ID: 1103848119

View in Genome Browser
Species Human (GRCh38)
Location 12:123913718-123913740
Sequence ATCACTTAAGACTGAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103848119_1103848125 12 Left 1103848119 12:123913718-123913740 CCTGGGCTTCAGTCTTAAGTGAT 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1103848125 12:123913753-123913775 TATTTATGGGCAAGACCGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 32
1103848119_1103848124 -1 Left 1103848119 12:123913718-123913740 CCTGGGCTTCAGTCTTAAGTGAT 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1103848124 12:123913740-123913762 TGGGGCTGTTTGATATTTATGGG 0: 1
1: 0
2: 1
3: 11
4: 159
1103848119_1103848123 -2 Left 1103848119 12:123913718-123913740 CCTGGGCTTCAGTCTTAAGTGAT 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1103848123 12:123913739-123913761 ATGGGGCTGTTTGATATTTATGG 0: 1
1: 0
2: 0
3: 11
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103848119 Original CRISPR ATCACTTAAGACTGAAGCCC AGG (reversed) Intronic
900688576 1:3965462-3965484 ATCACTGATGCCTGAACCCCAGG - Intergenic
905883818 1:41481180-41481202 TTCACGTAGGACTGAAGCCGGGG - Exonic
906408116 1:45558134-45558156 ATCACTTAAGACTTGAGGTCAGG - Intronic
906967180 1:50469234-50469256 ACCACTGAGGACTGCAGCCCAGG - Intronic
910643108 1:89485878-89485900 ATCATTAGAAACTGAAGCCCAGG - Intergenic
911425951 1:97712722-97712744 ATCACCTTGGACTGGAGCCCTGG - Intronic
912996833 1:114538903-114538925 TTCACATGAGACTGCAGCCCTGG + Intergenic
913432418 1:118809733-118809755 TTCAGATAAGACTGTAGCCCCGG - Intergenic
915496049 1:156283262-156283284 ATCACATAGGAGTAAAGCCCCGG + Intronic
916439974 1:164814916-164814938 ATCACTTAAGACTAAAACCCGGG + Intronic
916754489 1:167755954-167755976 ATCACTTGACTCTAAAGCCCTGG - Intronic
916814853 1:168341885-168341907 ATGAGTTAAGACTAAAGTCCTGG - Intergenic
917126013 1:171688037-171688059 GTCACTTAAGAATGAAAACCAGG - Intergenic
918580500 1:186121528-186121550 CTAGCTTAAGTCTGAAGCCCAGG - Intronic
922280970 1:224123811-224123833 ATCAGTTAAGACTTGAGGCCAGG + Intronic
922433486 1:225580408-225580430 TTCAGTTGAGACTGCAGCCCTGG + Intronic
922760932 1:228130100-228130122 ATCACTTAAGACAGGAGTCTGGG + Intergenic
1065684365 10:28269093-28269115 ATTACTTATGACTGAAGCCATGG + Intronic
1066280293 10:33910543-33910565 ATAACTTAAAACAGAAGGCCGGG - Intergenic
1069432219 10:68347815-68347837 ATCAATTACTACTGAAGCACAGG + Intronic
1069684591 10:70309547-70309569 TTCAGTAAGGACTGAAGCCCGGG + Intronic
1071139637 10:82493222-82493244 ATCACTTAGGTGTTAAGCCCAGG + Intronic
1074511679 10:114118327-114118349 ATCATTTAAGACTTAAACCAGGG - Intergenic
1074738736 10:116463912-116463934 ATCACTTGAGACTTGAGGCCAGG + Intronic
1076896420 10:133314934-133314956 GACACTAAAGCCTGAAGCCCAGG + Intronic
1078804939 11:14689416-14689438 GTCCTTTAAGATTGAAGCCCTGG + Intronic
1082066328 11:47903659-47903681 ATCTCTTAAGACTGTAGCATTGG - Intergenic
1084458367 11:69282257-69282279 ATCAGATAAAACTGCAGCCCTGG + Intergenic
1087225933 11:95599376-95599398 TTCATTCAGGACTGAAGCCCAGG - Intergenic
1098452396 12:70634550-70634572 ATCACCTAGGAATTAAGCCCAGG + Intronic
1098764787 12:74472307-74472329 ATCACTTAGGTATTAAGCCCAGG - Intergenic
1102431143 12:112883482-112883504 ATCTTTTTAGAGTGAAGCCCTGG - Intronic
1103204288 12:119116270-119116292 ATGACTCAAGACTGAGGCTCAGG - Intronic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1106236883 13:27869928-27869950 TTCACTTAACACTTAATCCCTGG - Intergenic
1112622527 13:101066706-101066728 AGCCCTCAAGACTGAAGCCTGGG + Intronic
1112730792 13:102359214-102359236 ATCACCTAAGTATTAAGCCCAGG - Intronic
1116551410 14:46244191-46244213 GTCTCTTAAGACTGACTCCCAGG - Intergenic
1118247647 14:64126956-64126978 ATCATTTGAAAGTGAAGCCCTGG + Intronic
1119171952 14:72542304-72542326 ATTACTTAAGATTGGAACCCAGG + Intronic
1119754271 14:77103740-77103762 CACATGTAAGACTGAAGCCCAGG - Intronic
1119832051 14:77711978-77712000 ATCAATAAAGACTGTAGGCCGGG - Intronic
1120805374 14:88742133-88742155 ATCTCTGAAGCATGAAGCCCAGG + Intronic
1122104391 14:99441245-99441267 ACCACTTACGACTGAACCACAGG + Intronic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1124639753 15:31390236-31390258 ATCACTCAAGAGTCAATCCCAGG + Intronic
1127551662 15:60044454-60044476 AACACTTAATACTGGAGCCTGGG + Intronic
1128217219 15:65942840-65942862 ACCCCTGAAGACTGAGGCCCAGG - Intronic
1129677201 15:77638112-77638134 AGAACTCAAGACAGAAGCCCTGG + Intronic
1130422681 15:83764033-83764055 ATCATTTAATACAGAAGCCTGGG + Intronic
1135613854 16:23892450-23892472 ATCCCTTAAGATTAAAGCTCTGG - Intronic
1136747691 16:32606438-32606460 ATCACTTAAGACCAAAGGCCTGG - Intergenic
1137639291 16:50014156-50014178 CTCAGTTAAGAGTGAAGCACTGG + Intergenic
1138019201 16:53461943-53461965 ATGACTTTAGACTGAAGGCTAGG + Intronic
1138537435 16:57667412-57667434 ATTCCTTTAGGCTGAAGCCCAGG + Intergenic
1140733469 16:77877014-77877036 CACTCTTAAGACAGAAGCCCTGG + Intronic
1141713211 16:85712204-85712226 ATCAGATGAGACTGCAGCCCCGG + Intronic
1203049825 16_KI270728v1_random:865647-865669 ATCACTTAAGACCAAAGGCCTGG - Intergenic
1143731982 17:8886581-8886603 GTCCCTGAAGGCTGAAGCCCAGG - Exonic
1145284934 17:21498269-21498291 GTCACTTGAGACTCCAGCCCAGG - Intergenic
1148683720 17:49488891-49488913 AGCACTGGAGACTGAGGCCCGGG - Intergenic
1148927536 17:51100546-51100568 ATCACATGAGACTGAAGTCAAGG + Intronic
1149014704 17:51894502-51894524 AATTCTTAAGACAGAAGCCCTGG - Intronic
1150185210 17:63173412-63173434 ATCAGTTAATAATCAAGCCCTGG - Intronic
1150550894 17:66208865-66208887 TTCAGATAAGACTGCAGCCCTGG + Intergenic
1150712557 17:67544371-67544393 ATCCCTTCCCACTGAAGCCCAGG + Intronic
1151964060 17:77422201-77422223 AACACATAAGGCTGAGGCCCGGG - Intronic
1153147125 18:2046267-2046289 TTCAAGTAAGACTGCAGCCCTGG - Intergenic
1153746955 18:8189206-8189228 ATCACTTAAGTCTGAGGCTGAGG + Intronic
1155523008 18:26688281-26688303 ATCACCCAGGACTGGAGCCCAGG + Intergenic
1156483052 18:37448239-37448261 ATGACTGGAGCCTGAAGCCCGGG + Intronic
1159231114 18:65607898-65607920 TTCAGTTAATACTGAAGCCATGG - Intergenic
1163110866 19:15160478-15160500 ATAAAGGAAGACTGAAGCCCTGG + Exonic
1163691208 19:18739406-18739428 AGCACTTAAGATTAAAACCCAGG - Intronic
1165339780 19:35203149-35203171 ATCTCTTGAGACTGTACCCCAGG - Intergenic
1166713818 19:44953946-44953968 ACCACTTAAGCATGAGGCCCAGG + Exonic
1167157724 19:47749711-47749733 ATCAGTTGACACTGAAGCCCAGG - Intronic
1167460496 19:49621971-49621993 ATGACTTAACACTGAAGCCTGGG - Intronic
928160538 2:28920064-28920086 ATCACTCAAGACTCAAGGCCAGG - Intronic
928875688 2:36036443-36036465 AACACTTAAGAATGAGGACCTGG - Intergenic
930571259 2:53089640-53089662 AACTCTTAAGACTCAAGGCCGGG + Intergenic
936509996 2:113137574-113137596 CTCACTTAAGCATGAACCCCAGG - Intergenic
937254223 2:120543430-120543452 ATCACTTAAGCCTGGAGCCACGG - Intergenic
937462716 2:122103269-122103291 CTCACTCAAGTCTGAAACCCAGG + Intergenic
939186705 2:138869613-138869635 ATCACCTAAGTATTAAGCCCAGG + Intergenic
939609410 2:144291588-144291610 ATCACTTAATTCTGGATCCCTGG + Intronic
939717120 2:145598300-145598322 ATCATTTAGGACTGAAATCCAGG + Intergenic
941599631 2:167525839-167525861 ATCACTTAAGACTTAAGCTGAGG - Intergenic
946051852 2:216869426-216869448 ATTACTTAGGCCTGAAGCCCAGG + Intergenic
947845708 2:233242057-233242079 ATCTCTTAAGCCTGAAGCAAAGG + Intronic
1169159133 20:3361350-3361372 ATCATTTAAGACTTAAACCAGGG + Intronic
1169307426 20:4504335-4504357 ATCAATTAAACCTGAATCCCTGG + Intergenic
1172443008 20:34978965-34978987 TTCACTGAAGACTCAAACCCAGG - Intronic
1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG + Intronic
1172494696 20:35371780-35371802 ATCACTTAAGGCCTAAGACCAGG + Intronic
1172988690 20:39015180-39015202 ATCTCTTAGGAGTGTAGCCCTGG - Intronic
1173933135 20:46838376-46838398 ACCTCTTAAGACTCAAGCTCTGG - Intergenic
1175023135 20:55872750-55872772 ATCACTTAATCCTGAGCCCCAGG + Intergenic
1176893841 21:14351875-14351897 ATCACTTGACACTTGAGCCCAGG - Intergenic
1176904524 21:14483535-14483557 ATCACTTAAAAATGAAGGTCTGG - Intergenic
1178081543 21:29071740-29071762 AACACTTAAGTCTGAACTCCTGG + Intronic
1181760997 22:25058817-25058839 ATCACTTACGTCTGGTGCCCGGG + Intronic
1181982887 22:26778581-26778603 ATCAGGTAAGATTGCAGCCCTGG + Intergenic
951966234 3:28388793-28388815 ATCACTCAAGAATGAAGGACTGG - Intronic
952087338 3:29840868-29840890 GACACTTAAGAGTGAAGTCCAGG + Intronic
952460830 3:33524420-33524442 ATCACTTATCACTTAAGCTCAGG + Intronic
956977835 3:74602201-74602223 ATCACTTGAGCCTTAAGCCTAGG + Intergenic
958561414 3:95752231-95752253 ATCATACAAGACTGAAGCCTTGG - Intergenic
960097386 3:113701321-113701343 ATCACTTGAGACTGAGGTCAAGG + Intergenic
961917188 3:130389227-130389249 AAAACTTAACACTGAAGTCCAGG - Intronic
963262432 3:143206284-143206306 ATATCTTGAGACCGAAGCCCTGG - Intergenic
967700450 3:192586216-192586238 ATCTCCTAAAACTGAAGACCTGG + Intronic
969376817 4:6768525-6768547 ATCACTGAGGATGGAAGCCCAGG - Intergenic
970538697 4:17055912-17055934 ATCACATAAGACTGCAGCAAGGG - Intergenic
970851646 4:20610848-20610870 TTCACTTAAAAATAAAGCCCAGG - Intronic
972951705 4:44333382-44333404 TTTACTTAAGACAGTAGCCCAGG - Intronic
976366827 4:84241973-84241995 ATCTCTTGAGAATGAAGCCCAGG + Intergenic
977514946 4:98010172-98010194 ATAACTTAAAAATGAAGCTCGGG - Intronic
977723965 4:100272401-100272423 ATTACTTAAGAGTGAAGGCTTGG - Intergenic
979350261 4:119636280-119636302 CTCAGTTGAGACTGAAGCTCTGG - Intergenic
979990319 4:127367486-127367508 AGCACTTAAAATTGCAGCCCTGG + Intergenic
984507720 4:180640234-180640256 CTCCCTGAAGACTGATGCCCAGG + Intergenic
987510501 5:18830626-18830648 ATCACTCAACACTCAAGCTCAGG - Intergenic
992662532 5:78975482-78975504 ATCCCTTAAGAATGAAACCTTGG + Intronic
993094595 5:83466657-83466679 ATCTATTAACACTGAATCCCAGG - Intergenic
993139735 5:84016712-84016734 ATCCCTTGAGAATGAGGCCCAGG - Intronic
993140572 5:84027974-84027996 TTCACTTAAGACTGACTCCTGGG + Intronic
994699418 5:103114435-103114457 ATCACTTCTGTCTGAAGCTCTGG + Intronic
997539385 5:134648962-134648984 ACGACTTAAGACTGAAGACTGGG - Exonic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
1000245087 5:159442430-159442452 AGCACCTATGAATGAAGCCCGGG - Intergenic
1000392105 5:160733808-160733830 ATTATTTAAGAATGAAGGCCAGG + Intronic
1001790810 5:174456278-174456300 TTCACTTAAGACTGTGTCCCAGG - Intergenic
1001841400 5:174879947-174879969 CTTACTGAAGACTGCAGCCCAGG + Intergenic
1001987884 5:176091172-176091194 ATCACTTAAGACCAAAGGCCTGG - Intronic
1002006837 5:176241101-176241123 CTCAGTGAAGACTAAAGCCCAGG - Intronic
1002219540 5:177669531-177669553 CTCAGTGAAGACTAAAGCCCAGG + Intergenic
1002228988 5:177746969-177746991 ATCACTTAAGACCAAAGGCCTGG + Intronic
1002266359 5:178036814-178036836 ATCACTTAAGACCAAAGGCCCGG - Intronic
1004249341 6:14010623-14010645 ATCAGTTTAGAATTAAGCCCTGG + Intergenic
1005781462 6:29197225-29197247 ATCACTTAACACTTAATCCAAGG - Intergenic
1006852099 6:37106071-37106093 ATGACTTAAGACTGCAGATCTGG + Intergenic
1011479991 6:87784316-87784338 TTCACATAAGACTGAAACCAAGG - Intergenic
1011750434 6:90449755-90449777 ATCACTGCATACTGAAGCCCTGG + Intergenic
1015434272 6:133167785-133167807 ATCAGTTAAGAGTGACGCTCTGG - Intergenic
1017445491 6:154503540-154503562 ATCACTCAAGCCTCAAGCCCTGG + Intronic
1018619804 6:165719210-165719232 ATCACCTAGGGCTGAAGTCCAGG + Intronic
1020210706 7:6156146-6156168 ATCTCTTGAAACTGAAACCCTGG + Intronic
1021048123 7:15948548-15948570 ATCACATAAGACTGAGAGCCAGG + Intergenic
1021301409 7:18977606-18977628 ATCACTGTGGACTGAAGCCAAGG - Intronic
1021739709 7:23673911-23673933 ATCACTTGAGACTTGAGGCCAGG - Intergenic
1023100245 7:36710486-36710508 CTCAAATCAGACTGAAGCCCTGG + Intronic
1024235215 7:47392602-47392624 AGCTCTGAAGACTAAAGCCCTGG + Intronic
1026128732 7:67602819-67602841 ATCACTTGAGACTTGAGCCCAGG - Intergenic
1027731258 7:81876199-81876221 ATCTATTAAGTGTGAAGCCCTGG - Intergenic
1029247126 7:99210177-99210199 AACACTTGATAATGAAGCCCAGG - Intergenic
1030665909 7:112278322-112278344 ATCACATAAGAGTGAAGCCGAGG - Intronic
1032373652 7:131386310-131386332 ATCCTTTAGGACTGAAGACCTGG - Intronic
1033395366 7:140968721-140968743 ATCATTTAAGGCTGAAGAGCTGG - Intergenic
1033458147 7:141520994-141521016 TTCAGATAAGACTGCAGCCCTGG - Intergenic
1034669311 7:152846115-152846137 CTCACTGCAGACTGCAGCCCAGG - Intronic
1034669337 7:152846271-152846293 CTCACTACAGACTGCAGCCCGGG - Intronic
1034669341 7:152846302-152846324 CTCACTGCAGACTGCAGCCCAGG - Intronic
1034669378 7:152846550-152846572 CTCACTACAGACTGCAGCCCGGG - Intronic
1034669388 7:152846612-152846634 CTCACTACAGACTGCAGCCCGGG - Intronic
1034669395 7:152846643-152846665 CTCACTACAGACTGCAGCCCGGG - Intronic
1034669428 7:152846862-152846884 CTCACTACAGACTGCAGCCCAGG - Intronic
1034669473 7:152847142-152847164 CTCACTACAGACTGCAGCCCCGG - Intronic
1035108365 7:156460561-156460583 TTGGTTTAAGACTGAAGCCCAGG - Intergenic
1035300579 7:157894761-157894783 CTCCCTCAAGATTGAAGCCCAGG + Intronic
1035921929 8:3686607-3686629 AGCACAGAAAACTGAAGCCCAGG + Intronic
1036581371 8:10078729-10078751 AACGCTGAAGACTGAAGCCATGG - Intronic
1037909822 8:22737689-22737711 ATGACATTGGACTGAAGCCCAGG - Intronic
1038575058 8:28698044-28698066 ATCCCTTAACACTGAAATCCTGG - Intronic
1045182963 8:99805975-99805997 ATCCCTTCTGCCTGAAGCCCAGG - Intronic
1046037777 8:108864700-108864722 ATGACTTTAGCCTGAAGCACTGG + Intergenic
1053589672 9:39499183-39499205 ATCACTCAGGCTTGAAGCCCTGG + Intergenic
1054576624 9:66866124-66866146 ATCACTCAGGCTTGAAGCCCTGG - Intronic
1055110619 9:72555919-72555941 ATCATTTAAGAGTTAAGTCCAGG - Intronic
1055307689 9:74947231-74947253 ATCTCTCAAGAGTGAGGCCCAGG + Exonic
1055550120 9:77425489-77425511 ATAACTCTAGACTGATGCCCGGG + Intronic
1056185082 9:84126413-84126435 ATCACATAAGGCTGCAGTCCAGG - Intergenic
1059392368 9:114007297-114007319 ACCCCACAAGACTGAAGCCCTGG + Intronic
1062598627 9:137310315-137310337 CTCACTGCAGCCTGAAGCCCCGG + Intronic
1186296785 X:8157627-8157649 ATCACTTGACACTGAGGACCAGG + Intergenic
1187195667 X:17081020-17081042 ATCACTTAAGACAGACTGCCTGG + Intronic
1189910897 X:45809816-45809838 ATCAAGAAAGACAGAAGCCCTGG + Intergenic
1190767685 X:53488974-53488996 ATCACTTAAGTCTTAAGTCCAGG + Intergenic
1191780801 X:64863149-64863171 ATCACCTAAGCATTAAGCCCAGG + Intergenic
1193887242 X:86997455-86997477 ATCATGTAAGAGTCAAGCCCTGG + Intergenic
1194502324 X:94697037-94697059 CTTACCTAAGAATGAAGCCCTGG - Intergenic
1195720978 X:107867757-107867779 AGAAGTTAAGAATGAAGCCCTGG + Intronic
1196732535 X:118955372-118955394 TTCAGGTAAGACTGAACCCCTGG + Intergenic
1197493835 X:127153262-127153284 ATCACTGAAGTCTGAATCTCAGG - Intergenic
1200181658 X:154154635-154154657 ATCATGTAAGACTGCACCCCGGG - Exonic
1200187306 X:154191749-154191771 ATCATGTAAGACTGCACCCCGGG - Intergenic
1200192955 X:154228889-154228911 ATCATGTAAGACTGCACCCCGGG - Exonic
1200198710 X:154266693-154266715 ATCATGTAAGACTGCACCCCGGG - Exonic
1201647591 Y:16252709-16252731 CTCACTTAAGAATGATGGCCGGG - Intergenic
1201655220 Y:16332592-16332614 CTCACTTAAGAATGATGGCCGGG + Intergenic