ID: 1103846099

View in Genome Browser
Species Human (GRCh38)
Location 12:123902920-123902942
Sequence TCGGCTGCAGGGTAGGACAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103846099_1103846109 6 Left 1103846099 12:123902920-123902942 CCCCTGTCCTACCCTGCAGCCGA 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1103846109 12:123902949-123902971 GAAGAAACTGGCAGAGGAAAAGG 0: 1
1: 1
2: 10
3: 94
4: 799
1103846099_1103846106 -6 Left 1103846099 12:123902920-123902942 CCCCTGTCCTACCCTGCAGCCGA 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1103846106 12:123902937-123902959 AGCCGAGGAGAAGAAGAAACTGG 0: 1
1: 0
2: 1
3: 25
4: 440
1103846099_1103846108 0 Left 1103846099 12:123902920-123902942 CCCCTGTCCTACCCTGCAGCCGA 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1103846108 12:123902943-123902965 GGAGAAGAAGAAACTGGCAGAGG 0: 1
1: 0
2: 9
3: 78
4: 747
1103846099_1103846111 21 Left 1103846099 12:123902920-123902942 CCCCTGTCCTACCCTGCAGCCGA 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1103846111 12:123902964-123902986 GGAAAAGGCCATGGAGATAGAGG 0: 1
1: 0
2: 3
3: 55
4: 372
1103846099_1103846110 12 Left 1103846099 12:123902920-123902942 CCCCTGTCCTACCCTGCAGCCGA 0: 1
1: 0
2: 1
3: 13
4: 154
Right 1103846110 12:123902955-123902977 ACTGGCAGAGGAAAAGGCCATGG 0: 1
1: 0
2: 3
3: 41
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103846099 Original CRISPR TCGGCTGCAGGGTAGGACAG GGG (reversed) Exonic
900470247 1:2850145-2850167 TCACCTGCAGGGCGGGACAGAGG - Intergenic
900491110 1:2949661-2949683 CGGGCTGCAGGGTACGGCAGGGG + Intergenic
900491149 1:2949808-2949830 CGGGCTGCAGGGTACGGCAGGGG + Intergenic
900491187 1:2949955-2949977 TGGGCTGCTGGGTACGGCAGGGG + Intergenic
900491199 1:2950004-2950026 TGGGCTGCTGGGTACGGCAGGGG + Intergenic
900721465 1:4178628-4178650 ACGGCTGCAGAGGAGGACAGTGG + Intergenic
902074813 1:13775867-13775889 TCGGCTGCAGGGTGGGTGAAGGG - Intronic
902244377 1:15110704-15110726 TGGGATTTAGGGTAGGACAGTGG - Intronic
904211626 1:28889683-28889705 TAGGCTGCAGGGTGAGACAGAGG + Intronic
907282760 1:53361858-53361880 TAGGCTCCAGGTTAGGCCAGGGG - Intergenic
915623875 1:157102754-157102776 TCTGCTTCAGGGGAGGAAAGGGG - Intergenic
917042311 1:170819457-170819479 CTGGCTGCAGGGTAGCAGAGGGG + Intergenic
918031399 1:180816174-180816196 TGGGCTGGCGGGTAGGAGAGGGG + Intronic
920185532 1:204156875-204156897 AAGGGTGCAGGGGAGGACAGAGG + Intronic
920312494 1:205056819-205056841 CCTGCTGCAGGGCAGGGCAGGGG - Intronic
922801979 1:228368611-228368633 CCGGGGGCAGGGTGGGACAGTGG - Intronic
1062971009 10:1649407-1649429 GTGGCTGAAGGGCAGGACAGGGG - Intronic
1064801183 10:19074223-19074245 TCTGCTGCCTGGTTGGACAGTGG - Intronic
1064987836 10:21228953-21228975 TGGGATGCAGGCTATGACAGAGG - Intergenic
1065092095 10:22245452-22245474 TTGGCTGTAGTGTAGGACTGGGG - Intergenic
1067296731 10:44978987-44979009 TACGCTGCAGGGCAGGAAAGGGG + Intronic
1067542274 10:47164701-47164723 TGGGCAGCATGGTGGGACAGAGG - Intergenic
1069594334 10:69660880-69660902 TCAGCTGGAGGGTGGGAGAGTGG + Intergenic
1072951518 10:99850592-99850614 TTGGCTGCAGCATAGGCCAGAGG + Exonic
1074833147 10:117263842-117263864 TGGGATGGAGGGTAGGACACGGG + Intronic
1076013666 10:127010541-127010563 TCAGCAGCAGGGGAGGTCAGTGG + Intronic
1076674534 10:132141261-132141283 TCAGGTGCAGGGTTGGGCAGGGG + Intronic
1077106343 11:844099-844121 TGGGCAGAAGGGCAGGACAGGGG + Intronic
1080428571 11:32178274-32178296 TTGGCTGCAGGGTGTGTCAGGGG - Intergenic
1080617161 11:33954621-33954643 ACCGCTGCAGTGTAGGAGAGAGG + Intergenic
1081747509 11:45483368-45483390 TGGCAGGCAGGGTAGGACAGAGG + Intergenic
1083146228 11:60761164-60761186 TCCACTGAAGGGTAAGACAGGGG - Intronic
1084189066 11:67490769-67490791 TTGTCTGCAGGGGAGGCCAGTGG - Exonic
1084592932 11:70100910-70100932 TGGGCAGCAGGGCAGCACAGAGG + Intronic
1084681763 11:70670493-70670515 CTGGCTGCAGGGCAGCACAGAGG + Intronic
1085914541 11:80869540-80869562 TGGGCTGCAGTCTAGGAAAGGGG + Intergenic
1090634058 11:128678107-128678129 GCAACTGCTGGGTAGGACAGTGG - Intergenic
1090640595 11:128726201-128726223 TCAGCTTCAGGGGAGGGCAGGGG - Intronic
1092126840 12:6080532-6080554 TAGGCTGCAGGGCAGGAGGGAGG + Intronic
1094495686 12:30987984-30988006 GCGGCTGCAGGCTGGGGCAGAGG + Intronic
1096468816 12:51863874-51863896 TGGGCAGCAGGGCAGGAAAGTGG + Intergenic
1101141929 12:101804481-101804503 TTGGCTGCAGAGTAGGGCACTGG - Intronic
1102192499 12:110999196-110999218 TCGCCTGCAGGGTGAGACAGAGG + Intergenic
1102554912 12:113720561-113720583 GAGGCTGCAGGGGAGGACTGGGG - Intergenic
1103621517 12:122189988-122190010 TTGGGTCAAGGGTAGGACAGGGG + Intronic
1103846099 12:123902920-123902942 TCGGCTGCAGGGTAGGACAGGGG - Exonic
1104460331 12:128950672-128950694 TGTTCTGCAGGGTAGAACAGAGG + Intronic
1106235969 13:27860748-27860770 AGGGGTGCAGGGAAGGACAGTGG - Intergenic
1107985070 13:45768526-45768548 TCTGCTGCAGGCTGGGAGAGAGG - Intergenic
1113976201 13:114229315-114229337 TCGCCTGCAGAGTTGGGCAGAGG - Intergenic
1114455562 14:22851200-22851222 CTGGTGGCAGGGTAGGACAGAGG - Intergenic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1122143309 14:99675028-99675050 TGGGCAGCAGGGCTGGACAGGGG + Intronic
1122301022 14:100731174-100731196 CCGGATACAGGGCAGGACAGGGG + Intronic
1122690401 14:103529466-103529488 TAGGTGGCAGGGTATGACAGAGG - Intronic
1131151440 15:90049740-90049762 TTGGCTGCAGGGTAGAGGAGAGG - Intronic
1132062555 15:98704392-98704414 TGGGCGGCAGGGTATCACAGAGG + Intronic
1133219538 16:4313944-4313966 TCGGCTGCAGGGCAGGGCTCCGG + Intergenic
1133231616 16:4369692-4369714 TGGGCTGGAGGGGAGGACAGAGG - Intronic
1133987375 16:10678763-10678785 CCTGCTGCAGGGGAGGACAAGGG - Intronic
1136027222 16:27476421-27476443 TCGGCTGCCCGGCAGCACAGCGG - Intronic
1136229844 16:28879743-28879765 TGGGGTGCAGGGGAGGAGAGAGG - Intronic
1136997090 16:35198064-35198086 TCTGCTCAAGTGTAGGACAGTGG + Intergenic
1137023767 16:35454185-35454207 TCTGCAGAAGTGTAGGACAGTGG + Intergenic
1139495340 16:67312901-67312923 TCTGCTGCAGTCTAGGCCAGGGG + Intronic
1141992324 16:87617645-87617667 GGGGCTGCATGGTAGGGCAGAGG + Intronic
1145058416 17:19717602-19717624 TCCGCTGCAGGGGTGGACATGGG - Intronic
1145274761 17:21422842-21422864 TCTGGTGCAGGGAAGGATAGGGG + Intergenic
1146411264 17:32587701-32587723 TAGGCTGAAGGGTGGGAGAGAGG - Intronic
1147251298 17:39154066-39154088 TCTTCTGCAGGGCAGGAGAGTGG - Intronic
1147311213 17:39597074-39597096 TGGGCTGTAGGGTGGGGCAGAGG - Intergenic
1150141810 17:62736696-62736718 TCTGCTACAGAGAAGGACAGAGG - Exonic
1151969181 17:77449150-77449172 TCTGCTGGAGGGTTGGACCGAGG + Intronic
1152941885 17:83177130-83177152 TTGGCTGCAGGCATGGACAGTGG + Intergenic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1158481341 18:57824257-57824279 TCAGCTGCAGGATAGGGCACTGG - Intergenic
1160462296 18:79048335-79048357 TAGGCTGCAGAGAAGGCCAGGGG + Intergenic
1162520819 19:11178444-11178466 CCGCCTGGAGGGGAGGACAGCGG + Exonic
1163133290 19:15290052-15290074 TAGGCTTAAGGGTAGGGCAGGGG + Intronic
1163816369 19:19467030-19467052 TCCCCTGCAGGGTAGGTCAGTGG + Intronic
1166037495 19:40179622-40179644 GTGATTGCAGGGTAGGACAGAGG - Intergenic
1166118445 19:40670022-40670044 TGGGAAGCAGGGCAGGACAGAGG + Intronic
925507509 2:4584350-4584372 TTGGCTGCAGGGTAGGGGAGCGG - Intergenic
925526608 2:4809691-4809713 TGGGCTGGAGGGTAGGGGAGTGG + Intergenic
925783346 2:7404270-7404292 TCAGCTCCAGGGTAGGATTGTGG + Intergenic
925812495 2:7714071-7714093 AAGGCTGCTGGGCAGGACAGAGG - Intergenic
925942959 2:8837511-8837533 TCGGCTGCAGGCGATGTCAGAGG + Exonic
928235292 2:29534022-29534044 TTGGCTGCAGAGTAGGACACTGG + Intronic
929414115 2:41730012-41730034 GAGGCTGCAGGGTAGGGCATTGG - Intergenic
932380324 2:71276470-71276492 TCGGCTGCAGGGGAGGAGCTGGG + Intergenic
935400199 2:102652366-102652388 TGGGCTGCAGGGGAGCAGAGGGG - Intronic
937145171 2:119638454-119638476 TGGGCTGCAGGGAGGGGCAGGGG + Intronic
938292932 2:130159926-130159948 CCGGCGGCAGGGGCGGACAGTGG - Intronic
943808325 2:192151900-192151922 TGGGCTGCAGGGGAGGAAAATGG + Intronic
945843429 2:214915182-214915204 TCTGCTGGAGGGTAGGAGTGGGG + Intergenic
947288988 2:228550635-228550657 TTGGCTTCAGGGCAGGACTGAGG - Intergenic
948004670 2:234597325-234597347 TCAGCTGAAGGACAGGACAGAGG + Intergenic
948348481 2:237319207-237319229 ACAGCTGCAGGGGAGCACAGAGG - Intergenic
948364839 2:237448242-237448264 TGGGGTGCAGGGGAGGACTGAGG - Intergenic
1168907627 20:1418643-1418665 TGTGCTGCAGGCTAGGAAAGAGG - Intergenic
1173132551 20:40408328-40408350 TAGTCTGCAGGGCAGGAAAGAGG - Intergenic
1173227960 20:41172894-41172916 TGGGCTTCAGGGTAGGAAAGGGG + Intronic
1175319367 20:58074524-58074546 TCTCCTGCAGGGGAGGAAAGGGG + Intergenic
1175675523 20:60943402-60943424 GTGACTGCAGGGTAGGGCAGCGG + Intergenic
1175715725 20:61253132-61253154 TGGGCGGCGGGGTAGGACTGCGG + Intronic
1179616162 21:42584569-42584591 TGGACTGCTGGGAAGGACAGTGG + Intergenic
1180172430 21:46066676-46066698 TCTGCTGGAGGGAAGGACGGCGG + Intergenic
1180597510 22:16988351-16988373 GCTGCTCCAGGGTAGGAAAGAGG - Intronic
1180836470 22:18932132-18932154 GTGCCTGCAGGGTAGGGCAGGGG + Intronic
1182832664 22:33316245-33316267 GGAGCTGCAGGGTAGGAGAGAGG + Exonic
1183287883 22:36979140-36979162 TCTGTTCCAGGGAAGGACAGGGG + Intergenic
1184604918 22:45567135-45567157 TTTGCTGCAGTGGAGGACAGGGG - Intronic
1185320407 22:50198056-50198078 TCGGCTGTGGGGAAGGACAAGGG - Exonic
1203286562 22_KI270734v1_random:157431-157453 GTGCCTGCAGGGTAGGGCAGGGG + Intergenic
954124713 3:48521556-48521578 TCGGCTGCAGGGATGGGGAGTGG + Intronic
954241559 3:49297830-49297852 TCTGCTGCAGGTCAGGTCAGAGG - Intronic
954816606 3:53286946-53286968 CCTGCTGCAGGGCAGGACTGGGG + Exonic
955771558 3:62389831-62389853 TCGGCTGAAGGCTGGGACACAGG + Intergenic
956584662 3:70851828-70851850 TCAGCTGCAGGGATGGGCAGTGG + Intergenic
958019561 3:87979836-87979858 TCAGCTGCAGGGTTGCACAGAGG - Intergenic
962627044 3:137236073-137236095 TCTGCTGCAGGGCAGGACAGAGG + Intergenic
967709409 3:192687811-192687833 TCAGCTGCGGGTTGGGACAGGGG - Intronic
969707644 4:8820506-8820528 TCCGCTGCAGGCGAGGACAATGG + Intergenic
970133274 4:12894289-12894311 TCTGCTGCAGTGGAGGACAAGGG + Intergenic
972158028 4:36189067-36189089 TTGGCTGCATGGGAGGACATAGG - Intronic
978692363 4:111529487-111529509 TCAGGTGAAGGGTTGGACAGTGG + Intergenic
981468258 4:145098607-145098629 TCGGCTGGAGGGGAAGACCGAGG - Intronic
984146375 4:176066045-176066067 GCGGCTGCAGCGGCGGACAGCGG - Exonic
989489324 5:42032298-42032320 TAGACTGCAGGGGAGGACATAGG - Intergenic
993216477 5:85029499-85029521 TCTGCTGCTCGGGAGGACAGAGG + Intergenic
995914812 5:117232192-117232214 AAGGCTGCAGGGTAGAACAGTGG + Intergenic
1002374376 5:178777736-178777758 CTGGCTGCAGGGTACCACAGAGG + Intergenic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1004191848 6:13471045-13471067 TCGGCTGAAGGAAAGGACAAGGG + Intronic
1007121020 6:39381529-39381551 TGGGCTGAAGGCTAGGACAGAGG - Intronic
1007386915 6:41526480-41526502 AGGGCTGCAGGGTGGGCCAGGGG + Intergenic
1010327932 6:74587229-74587251 TCTGCTGAAGGGCAGGAGAGGGG - Intergenic
1015329058 6:131955935-131955957 TCTGCTGCGGGGTGGGAAAGGGG + Intergenic
1016881678 6:148917711-148917733 TCAGCTTCAGGGTAGGGCTGAGG + Intronic
1019289741 7:244601-244623 TGGGGTGCAGGGCAGGGCAGTGG - Intronic
1022081337 7:27024914-27024936 GCAGCAGCAGGGTAGGACTGGGG - Intergenic
1024249027 7:47492417-47492439 TTGGCTGCAGGTGAGGAAAGAGG - Intronic
1026005185 7:66594770-66594792 TAGGCTGCTGGGTAGCAGAGTGG - Intergenic
1028964598 7:96787908-96787930 TAGGCTGCAGAGGAGGAAAGTGG - Intergenic
1029745794 7:102515209-102515231 TTGGCTGCAGAGTCGGGCAGGGG - Intronic
1029763732 7:102614188-102614210 TTGGCTGCAGAGTCGGGCAGGGG - Intronic
1031887338 7:127255241-127255263 TCGTCTTCAGGGTAGGCTAGAGG + Intergenic
1032084890 7:128878744-128878766 TGGGGAGCAGGGAAGGACAGGGG + Intronic
1033511703 7:142065821-142065843 TTGGGACCAGGGTAGGACAGTGG + Intronic
1033514776 7:142094853-142094875 TTGGGACCAGGGTAGGACAGTGG + Exonic
1033862293 7:145643599-145643621 TCAGGTGAAGGGTTGGACAGTGG + Intergenic
1035695328 8:1591550-1591572 TAGGCTGCAGGGGTGAACAGTGG - Intronic
1036157858 8:6359120-6359142 TCGGCTACAGAGAAGGACACAGG - Intergenic
1048061033 8:130919457-130919479 TCTTCTGCAGGCTAGGAGAGAGG - Intronic
1052991464 9:34521439-34521461 TGGGCTCCAGGCTAGGCCAGGGG + Exonic
1054805934 9:69395855-69395877 TAGGATGCAGAGGAGGACAGTGG + Intergenic
1056542392 9:87583623-87583645 TGGGGTGCAGGTTATGACAGTGG - Intronic
1057269089 9:93637043-93637065 ACGGCTGCAGGGCAGCTCAGAGG - Intronic
1057842425 9:98496690-98496712 TCAGTTGCAGGGTGGGACTGGGG - Intronic
1058037906 9:100273247-100273269 GAGGCTGCAGTGAAGGACAGAGG + Intronic
1060816578 9:126638372-126638394 TGGGCTGCAGGGTGGTGCAGAGG - Intronic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1061976568 9:134070982-134071004 GAGGCTGGAGGGCAGGACAGAGG - Intergenic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1190514537 X:51209134-51209156 AAGGCTGCAGGGTAGAACTGAGG + Intergenic
1197723902 X:129762822-129762844 TGGGCTGCATGGGAGGAAAGTGG + Intronic
1200208801 X:154336399-154336421 TCGGCTGGAGGCGAGGACACGGG - Intergenic
1200222077 X:154395735-154395757 TCGGCTGGAGGCGAGGACACGGG + Intronic