCTCCAGACATGG - Intergenic
1075060219 10:119251992-119252014 TGCAGCAATATCTCAAGGCAGGG - Intronic
1075538890 10:123295708-123295730 AACTAAAATGTCTCCAGACATGG + Intergenic
1075635346 10:124026869-124026891 AGGGGAAATACCTCCAGTCAGGG + Intronic
1076092628 10:127701494-127701516 AGCAGTATTATTTCCACACACGG - Intergenic
1076095626 10:127733297-127733319 ACCAAAAATGTCTTCAGACATGG - Intergenic
1077590568 11:3487803-3487825 ACCAAAATTGTCTCCAGACATGG - Intergenic
1078459194 11:11500475-11500497 ACCAAAAACATCTCCAGACATGG - Intronic
1078780659 11:14435999-14436021 AGGAGACATATCTACAGACAGGG + Intergenic
1078919103 11:15810429-15810451 AGCAGAACCATATCCAGACGTGG + Intergenic
1079894809 11:26104933-26104955 AGCTGAAATGTCTAGAGACAAGG - Intergenic
1080359558 11:31496169-31496191 AAAAGACATCTCTCCAGACAAGG + Intronic
1081591271 11:44424904-44424926 ATCAAAAATGTCTCCAGCCATGG - Intergenic
1082094270 11:48115151-48115173 AGCAGAAAACTCTCCAAACCTGG + Intronic
1082989026 11:59191532-59191554 ACCAAAAATGTCTCCAGACATGG - Intronic
1084246289 11:67859584-67859606 ACCAAAATTGTCTCCAGACATGG - Intergenic
1084359626 11:68661088-68661110 ACCAGCGATGTCTCCAGACATGG + Intergenic
1084660106 11:70541692-70541714 ACCAAAAATATCTCCCAACATGG - Intronic
1084826393 11:71734916-71734938 ACCAAAATTGTCTCCAGACATGG + Intergenic
1088193524 11:107251970-107251992 TTCAGAAATATCTCCAGCCTAGG + Intergenic
1089473976 11:118743502-118743524 ACCAAAAATATCTACAGATAAGG + Intergenic
1089514211 11:119021470-119021492 AGCAGAAACATTGCCAGGCAGGG - Intronic
1089575000 11:119435649-119435671 ACCAAAAATGTCTCCAGACATGG - Intergenic
1089656155 11:119948344-119948366 AGGAGAAATATTTCCAGAGATGG + Intergenic
1091777534 12:3194297-3194319 AGCAGACCTTTCTCCAGAGAGGG + Intronic
1092416855 12:8296708-8296730 ACCAAAATTGTCTCCAGACATGG - Intergenic
1093199434 12:16169329-16169351 AACAAACATATCTCAAGACATGG - Intergenic
1094165075 12:27435316-27435338 ACCAAAAATGTCTGCAGACAGGG + Intergenic
1096431769 12:51550293-51550315 AGCTGAAATATTTCCACAAAGGG + Intergenic
1096928804 12:55180869-55180891 AGCAGAAACATCTGCATAAAGGG - Intergenic
1097873715 12:64623937-64623959 AACAGAAATATGGCCGGACATGG - Intronic
1098572476 12:72004381-72004403 AGAAGAAGTATTTCCAGACCTGG - Intronic
1098714296 12:73810209-73810231 ACTAGGAATATCTCCAGACCTGG + Intergenic
1098983284 12:76983398-76983420 GGCAGAAAAATCTCCAGATCTGG - Intergenic
1099069841 12:78032080-78032102 AGGAGAAATAGTTTCAGACATGG - Intronic
1099827909 12:87802271-87802293 AGCAAAAATGTTTCCAGAAATGG - Intergenic
1100698777 12:97124029-97124051 AGTAGAAATATTTCCAGGCTGGG + Intergenic
1101268116 12:103113538-103113560 ACCCAAAATGTCTCCAGACATGG - Intergenic
1103241549 12:119417528-119417550 AGCAGAAGTAACTCCATAAAAGG - Intronic
1103844632 12:123892871-123892893 AGCAGAAATATCTCCAGACATGG + Intronic
1104428643 12:128698358-128698380 AGCAGAAAGTCCTGCAGACAAGG - Intronic
1104615919 12:130268495-130268517 ACCAAAAATGTCTCCAGACATGG - Intergenic
1107377122 13:39815934-39815956 ATCAAAAATATCTCCAGACATGG + Intergenic
1107871143 13:44747853-44747875 AGCAAATATATCTCAAGAAAAGG + Intergenic
1108552325 13:51558984-51559006 AGAAGAAGTATCTGGAGACAGGG - Intergenic
1108698527 13:52924326-52924348 ACCAAAAATGTCTCTAGACATGG - Intergenic
1108915738 13:55608680-55608702 ACCAAAAATATTTCCAGACATGG - Intergenic
1109680994 13:65752389-65752411 AGAAGACATATCCCCAGAAAAGG - Intergenic
1110975451 13:81828102-81828124 AGCATAAATATGGCCAAACATGG - Intergenic
1112239098 13:97663575-97663597 TGCAGAAACACCTCCAGAAAAGG + Intergenic
1113313554 13:109155655-109155677 TGCAGAAATATATCAAGAGAGGG - Intronic
1114792483 14:25675076-25675098 AGCAGAAAAATCACTAGCCAGGG - Intergenic
1115862091 14:37698801-37698823 TGCAGAAATATCTCAAGAAATGG - Intronic
1116352895 14:43888137-43888159 ACCATAAATGTCTTCAGACATGG + Intergenic
1121148052 14:91603928-91603950 AATAGACATTTCTCCAGACAAGG - Intronic
1121690173 14:95872614-95872636 AGCAGAAATATTTCAAGTCCAGG - Intergenic
1122686206 14:103508570-103508592 AGAAGAAAAACCTCCATACATGG + Intergenic
1123892538 15:24795659-24795681 AGAAGAAATCTGTCCAGGCACGG - Intergenic
1126141590 15:45443804-45443826 GGTAGAAACATCACCAGACATGG - Intronic
1126589573 15:50325402-50325424 AGCAGAAACAGAACCAGACAGGG - Intronic
1128430235 15:67586275-67586297 AGCATAAATATGTCAAGAGAGGG - Intronic
1129301642 15:74628944-74628966 AGCAGAAATATTTCTACAAAGGG + Exonic
1130385358 15:83406749-83406771 ATCACAACTCTCTCCAGACAAGG - Intergenic
1130430839 15:83845385-83845407 AGCAGAATCATCTCCAGCGAAGG - Intronic
1130789881 15:87142872-87142894 AGCAGGAGCATCTCCAGCCATGG + Intergenic
1130935170 15:88464060-88464082 ACCAAAAATATCTCTAGACATGG - Intronic
1130980444 15:88808586-88808608 ACAAAAAATGTCTCCAGACATGG - Intronic
1131091927 15:89629975-89629997 ACCAAAAGTATCTCCAGCCATGG + Intronic
1131156389 15:90078610-90078632 ACCATAAATGTCTCCAAACATGG - Intronic
1131394191 15:92073795-92073817 AGCAAAACTGTCTTCAGACATGG + Intronic
1131529319 15:93178660-93178682 AGCCTAAATGTCTCCAGCCACGG - Intergenic
1132029576 15:98428936-98428958 ACCAAAAATATCTCCAGACATGG + Intergenic
1133174811 16:4006142-4006164 ACCAAAAATGTCTCCAGACATGG - Intronic
1133274836 16:4631464-4631486 ATCACAAATGTCTCCAGACATGG - Intronic
1133355937 16:5136888-5136910 ACCAAAACTGTCTCCAGACATGG - Intergenic
1133661675 16:7924293-7924315 ACCACCACTATCTCCAGACATGG - Intergenic
1133755377 16:8758679-8758701 ACCAAAAATGTCTGCAGACATGG + Intronic
1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG + Intronic
1134213406 16:12297014-12297036 ATCACAAATGTCTCCAGACATGG + Intronic
1134251106 16:12574799-12574821 AACAGACAGATGTCCAGACATGG + Intergenic
1134394194 16:13848095-13848117 AGCCAAAATGTCTCCAGACATGG + Intergenic
1134827411 16:17295707-17295729 AACAAAAATGTCTCCAGACATGG - Intronic
1134860430 16:17555670-17555692 ATCAAAAATGTCTCCAGACATGG + Intergenic
1135142441 16:19933171-19933193 TCCAAAAATGTCTCCAGACATGG - Intergenic
1135247049 16:20866181-20866203 AGCTGAATTATCTCAAAACAAGG + Intronic
1135500673 16:22993205-22993227 AGGAGAAACATCTCCAAACTGGG + Intergenic
1135935662 16:26777667-26777689 TGCAGCATTATCTCCAGTCACGG - Intergenic
1137294064 16:47073409-47073431 AGCAAAACTGTCCCCAGACATGG - Intergenic
1137547265 16:49413035-49413057 TGGAGAAGTATCTCCAGGCAGGG - Intergenic
1139027189 16:62833138-62833160 ATCAGAAAGATCACCAGATATGG + Intergenic
1141746713 16:85931070-85931092 ACCAAAAATGTCTCCAGACATGG - Intergenic
1142330894 16:89452684-89452706 GGCAGGAAAATCTCCAGACCTGG + Intronic
1143317837 17:6046080-6046102 AACCAAAATATCTCCAGGCATGG - Intronic
1143690930 17:8564878-8564900 AGAAGAAATATCCTCAGATATGG + Intronic
1143965955 17:10756642-10756664 ACCAGAAATGTCTCCAAACCTGG + Intergenic
1144757867 17:17691185-17691207 ACCAAAAATGTCTCCTGACATGG - Intronic
1146200045 17:30849159-30849181 AGCAAAAATATAGCCAGGCACGG - Intronic
1146519538 17:33515516-33515538 AGTAGGAATAACTCAAGACACGG + Intronic
1146720096 17:35118157-35118179 ATCAAAAATGTCTCCTGACATGG - Intronic
1147011368 17:37451472-37451494 ACCAAAAATATAGCCAGACATGG - Intronic
1147855119 17:43473932-43473954 ACCAAAAATGTCTCCAGACATGG - Intergenic
1148620166 17:49028657-49028679 AGCAGATATCCTTCCAGACAGGG - Intronic
1149345416 17:55729400-55729422 AGCAGAAATAGGTCAGGACAAGG + Intronic
1150201032 17:63357799-63357821 AGCAGGACTCTCTCCAGGCATGG + Intronic
1151179119 17:72312903-72312925 AGCAAAACTGTCTCCAGACATGG + Intergenic
1151351696 17:73535752-73535774 AGCAGAAATCTCTCTATCCATGG + Intronic
1152240837 17:79160158-79160180 AGCAGACATAGCTCCAGGCCGGG + Intronic
1152557760 17:81062938-81062960 AGCACAAACATCTCCAGAGCTGG - Intronic
1154930259 18:20987278-20987300 AGCAGAAATCTCTAAAGAAAAGG + Intronic
1155637607 18:27974382-27974404 AGCAGAAAGATCTGGAAACATGG - Intronic
1155775346 18:29754193-29754215 AACAGAAATCTCTCCAGCCTGGG - Intergenic
1156688076 18:39673976-39673998 AACAGAAATATCATCAGAGAAGG + Intergenic
1157775389 18:50391437-50391459 ACCAAAAATGTCTCCAGACATGG - Intronic
1157907644 18:51583901-51583923 AGCTGAAGTATCTCCATGCATGG - Intergenic
1158156695 18:54433706-54433728 AGCTTTAATATCTCCAGAGAAGG + Intergenic
1158360101 18:56662788-56662810 ATCAGAAAAATCTTCAGATATGG + Intronic
1160938960 19:1611030-1611052 AGCAGAAATAGCGAGAGACACGG + Exonic
1161121215 19:2527810-2527832 AGCACAAATGTCCCCAGACTTGG + Intronic
1161328660 19:3675861-3675883 ACCACAGATGTCTCCAGACATGG + Intronic
1161523049 19:4736558-4736580 ACCACAAATGTCCCCAGACATGG - Intergenic
1161652095 19:5491707-5491729 AGCACAAATACCCCCAGACATGG - Intergenic
1161938060 19:7384294-7384316 ATCAAAAATGTCTCCAGACATGG + Intronic
1163399491 19:17083498-17083520 ACCAGAAATGTCTCCAGACATGG + Intronic
1165794636 19:38511818-38511840 GACAGACCTATCTCCAGACAAGG + Intronic
1168421586 19:56207679-56207701 AACAAAAATGTCTCTAGACATGG - Intronic
1168504895 19:56925333-56925355 ATCACAAATTTCTCCAGACATGG - Intergenic
925520927 2:4744961-4744983 AACAGAAATATCACCAATCAAGG + Intergenic
925788698 2:7459020-7459042 AGCAGAACTATATACATACATGG - Intergenic
926952614 2:18260189-18260211 AGGAGAAATCTCTCAAGACCTGG + Intronic
927476680 2:23419287-23419309 AGCAGAAATGACTCAAGAGAGGG - Intronic
929607312 2:43243290-43243312 ACCAAAAATGTCTCCAGACACGG - Intronic
930293789 2:49529091-49529113 AGAAGATATATCTACAGAAAAGG + Intergenic
931334830 2:61328979-61329001 AGCAGAAATAAAACCACACATGG - Intronic
931750528 2:65326034-65326056 AGCAGCAGCATCTGCAGACAAGG - Intronic
935210559 2:100936386-100936408 AGCAGAAAAATGTCCAGATTCGG + Intronic
936376084 2:111942520-111942542 AGGACAAATATCTCCAAATAAGG - Intronic
936962539 2:118090789-118090811 AGCAGGAAGAACTCCGGACATGG + Intronic
940797406 2:158095096-158095118 GACAGAAATTGCTCCAGACAGGG + Intronic
942773823 2:179556560-179556582 GCCAAAATTATCTCCAGACAGGG + Intronic
943093926 2:183405563-183405585 AGGAGGAATATCTCCTGCCAAGG - Intergenic
945249822 2:207755390-207755412 AGAAGAAAAATGTTCAGACAAGG + Intronic
945687190 2:212985853-212985875 AGAAGAAAAATCGCCAGAAAAGG - Intergenic
946554461 2:220839823-220839845 AGCAGAAATATGTTCAGGCATGG - Intergenic
947476243 2:230450038-230450060 CGCAGCAATATATGCAGACAGGG + Intronic
947704386 2:232262506-232262528 ATCAAAAATGTCTCCAGACATGG - Intronic
947780459 2:232756233-232756255 AGCAGCACTATTTACAGACATGG - Exonic
1170472645 20:16683623-16683645 ATCAAAAATGTCTCCAGACCAGG - Intergenic
1170882121 20:20305881-20305903 AGCAGAAACATCTCTAGGTAAGG - Intronic
1171024790 20:21620115-21620137 CCCAGAAATAAATCCAGACATGG + Intergenic
1171802794 20:29641661-29641683 AGAAGAAATGTATCAAGACATGG - Intergenic
1172049182 20:32103289-32103311 AGCAGCCATATCTCCAGACCAGG - Intergenic
1172301327 20:33852571-33852593 ACCAAAAATGTCTTCAGACATGG + Intronic
1173386748 20:42595412-42595434 AGCAGAAATGGGTCCAGATACGG + Intronic
1175091591 20:56509185-56509207 AGCAGACATTTCTCCAGAGAAGG + Intronic
1175154339 20:56959554-56959576 ACCAAAAATGTCTCCGGACATGG + Intergenic
1175266339 20:57705777-57705799 GCCAGAAATGTCTCCAGACATGG - Intronic
1175579238 20:60086426-60086448 AGCAGAAAAAGCTCCAGGCCTGG + Intergenic
1175837608 20:62006237-62006259 ACCAGTAACATCCCCAGACAAGG + Intronic
1177547655 21:22579389-22579411 AGCAGAAATAGGGCCAGGCACGG - Intergenic
1179025700 21:37676705-37676727 ATCAAAAATGTCTCCAGACATGG - Intronic
1180577249 22:16789807-16789829 AGCACAAATAAATCCACACACGG + Intronic
1181775017 22:25153329-25153351 ACCAAAAATGTCTCCAGACAAGG - Intronic
1181974850 22:26721662-26721684 ACCAAAAACATCTCAAGACATGG - Intergenic
1183173756 22:36206797-36206819 AGCAAAAGAATCTCCAGTCACGG + Intergenic
1183396744 22:37575998-37576020 ACCAAGAATGTCTCCAGACAGGG + Intronic
1183725807 22:39589120-39589142 ACCAAAAATGTCTCCAGACACGG + Intronic
1183992543 22:41607640-41607662 ACCAAAAATATCTCTGGACATGG + Intronic
1184751920 22:46491168-46491190 AACCGAAACATCTCCAGACATGG + Intronic
949644793 3:6080668-6080690 AGCAGAAATTTCCACAGACCTGG - Intergenic
950766407 3:15276410-15276432 AACTGAAATAGCTCCAGACTAGG - Intronic
950828314 3:15848911-15848933 AGCAAAATTATCTCTAGTCACGG + Intronic
951657297 3:25023853-25023875 TGCAGAAATATCTCTAGATGTGG + Intergenic
952000144 3:28775698-28775720 ATCAAAAATGTCTCCAGGCATGG - Intergenic
953394640 3:42558024-42558046 ACCAGAAATGACTCCAGACATGG - Intronic
953655752 3:44852763-44852785 AGAAGAAACATCTTCAAACAAGG - Exonic
953744329 3:45561803-45561825 AGAAGAAAGAACTCCAGAAATGG - Intronic
955193687 3:56785319-56785341 AGCAGTAAAATCTCAAGATAAGG + Intronic
955738836 3:62067867-62067889 ACCAAAAATGTCTCTAGACATGG + Intronic
955761784 3:62292670-62292692 AGCAAAAAAGTCTCCAGACATGG - Intronic
955775435 3:62427595-62427617 ACCAGGAATGTCTCCAGACATGG + Intronic
955778902 3:62462859-62462881 GGCAGGAATATCTCCACACATGG - Intronic
957355142 3:79073738-79073760 AGCACAAATGTGTTCAGACAAGG - Intronic
958896950 3:99840004-99840026 GACAATAATATCTCCAGACATGG - Intronic
959484718 3:106913555-106913577 AGCAGAAATATTTCAAGGTAGGG - Intergenic
960198481 3:114800801-114800823 AGCAAGAATCTTTCCAGACAGGG + Intronic
960603741 3:119483808-119483830 ATCAAAAATGTCTACAGACATGG + Intronic
961779635 3:129314186-129314208 AGCAGAAGGATCTCCAGCCCTGG - Intergenic
961894407 3:130155309-130155331 ACCAAAATTGTCTCCAGACATGG - Intergenic
962399689 3:135047800-135047822 AACCAAAATGTCTCCAGACATGG - Intronic
963548893 3:146696451-146696473 AGCAGAGATTTCTGCACACAGGG - Intergenic
964194331 3:154045238-154045260 AGCAGAAACATATAAAGACAGGG - Intergenic
964249330 3:154692363-154692385 ACCAAAAATGTCTACAGACATGG - Intergenic
964880710 3:161419652-161419674 ACCACAACTATCTCCAGACATGG + Intergenic
965552927 3:169987812-169987834 AGAAGAAGAATCTCCAGAGAGGG + Intronic
967297525 3:187979691-187979713 AGCAGCAATATTGCCATACAGGG - Intergenic
969004497 4:4008388-4008410 ACCAAAACTGTCTCCAGACATGG - Intergenic
969249716 4:5959036-5959058 ACCAAAAATGTCTCCAGACATGG + Exonic
969737065 4:8999222-8999244 AGCAGAATTATTTCATGACAGGG + Intergenic
969748371 4:9091760-9091782 ACCAAAACTGTCTCCAGACATGG + Intergenic
969809402 4:9636319-9636341 ACCAAAACTGTCTCCAGACATGG + Intergenic
969885556 4:10212236-10212258 AGAAGAAAGTTTTCCAGACATGG - Intergenic
971258336 4:25033193-25033215 ACCCCAAATATCTCCACACATGG - Intergenic
971949374 4:33324910-33324932 TGCAGAAATATCTGCAGAATGGG + Intergenic
972073912 4:35059362-35059384 AGTAGATATAGCTCCAGGCAAGG + Intergenic
972284596 4:37636303-37636325 AGCAGAAATATGGCCAGGCGTGG + Intronic
974797958 4:66778789-66778811 AGCAGAAATTTTTCCATAAAAGG + Intergenic
975153237 4:71043780-71043802 AGCAGACATTTCTCCAAAGAAGG + Intergenic
975464219 4:74691346-74691368 AACAGAAACATCTTCAGACCAGG + Intergenic
975818577 4:78245939-78245961 ACCAGAAATCTTTGCAGACATGG + Intronic
976130886 4:81882702-81882724 AGCAGAGACCACTCCAGACAAGG - Intronic
976180229 4:82391917-82391939 ACCAGAAAGCTCTCCAGTCATGG - Intergenic
976337393 4:83906162-83906184 ACCAAAAATGTCTCCAGACATGG + Intergenic
976618688 4:87105324-87105346 AGCAGAACTACCACAAGACAAGG - Intronic
977335386 4:95691911-95691933 AGAGAAAATATCTCCAAACACGG - Intergenic
977414263 4:96711297-96711319 AACAGAAATAACTCCAGTTAAGG + Intergenic
978968479 4:114772478-114772500 AGTAGACATATCTCGGGACAAGG - Intergenic
981143940 4:141303413-141303435 TGCAGAAATATCTAGAAACAAGG - Intergenic
981649777 4:147043657-147043679 AGCAGAAAGATCCCCAGCCATGG + Intergenic
981735840 4:147949457-147949479 ATCAGTAATGTCTCCAAACATGG - Intronic
983221191 4:165045967-165045989 AGTAGAAATGTCTCCAGGCCTGG - Intergenic
983531324 4:168812632-168812654 TGCAGAAATATCTCCTGAGATGG - Intronic
983646828 4:170000010-170000032 ACCAAAAATGTCTCCAGACTTGG + Intronic
984498736 4:180532013-180532035 ACCAAAAATGTCTCCAGAAATGG - Intergenic
985354145 4:189099055-189099077 AGCAGAAATATGTGTAGACAAGG - Intergenic
986596636 5:9429607-9429629 ATCAGGAATATCTCCTGACAAGG + Intronic
987259726 5:16190910-16190932 ACCAAAAATGTCTCCAGACATGG - Intergenic
987433404 5:17864176-17864198 AGCTGAAAGATTTCCAAACAGGG + Intergenic
988292703 5:29310149-29310171 AGCACAAATATCACAACACAGGG - Intergenic
988474281 5:31569273-31569295 AGCAGAAAAATGAACAGACAAGG + Intergenic
989133917 5:38134648-38134670 ACCAAAAATATCAGCAGACATGG - Intergenic
989371725 5:40717617-40717639 AACAAAAATGTCTCTAGACATGG + Intronic
989854446 5:46263934-46263956 AAAAGAAATATCTTCAGATAAGG - Intergenic
990669526 5:58112558-58112580 ACTAAAAATGTCTCCAGACATGG + Intergenic
991611877 5:68457928-68457950 ACCAGAAATGTTGCCAGACATGG + Intergenic
993034852 5:82745501-82745523 ACCAAAACTGTCTCCAGACATGG + Intergenic
994109771 5:95988136-95988158 AGCAAAAATGTCTCCACACAAGG - Intergenic
994264155 5:97694832-97694854 AGCAGGAATAACACCAGACTTGG - Intergenic
994436899 5:99747761-99747783 AGCAGAAAAATTTCCCAACACGG - Intergenic
995434416 5:112119800-112119822 ACCACAAATCTCTCCAGAAAAGG + Intergenic
996078690 5:119230094-119230116 AGTAGACATAACACCAGACAAGG + Intronic
997868247 5:137483755-137483777 ACCAAAAATGTCTCCAGACAGGG + Intronic
998422780 5:142002888-142002910 AGCAAACAGATCTCCAGAAATGG + Intronic
1000846157 5:166282851-166282873 TGGAGAAATGTCTCTAGACATGG + Intergenic
1000971495 5:167719745-167719767 AACAAAAACATCACCAGACAGGG - Intronic
1001017975 5:168158654-168158676 ATCAAAAATGTCTCCAGACTGGG + Intronic
1002463582 5:179389608-179389630 GTCAAAAATGTCTCCAGACATGG - Intergenic
1004537608 6:16518183-16518205 AGCAGAAATATGGCCAGAGCAGG + Intronic
1004608316 6:17214716-17214738 ATCAAAAATGTCTCCAGACATGG - Intergenic
1004767654 6:18748615-18748637 ACCAGAAATACCTGCAGCCAGGG - Intergenic
1005256292 6:24007002-24007024 AGCAAAAATGTCTCCAGACGTGG - Intergenic
1005500822 6:26427648-26427670 AGCAGAAACATCTGGAGTCACGG - Intergenic
1006751203 6:36378794-36378816 ACTAAAAATGTCTCCAGACACGG + Intronic
1007329346 6:41092633-41092655 AGCAGAAATATCTAGAGCCATGG + Intronic
1007688938 6:43685497-43685519 ACCAAAAATGTCTGCAGACATGG + Intronic
1009213487 6:60891436-60891458 AACAAAAATGTCCCCAGACATGG + Intergenic
1009641699 6:66345711-66345733 ACCAGAAATGACTCTAGACATGG - Intergenic
1009966060 6:70580162-70580184 AGTAGACATTTCTCCAGAGAAGG + Intronic
1012358064 6:98340840-98340862 ACCAAAAATGTCTCCTGACATGG - Intergenic
1012427435 6:99129817-99129839 AGCATAAATCTGGCCAGACAAGG - Intergenic
1013343243 6:109236048-109236070 ACCAGAAGTATCTCCAGACATGG + Intergenic
1014411259 6:121124574-121124596 AACAGAAATATTTCCAAACCTGG - Intronic
1014990621 6:128070902-128070924 AGCAAAAATATCAACAGAAAAGG - Intronic
1019380547 7:719968-719990 AGCAGGAAAATCTTCACACATGG - Intronic
1020324633 7:6964887-6964909 ACCAAAATTGTCTCCAGACATGG - Intergenic
1021398930 7:20186911-20186933 AGAAGAAATAACTTAAGACATGG + Intronic
1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG + Intronic
1021739533 7:23671959-23671981 AGTAGAAAAACTTCCAGACAAGG - Intergenic
1021793041 7:24225514-24225536 AACAAAAATATCTCCACACATGG + Intergenic
1022282773 7:28927606-28927628 AACACAAATCTCTCCAGACAAGG - Intergenic
1022341920 7:29476708-29476730 ATAAAAAATGTCTCCAGACATGG - Intronic
1022846915 7:34219557-34219579 AGCAGGAGTATTTCCAGACTGGG + Intergenic
1023151855 7:37209043-37209065 AGCAGAACACTCCCCAGACAGGG + Intronic
1023901403 7:44483362-44483384 AGCAAAAATATCCTCAGAAATGG + Intronic
1024471258 7:49770646-49770668 AGCAGAAAGATCTCTGGTCAGGG - Intergenic
1024795386 7:53013290-53013312 AGCAAAAATGTCTCCACATAAGG + Intergenic
1024953912 7:54895499-54895521 AGAAGAAATATCCCCAAATATGG - Intergenic
1026579216 7:71599983-71600005 AACCAAAATATCTTCAGACATGG + Intronic
1027128215 7:75572454-75572476 AGCACAAATATCAGCAGACCTGG - Intronic
1028288799 7:89040024-89040046 AACAGAAAAATCTCCAGATCTGG - Intronic
1028759144 7:94475552-94475574 GGCAGGAATGTCTGCAGACAAGG + Intergenic
1029804857 7:102985486-102985508 AGCAGGAAGATCCCCAGAAAGGG + Intronic
1029935967 7:104424578-104424600 ACCAAAAATGTCTCCAGACCTGG - Intronic
1030128504 7:106177704-106177726 AGCAGAAAGATGTACAGAAAGGG - Intergenic
1030490025 7:110220699-110220721 ACCAAAAATATCTTCAGACATGG - Intergenic
1030550225 7:110949059-110949081 AGCCGAAATGTCTCAAAACAAGG - Intronic
1031770952 7:125841815-125841837 ATTAGAAATATATCCAGATATGG + Intergenic
1032022695 7:128418539-128418561 ACCAAAAATGTCTTCAGACACGG - Intergenic
1033656073 7:143375497-143375519 GGCATAAATAACTACAGACAGGG + Intergenic
1035845428 8:2859151-2859173 AGCAGAAGAATTTACAGACATGG + Intergenic
1036371433 8:8166054-8166076 ACCAAAATTGTCTCCAGACATGG + Intergenic
1036519764 8:9480245-9480267 AGAAGACATATCTACAGAGAAGG + Intergenic
1036879470 8:12499590-12499612 ACCAAAATTGTCTCCAGACATGG - Intergenic
1037471460 8:19215407-19215429 TGCAGAAATTTCTCCAAAAAGGG - Intergenic
1038572335 8:28673478-28673500 AGCTGGAACATCTCCAGACTGGG + Intronic
1041030633 8:53732498-53732520 AACAGAAATAACTACAGACAGGG + Intronic
1043390725 8:79789315-79789337 AGCAGAAAAATTTTCACACATGG + Intergenic
1043531519 8:81156513-81156535 AGAAAAAATATCTCTAGACATGG - Intergenic
1044457806 8:92408968-92408990 AGCAGAAATCACACTAGACAAGG - Intergenic
1044709596 8:95043577-95043599 AGTAGACATTTCTCCAGATAAGG + Intronic
1044776599 8:95695437-95695459 GGCATAAATATCTTCAGAGAAGG + Intergenic
1046017586 8:108623798-108623820 ATCAAAAATGTCTCCAGACATGG - Intronic
1047693751 8:127383120-127383142 CCCAAAAATGTCTCCAGACATGG + Intergenic
1050026268 9:1337429-1337451 GCCAAAAATATCTCCAGACACGG - Intergenic
1051229527 9:14941059-14941081 TGCAAAAATATCTCCAGTCTGGG - Intergenic
1051995287 9:23208563-23208585 AACAGAAATATCTGCTAACACGG + Intergenic
1052059087 9:23938782-23938804 AGAAGAAACATCTCAAGAGAAGG - Intergenic
1055357864 9:75455937-75455959 AACAGAAATACCTCTAGACTTGG - Intergenic
1055645140 9:78356102-78356124 ACCAAAAATGTCTCTAGACATGG - Intergenic
1057547803 9:96031222-96031244 AACAGAAATATTTCCAGACAGGG + Intergenic
1058584993 9:106498113-106498135 AGAAGCAATGTCTCCAGGCAAGG + Intergenic
1059269589 9:113063457-113063479 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059270722 9:113068904-113068926 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059271856 9:113074351-113074373 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059272990 9:113079798-113079820 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1059274126 9:113085240-113085262 AGCTGAAAATTCTCCCGACAGGG + Intergenic
1060062578 9:120474362-120474384 ACCAAAAATGTCTCCAGACATGG - Intronic
1060820124 9:126656859-126656881 ATCAAAAATGTCTCCAGACATGG + Intronic
1061701333 9:132418218-132418240 ACCAAAAATGTCTCCAGACGTGG - Intronic
1061712000 9:132494369-132494391 ACCAAAAATATGTCCAGACATGG + Intronic
1185796459 X:2969436-2969458 ACCGGAAATATCTCCAGCCGTGG + Intergenic
1185798899 X:2991692-2991714 AACAAAAATGTCTCCAGACATGG - Intergenic
1186157279 X:6738628-6738650 ACCCAAAATGTCTCCAGACATGG - Intergenic
1186614435 X:11171867-11171889 ACCAGAATTATCTCTAGACATGG + Intronic
1186669599 X:11756469-11756491 AGCAGAACTCTCTCCAATCATGG + Intergenic
1187408347 X:19024585-19024607 ACCAAAAATGTCTCCAGACATGG - Intronic
1188215449 X:27471021-27471043 ACCAAAAATATCTTCAGTCAGGG + Intergenic
1189096939 X:38150433-38150455 ACCAAAAATATCTCCAGACATGG - Intronic
1190855084 X:54286289-54286311 AGCTGAAGTTTCTTCAGACAGGG - Intronic
1191820030 X:65295923-65295945 AGCAAAAATATATCCAGAAAGGG + Intergenic
1192084836 X:68085886-68085908 AGCAGAAATAAAACCAGGCATGG + Intronic
1194613397 X:96071921-96071943 ATCAAAATTATCTCCAGAAAGGG - Intergenic
1195630094 X:107046661-107046683 GCCAAAAATATCTCTAGACATGG - Intergenic
1195999056 X:110761583-110761605 ACCAAAAATGTCTCCAGACATGG - Intronic
1196671422 X:118372258-118372280 AGCAGAAATATCTTAAGCAAGGG - Intronic
1198211836 X:134523421-134523443 AGCATAAATTTCTCCACAAAGGG - Intergenic
1198330082 X:135614402-135614424 ACCACAAATATCTCCTGCCATGG + Intergenic
1198362754 X:135911868-135911890 ACCACAAATATCTCCTGCCATGG + Exonic
1199162091 X:144624829-144624851 ATCAGAAATGTCTCCAGACAGGG - Intergenic
1199271302 X:145885625-145885647 ACCAAAAACATCTCCAGATATGG + Intergenic
1200922001 Y:8621558-8621580 AGCAGAAATAAGTTCAGACAGGG + Intergenic
1201550902 Y:15215423-15215445 ACCCAAAATGTCTCCAGACATGG - Intergenic
1201754591 Y:17472415-17472437 AGAAGAAATGTCTACAGAAACGG - Intergenic
1201846961 Y:18433570-18433592 AGAAGAAATGTCTACAGAAACGG + Intergenic
1201885248 Y:18874883-18874905 AGCAGAATCTTCTCCAGCCAGGG - Intergenic