ID: 1103850312

View in Genome Browser
Species Human (GRCh38)
Location 12:123928640-123928662
Sequence CTGCATGCTGCTCTGGGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 7, 3: 60, 4: 420}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103850306_1103850312 1 Left 1103850306 12:123928616-123928638 CCAGCACGCAGCTTCTCAGAACA 0: 1
1: 0
2: 2
3: 10
4: 144
Right 1103850312 12:123928640-123928662 CTGCATGCTGCTCTGGGGCCGGG 0: 1
1: 0
2: 7
3: 60
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103850312 Original CRISPR CTGCATGCTGCTCTGGGGCC GGG Exonic
900154003 1:1196834-1196856 CTGCATGCAGCCCTGGGGATGGG + Intronic
900242338 1:1623181-1623203 CTGCAGGGTGGTCTGGGCCCAGG - Intronic
900311384 1:2035089-2035111 CTCCCAGCTGCTCTGGGGCCTGG - Intergenic
900748538 1:4378100-4378122 CTGGATGCAGCTCTGGGGCCAGG - Intergenic
900915203 1:5632674-5632696 CTCCCTGCTGCCCTGTGGCCAGG + Intergenic
900986110 1:6073602-6073624 CTCTGTGCTGCTCTGTGGCCAGG - Intronic
901083681 1:6597810-6597832 CTGCCTGAAGCTCTGGGTCCAGG - Intronic
901142300 1:7043025-7043047 CTGCAGTGTGCTCTGGGGCATGG + Intronic
901428668 1:9199259-9199281 ATGCACCCTGCTCTGAGGCCTGG + Intergenic
902699393 1:18161313-18161335 CTGCTTGCTCCTCTGCGGCATGG - Intronic
903042633 1:20542793-20542815 CTCCATGCTGCTCCGGATCCTGG - Intergenic
903190550 1:21653404-21653426 TTGCAAGGTGCTCTGGAGCCTGG + Intronic
903222253 1:21875455-21875477 ATACAGGCTGGTCTGGGGCCAGG - Intronic
903350885 1:22716011-22716033 CTGAAGGCTGATCTGGTGCCTGG - Intronic
903701973 1:25255934-25255956 CTGCCTCCTGCTGTGCGGCCTGG + Intronic
904027221 1:27512105-27512127 CTGCATCTTGATCTGGGGACTGG - Intergenic
905602575 1:39266693-39266715 CTGCTTTCTGCTGTGTGGCCTGG + Intronic
906646899 1:47481716-47481738 CTGCATGCTGGCCTGGTGCTAGG + Intergenic
906719957 1:47997349-47997371 CGCCATGCTGCTCCGCGGCCGGG + Intergenic
907968277 1:59355038-59355060 CTGCATGCAGCCTTGAGGCCAGG + Intronic
908538888 1:65103913-65103935 CTGCATCCTGCCCTAGGGTCTGG - Intergenic
908634451 1:66146943-66146965 CTGTATGCAACTCTAGGGCCTGG + Intronic
910667455 1:89740542-89740564 CTTCAAACTGATCTGGGGCCAGG - Intronic
910684712 1:89904386-89904408 CTGCCTGCTGGTCTGGTTCCTGG + Intronic
911378832 1:97086840-97086862 CAGCATGCTGTTCTGGGTCCTGG - Intronic
912451104 1:109768313-109768335 CTGGACCCTGCTCTGGGGTCTGG - Intronic
912500912 1:110121383-110121405 CGGCCTGCTGCAGTGGGGCCAGG + Intergenic
912860039 1:113206180-113206202 CTCTCTGCTGCTGTGGGGCCAGG + Intergenic
913175083 1:116266159-116266181 CTGCAGGATGGTCTGGTGCCAGG + Intergenic
913424668 1:118713842-118713864 GTGGCTGCTTCTCTGGGGCCTGG + Intergenic
914801925 1:150968365-150968387 CCGCATGCTGCTCTGGCTCTGGG - Intronic
915118924 1:153616526-153616548 CTGCATGCTGATCGGAGGCCAGG - Intronic
915902345 1:159855843-159855865 CTGCATGCTGCTGTGCGGCAGGG - Intronic
917839541 1:178966530-178966552 CTGCATGGTGCCCTGGGGATGGG + Intergenic
918177691 1:182059998-182060020 CTGAAGCCTGCTCTGGGGCTGGG + Intronic
919796695 1:201325320-201325342 CTCCATGCAGCCCTGGGGCCTGG - Intronic
919966130 1:202527233-202527255 TTACATGCTAGTCTGGGGCCTGG + Intronic
920048645 1:203150157-203150179 CTGCATGTTGTTCTGGGGAGGGG + Intronic
924811865 1:247410001-247410023 GTGACTGCTCCTCTGGGGCCTGG - Intergenic
1062860617 10:806574-806596 CTCCATGCTGCTGTCGGGCCGGG - Intergenic
1064284319 10:13979230-13979252 TTACATGCAGGTCTGGGGCCTGG + Intronic
1067059497 10:43070690-43070712 CTGCAGGCTGCCATGGGCCCAGG - Intergenic
1067102405 10:43342835-43342857 GTGCCTGCTGCGCTGGGCCCAGG + Intergenic
1067567274 10:47348511-47348533 GTCCGTGCTGCTCTGTGGCCTGG + Exonic
1069778636 10:70941261-70941283 CTCCATGCTTCTCTGGGCTCAGG + Intergenic
1069908431 10:71745790-71745812 CTGCATGCTGCTCAGGTCTCTGG - Intronic
1070773244 10:79095001-79095023 CTGGATGCTGATCAGAGGCCTGG + Intronic
1070797584 10:79225805-79225827 CTGAAGGAGGCTCTGGGGCCTGG + Intronic
1071013746 10:80970290-80970312 CTGGATGCTGTTTTAGGGCCTGG + Intergenic
1071297710 10:84234193-84234215 CTGGATGGAGCTCTGGGCCCTGG + Exonic
1071876731 10:89850912-89850934 CTGTCTGCTGCTCTGGGCCTTGG - Intergenic
1073186894 10:101620430-101620452 CTCCAAGCTTCTCTGGGGACAGG + Intronic
1073195541 10:101687849-101687871 CTGGATGCTTCTCTGTTGCCTGG - Intronic
1075846962 10:125552529-125552551 CTGCATGCTCCTTGGGGGCTGGG - Intergenic
1075971690 10:126659942-126659964 CTGAGTGCTGGTCTGGTGCCAGG + Intronic
1076023745 10:127095142-127095164 CTGCTCTCTGCTCTGGAGCCAGG - Intronic
1076160683 10:128242393-128242415 CTGCATGAAGCCGTGGGGCCCGG - Intergenic
1076370724 10:129951452-129951474 CTGCATGCTGCTGCAGGGCCTGG + Intronic
1076887989 10:133271311-133271333 TGGCAGGCTGCACTGGGGCCGGG + Intronic
1076992761 11:284370-284392 CTGCACCCTGCACTGCGGCCAGG - Exonic
1077187193 11:1240671-1240693 CTGCATGAGGGACTGGGGCCTGG - Intronic
1077218090 11:1403423-1403445 CTGAAGGCTGCTCTTGGGCCTGG + Intronic
1078877523 11:15413157-15413179 CTGAAGGCTACCCTGGGGCCTGG - Intergenic
1079090095 11:17474920-17474942 CTTCATGCTGCTCTTCGTCCTGG - Exonic
1080289752 11:30657891-30657913 TTGTATGCTACTTTGGGGCCTGG - Intergenic
1083330897 11:61897919-61897941 CTGCAGGCAGTTCTGGGGACTGG + Exonic
1083888010 11:65582109-65582131 CTGCAGGCTCCGCTGGGGGCAGG - Exonic
1083986835 11:66221098-66221120 CAGCATGCTGTTCTGAGCCCTGG + Intronic
1083996661 11:66276386-66276408 CTGCCTGCTGCCCTGAGCCCCGG + Exonic
1084536912 11:69762702-69762724 CTGCAGGCTGCCCTGGGGATCGG - Intergenic
1084970933 11:72771711-72771733 GGGCCTGCTGCTCTGGAGCCTGG - Intronic
1085260909 11:75204171-75204193 CTGGACTCTGCTCTGTGGCCTGG - Intronic
1085348683 11:75784414-75784436 CTGCATGCTCCCCTGTGCCCTGG - Intronic
1087093039 11:94294646-94294668 CTGCATTCTGTTCTGGGGAAAGG - Intergenic
1087119685 11:94560387-94560409 CTGCACGCTTCTGTAGGGCCTGG + Intronic
1087304522 11:96472964-96472986 CAGCATGCTGCCCAGGTGCCTGG + Intronic
1089067262 11:115671160-115671182 CTGCATGCTACCATGTGGCCGGG + Intergenic
1089308820 11:117544472-117544494 CCGCAGGCTGCCCTGGTGCCAGG - Intronic
1089487135 11:118855214-118855236 CTGCATGGAGGTCTTGGGCCGGG - Intergenic
1090349042 11:126095400-126095422 CTTCAGGCTGCCCTGGGGCGAGG - Intergenic
1090598311 11:128343002-128343024 CAGCAGGCTGCTCTGAGGCCTGG + Intergenic
1091105020 11:132910310-132910332 CTTCAGGCTGCTCTGGGGCCCGG - Intronic
1091170729 11:133517710-133517732 CTCCATTCAGCTCTGTGGCCTGG - Intronic
1091591314 12:1844441-1844463 CAGCAGGATGCTCTGAGGCCTGG + Exonic
1091887121 12:4024971-4024993 CTGCATTCTCATCTAGGGCCTGG - Intergenic
1092063024 12:5566051-5566073 CTGAATGGTGCTCTGCAGCCGGG + Intronic
1097018546 12:56004258-56004280 CTGCACGCTGGGCTGGGGCACGG + Exonic
1100512226 12:95286875-95286897 CTCCAAGCTGCTCTGGGTCATGG + Intronic
1101835539 12:108292464-108292486 CTGCATGGTCATCTGGGTCCTGG - Exonic
1102097074 12:110249420-110249442 CAGGAAGCTGCTCTGTGGCCTGG + Intergenic
1102422531 12:112815194-112815216 CTCCATCCTGCTCTGTGCCCTGG - Intronic
1102569927 12:113821209-113821231 CTGAATCCTGCTCTGGGGGGAGG + Intronic
1103508023 12:121454467-121454489 CTGCAGGAGGCTCTGGGGCTGGG - Intronic
1103606086 12:122087129-122087151 CAGCCTCATGCTCTGGGGCCCGG - Intronic
1103850312 12:123928640-123928662 CTGCATGCTGCTCTGGGGCCGGG + Exonic
1103912828 12:124361648-124361670 CTGGCAGCAGCTCTGGGGCCTGG - Intronic
1104628878 12:130382443-130382465 CACCATGCTGCTTAGGGGCCTGG + Intergenic
1104720997 12:131045202-131045224 CTGCGGGCTGCCCTGGGGACTGG - Intronic
1104908725 12:132229345-132229367 CTGGAGGCTGCTCTGGGTTCAGG - Intronic
1105319563 13:19305541-19305563 CTGGGTGCTGCCCTGGGCCCGGG - Intergenic
1105546082 13:21352067-21352089 CAGCAGCCTGCTCTGGGGCAGGG + Intergenic
1105596823 13:21846853-21846875 CTGCCTGCTGCTCTGGGGAGGGG + Intergenic
1105673777 13:22648358-22648380 CAGCATGCTGTTATGGGCCCAGG - Intergenic
1105751076 13:23421742-23421764 CTGGATGTTGCCCTGGGGTCAGG + Intronic
1105751392 13:23425134-23425156 CTGGATGGTCCTCTGGGGTCAGG + Intronic
1106135794 13:26972432-26972454 CTGAATGCTGCCCAGGGTCCAGG + Intergenic
1106460488 13:29963806-29963828 CTGCATGTTCCTCAGGGACCTGG + Intergenic
1107006663 13:35619979-35620001 CTTCATCCTGCTCTGGGCTCTGG + Intronic
1109513733 13:63413739-63413761 CTGCAGACTGCCCTGGGGCAGGG - Intergenic
1110148362 13:72221388-72221410 CTGCATCCTGCCCTGGGGCCAGG - Intergenic
1111952247 13:94718006-94718028 ATCCCTGCTGTTCTGGGGCCAGG + Intergenic
1112832028 13:103464787-103464809 TGGCCTGCTGCTCTGGGGGCAGG + Intergenic
1113767352 13:112889591-112889613 CTCCATGCGGCGCTGGGGTCAGG + Intergenic
1115328512 14:32168426-32168448 ATGCATGCTGCCATGGGGCTGGG + Intergenic
1117026007 14:51620799-51620821 CTGCAAGCTGCTATGGGCCAAGG + Intronic
1117876017 14:60250004-60250026 CTGCAGGCCGCTCTCCGGCCAGG - Intronic
1119671786 14:76525592-76525614 CTGCATTCTGATCAGGGGCTGGG + Intergenic
1119793721 14:77377022-77377044 CTGCAGGCGGCTGAGGGGCCGGG - Exonic
1120316917 14:82906040-82906062 CTGCCTCCTGCTTTGGGACCTGG + Intergenic
1120985454 14:90330961-90330983 CTGCATCCTGCCCTGGGGTGGGG - Intronic
1121104578 14:91272023-91272045 CTGCAGGCTGCCCTGGGTCCTGG + Exonic
1122105066 14:99446800-99446822 CTGCATCCTGCCCTCGGGACTGG - Intronic
1122198733 14:100109029-100109051 CTCGATGCTGAGCTGGGGCCTGG - Intronic
1122261984 14:100528998-100529020 TGGCACTCTGCTCTGGGGCCTGG - Intronic
1123053878 14:105560235-105560257 CTGCAGCCTCCTGTGGGGCCGGG + Intergenic
1123078461 14:105680652-105680674 CTGCAGCCTCCTGTGGGGCCGGG + Intergenic
1124153772 15:27207817-27207839 CTGCATGATTCTCAGTGGCCAGG - Intronic
1124831532 15:33153996-33154018 CTGGATGCTTCTCAGGGTCCTGG + Exonic
1128159090 15:65411281-65411303 CTGCAGCCTGCTCTGGGCCCAGG + Exonic
1129271854 15:74423133-74423155 CTGCTTTCTGCTCTTTGGCCCGG - Intronic
1129514772 15:76150665-76150687 GTGCTTGCTTCTGTGGGGCCTGG - Intronic
1130259681 15:82345397-82345419 CTGCTGGGGGCTCTGGGGCCAGG + Exonic
1130281554 15:82523612-82523634 CTGCTGGGGGCTCTGGGGCCAGG - Intergenic
1130354694 15:83118603-83118625 CTTCATGCTCCCCTGGGGCAAGG - Intronic
1130472927 15:84239795-84239817 CTGCTGGGGGCTCTGGGGCCAGG - Exonic
1130491351 15:84433763-84433785 CTGCTGGGGGCTCTGGGGCCAGG + Intergenic
1130502967 15:84512804-84512826 CTGCTGGGGGCTCTGGGGCCAGG + Intergenic
1130595219 15:85244431-85244453 CTGCTGGGGGCTCTGGGGCCAGG - Intergenic
1131562833 15:93459150-93459172 CTGCATGGTTCTCTGGGGCCAGG - Intergenic
1132386845 15:101406905-101406927 CTGCATGCAGCCCTGGATCCAGG + Intronic
1132548270 16:543572-543594 GTGCCCGCTGCTGTGGGGCCTGG + Intronic
1132589939 16:722185-722207 GTGTTTGCTGCTCTGAGGCCTGG + Intronic
1132693954 16:1193946-1193968 CTGCGTGCAGCACTGGGGTCAGG - Intronic
1132798906 16:1741865-1741887 GTGCATACAGCTCTGGGGACTGG - Intronic
1133230582 16:4364689-4364711 CTGCCTGCTTGTCTGCGGCCAGG - Exonic
1133379715 16:5319838-5319860 CTACATCATGCTCTGGGTCCTGG + Intergenic
1134776933 16:16861682-16861704 CTGCAGCCTGCCCTGGGGACAGG - Intergenic
1136069508 16:27779365-27779387 CTGCGTGCTGCTGCCGGGCCAGG + Exonic
1136188237 16:28600694-28600716 CTGCGCGGTGCCCTGGGGCCGGG + Intergenic
1136190709 16:28613688-28613710 CTGCGCGGTGCCCTGGGGCCGGG + Intronic
1136683264 16:31980013-31980035 TTGCATGCTGCTGTAGGCCCTGG + Intergenic
1136783897 16:32923569-32923591 TTGCATGCTGCTGTAGGCCCTGG + Intergenic
1136885886 16:33930237-33930259 TTGCATGCTGCTGTAGGCCCTGG - Intergenic
1137554369 16:49461413-49461435 CTGCCTTCTGCTCTGTGGCATGG - Intergenic
1138187590 16:54988284-54988306 CTGCTTGCTGCTCTGTGACCTGG - Intergenic
1138332982 16:56230239-56230261 GTGGAGGCTGCTGTGGGGCCTGG + Intronic
1138347922 16:56331322-56331344 GTGAAAGGTGCTCTGGGGCCTGG + Intronic
1139175716 16:64684689-64684711 ATTCCTGCTACTCTGGGGCCTGG + Intergenic
1139360121 16:66392439-66392461 ATGCCTGCTGGTCTGAGGCCAGG + Intronic
1139432092 16:66916288-66916310 CTGCCTGCTCCTCTCGGTCCAGG + Exonic
1139486885 16:67262827-67262849 CTGGATGCTGCGCAGAGGCCTGG + Intronic
1139952350 16:70678512-70678534 CTGGGTGTTGCCCTGGGGCCAGG + Intronic
1141482940 16:84318739-84318761 CAGCATGCAGGTCGGGGGCCTGG + Intronic
1141630087 16:85282986-85283008 CTGCAGGCTGGCCTGGGGTCGGG + Intergenic
1141834968 16:86532415-86532437 CAGCCTGCTGCTCTCGGGCGCGG + Exonic
1141854314 16:86670608-86670630 CTGCTTGCTGCCCTGGGACCTGG + Intergenic
1142237126 16:88927612-88927634 CTCCGGGCTGCTCTGGGGCTAGG + Intronic
1142425422 16:89999919-89999941 GTGCATGATGCTCGGGGGCCGGG + Intergenic
1203086555 16_KI270728v1_random:1187571-1187593 TTGCATGCTGCTGTAGGCCCTGG + Intergenic
1142636459 17:1260435-1260457 CCGCATGCTGCGCGGGGGCTGGG + Intergenic
1142883770 17:2900161-2900183 CAGCAGGTGGCTCTGGGGCCAGG - Intronic
1143358818 17:6351118-6351140 CTGCAAGCTCCTCAGGGGCAGGG + Intergenic
1143469720 17:7165038-7165060 CTCCATGTTGTTCTGTGGCCTGG + Intergenic
1143729539 17:8873180-8873202 CTTCAGTCTGCTCTGGAGCCAGG + Intergenic
1144570721 17:16396774-16396796 CTGTCTGCTGCTCTGGGCCTTGG + Intergenic
1145362859 17:22226548-22226570 CTGTCTGCTGCTCTGGGCCTTGG + Intergenic
1145885754 17:28381428-28381450 CTGCGCGCTGCACGGGGGCCAGG + Exonic
1146154742 17:30512798-30512820 CTGCCTGCTCTTCTAGGGCCAGG + Intronic
1146500979 17:33364161-33364183 CTTCTTGCTTCTCTGGGGCTAGG + Intronic
1147249373 17:39143967-39143989 CTGCAAGCAGCCCTGGGGCCTGG + Intronic
1147335875 17:39726763-39726785 CTGCATGCTGGGCTGGGGAGGGG + Intronic
1147426157 17:40346826-40346848 CTGCAGGCTGGTCTTGGGGCAGG + Intronic
1147705172 17:42421329-42421351 CTGCTGACTGCTCTGGGGCCTGG - Intronic
1148748613 17:49931993-49932015 CAGCTTGCTTCTCTGGGCCCTGG - Intergenic
1148767813 17:50049477-50049499 CTGCAAGGTGCTCTGTGGCCTGG + Intergenic
1149445485 17:56710224-56710246 CTGCTGGCCGCTCTGTGGCCTGG - Intergenic
1149546134 17:57505184-57505206 GAGCCTGCTGCTCTGGGGACAGG + Intronic
1150008228 17:61482831-61482853 CAACAGGGTGCTCTGGGGCCTGG + Intronic
1150681113 17:67285261-67285283 CGCCATGTTGGTCTGGGGCCAGG + Intergenic
1151733248 17:75923241-75923263 CAGCATGCTGCTCTCTGGCCAGG + Exonic
1152122276 17:78426226-78426248 ATGGAAGCTGCTCTGCGGCCTGG + Intronic
1152140000 17:78530620-78530642 CTGCCGGCCACTCTGGGGCCAGG + Intronic
1152229098 17:79105835-79105857 CTGCGTGGTCCTCTGTGGCCAGG + Intronic
1152238348 17:79149857-79149879 CAGCCTCCTCCTCTGGGGCCTGG + Intronic
1152564088 17:81092452-81092474 CTGCCTGCCTCTCTGGGGCAGGG - Intronic
1152726957 17:81952278-81952300 CTCCCTGCTGCTGTGGGGCTGGG + Intergenic
1153019689 18:615898-615920 CTGCATGTTGCTCAGAGACCAGG + Intronic
1153160492 18:2199392-2199414 CTGGATGCTGTTCTGGGAACTGG - Intergenic
1154210755 18:12377049-12377071 CTGTTTGCGGCTGTGGGGCCGGG - Exonic
1155373039 18:25124025-25124047 CTCCAAGCAGCACTGGGGCCAGG - Intronic
1155799347 18:30081613-30081635 CTGCATGCCACTCATGGGCCTGG - Intergenic
1156497496 18:37535739-37535761 GAGCATGCTCCTCTGTGGCCTGG - Intronic
1156830637 18:41486809-41486831 TTGCATGCTGCCCTGGGCCTGGG - Intergenic
1158228662 18:55229036-55229058 CTGCCTTCTGCTCTGGTGTCAGG + Exonic
1158512146 18:58100134-58100156 CTGCCTGCTGCTGTGGGCTCAGG + Intronic
1158615247 18:58981073-58981095 ATGCATGCTGCTTTTGTGCCTGG + Intronic
1158894782 18:61902642-61902664 CTGCATGATGCTGTGGGGTGTGG - Intergenic
1160704656 19:524343-524365 CTCTATGCTGCTGTGAGGCCAGG - Intergenic
1160855543 19:1215552-1215574 CTGCAGGCTGTGCTGGGGCTGGG - Intronic
1160893208 19:1390363-1390385 CTGCACGCGGCTCTGAGACCTGG - Intronic
1161009458 19:1953286-1953308 CTGCTTCCTGCTCCGTGGCCCGG - Intronic
1161047316 19:2142648-2142670 CTGCATGCGGCTCAGCGGCCCGG - Intronic
1161706950 19:5826653-5826675 CTGCCACCTGCTCTGGGGCTGGG + Intronic
1161971326 19:7582524-7582546 CTGCATGCTGAGATGGGGACAGG - Intergenic
1161981651 19:7633223-7633245 CTGCCCTCTGCCCTGGGGCCTGG + Intronic
1162474838 19:10893754-10893776 CAGGATGGTGCCCTGGGGCCGGG + Intronic
1162503258 19:11066763-11066785 CTGCCACCTGCTCTGGGGTCTGG + Intergenic
1162797779 19:13095550-13095572 CTGCATGCAGGGCTGGGGGCGGG - Exonic
1162947680 19:14053769-14053791 CGGCGGGCTGCTCTGGGGCTGGG + Exonic
1163124894 19:15239460-15239482 GTGCGTTCTGCTCTGGGGGCCGG + Exonic
1163138525 19:15331576-15331598 CTGCACGCCGGTCTGAGGCCAGG - Intronic
1163569133 19:18069863-18069885 CTGGAGGCTGCCTTGGGGCCAGG + Intronic
1163807106 19:19405982-19406004 CTGCGCGCTGCCCTAGGGCCCGG + Intronic
1165040620 19:33065215-33065237 CTGCACCCTGCCCTGGAGCCCGG + Intergenic
1165077343 19:33287167-33287189 CTACATCCTGCCCTGGGCCCTGG - Intergenic
1165245942 19:34498374-34498396 CTCCAAGCTGCTGGGGGGCCCGG - Intronic
1165284720 19:34832459-34832481 CTGCAGGCAGCTCTGGGCTCAGG - Intergenic
1166356357 19:42229795-42229817 CTGCCTGCTGCTCTAGGGTCTGG - Intergenic
1166383710 19:42369009-42369031 CCGCAGGCGGCGCTGGGGCCAGG + Intronic
1166481042 19:43174711-43174733 CTCCATGCTTCTCTGGTGACTGG - Intronic
1167473964 19:49689738-49689760 CTGGGTGCAGCTCTGGAGCCAGG - Exonic
925706168 2:6686127-6686149 CTGCATGATCACCTGGGGCCTGG + Intergenic
925755994 2:7133182-7133204 CTCCCTGCTGCTCTGTGGCCTGG + Intergenic
925793780 2:7521092-7521114 CTGCACGCAGCTCTGTTGCCTGG - Intergenic
926003887 2:9356545-9356567 CTCAGTCCTGCTCTGGGGCCCGG - Intronic
928245764 2:29625768-29625790 CTGCCTGCTGCTGGAGGGCCAGG + Intronic
928437997 2:31268399-31268421 TTGAATGATGCTCTGTGGCCAGG - Exonic
929017453 2:37513093-37513115 CTGCATGACTCTCTGGGCCCAGG + Intergenic
931775844 2:65539715-65539737 CTGCAGGCTGGACGGGGGCCAGG + Intergenic
933741474 2:85538012-85538034 CTGCAGCCTGTTCTGGGGCTGGG - Intergenic
933758246 2:85657482-85657504 ATGCAGCCTGCTCTTGGGCCTGG - Intronic
934495145 2:94789697-94789719 GAGCACGCTGCTCAGGGGCCTGG - Intergenic
934567100 2:95346986-95347008 CTGCCTGGGGCCCTGGGGCCCGG - Intronic
934935432 2:98461835-98461857 CTGCATGCTGGCCTGCTGCCAGG + Intronic
935214824 2:100967750-100967772 CTGCAAGCAGCTCTGGGGAAGGG + Intronic
935730220 2:106059132-106059154 CTGCCTGCTCCCCTGGTGCCAGG + Intergenic
936008522 2:108910244-108910266 CTGCCTGCTGCTCTCGGGTCAGG - Intronic
937242927 2:120474233-120474255 CTGCCTGCTCCTCGGGGGACAGG - Intergenic
937877893 2:126839261-126839283 CTGCAAGCTGCTTTGGGGCAGGG - Intergenic
937907090 2:127057717-127057739 CTGCGTCCTGCTCAGTGGCCTGG - Intronic
938074401 2:128323995-128324017 CTGCGTCCTTCTCTGGGCCCAGG + Intergenic
938491173 2:131762070-131762092 CTGCATGCTTACCTAGGGCCTGG + Intronic
938496390 2:131800267-131800289 CTGCATGCTTACCTAGGGCCTGG - Intronic
939992418 2:148888126-148888148 CTGCCTGCCGCCCTGGTGCCTGG + Intronic
941291460 2:163680716-163680738 CTGCATGAAGCTCTGGGGAGGGG - Intronic
941624419 2:167815055-167815077 CTGCAGGGAGCTCTGGGGCTGGG - Intergenic
942547107 2:177076560-177076582 CTCCCAGCTGCTCTGGGGCAGGG + Intergenic
945068079 2:205963986-205964008 CTTCATGGAGCTCCGGGGCCTGG + Intergenic
946120775 2:217512125-217512147 CTCCATGCTCCTCTGGGCTCAGG + Intronic
946239439 2:218344871-218344893 CTACAGGAGGCTCTGGGGCCGGG + Exonic
946291080 2:218746006-218746028 CTACATGAGGCCCTGGGGCCAGG - Intronic
947240696 2:227991132-227991154 CAGCAGGCTCCTCTGGGGGCTGG + Exonic
948406329 2:237722804-237722826 GTGCCTGCTGCTCAGGGCCCTGG + Intronic
948997953 2:241593536-241593558 CTGAATGCAGCACTGGGGACAGG + Intronic
1169144784 20:3245101-3245123 CCCCATCCTGCTCAGGGGCCTGG + Intergenic
1169210520 20:3763991-3764013 CTGCACCCTGGGCTGGGGCCTGG - Intronic
1169210926 20:3765939-3765961 CTGCACCCTGGGCTGGGGCCTGG - Intronic
1169384455 20:5136364-5136386 CTGCATCCTGCCCTGGGCACGGG - Intronic
1169567821 20:6874811-6874833 ATGCAGGCTGCTCTGGGGAGGGG + Intergenic
1171366416 20:24627828-24627850 CTTAATGCTGCCCTGGGGCAGGG + Intronic
1172419740 20:34805723-34805745 CTGCATACTAGTCTGGGGCCTGG - Intronic
1172754031 20:37270911-37270933 CTTCCTTCTGCTCTGTGGCCTGG - Intergenic
1174059880 20:47825368-47825390 CTGCCTGCTTCTCTGGGCCCAGG - Intergenic
1174071994 20:47905902-47905924 CTGCCTGCTTCTCTGGGCCCAGG + Intergenic
1174130477 20:48340560-48340582 CTCCCTGCTGCTCTGTAGCCTGG - Intergenic
1174147258 20:48460417-48460439 CTGCCTGCTTCTCTGGGCCCAGG - Intergenic
1174152054 20:48492767-48492789 CTGCCTGCTTCTCTGGGCCCAGG - Intergenic
1175542468 20:59756347-59756369 CAGCAGGCTGTCCTGGGGCCTGG - Intronic
1175795330 20:61767177-61767199 CTGCATGCTCATGTGGGGGCGGG - Intronic
1175969299 20:62675772-62675794 CTGCATGCTGGCCTGGGTCCTGG + Intronic
1176173465 20:63707016-63707038 CTGCATCCTGATCCTGGGCCTGG - Exonic
1177775520 21:25562151-25562173 CTGCAGGCGGCGCTGGGCCCGGG - Intergenic
1178716088 21:34965831-34965853 CTCTTTGCAGCTCTGGGGCCAGG - Intronic
1180049163 21:45323581-45323603 CTGCCTGCAGGCCTGGGGCCAGG + Intergenic
1180082335 21:45492722-45492744 CAGCATGCAGCTCTGGCACCAGG - Intronic
1180707348 22:17817798-17817820 CTGCATCCTGCTCAGCTGCCTGG + Exonic
1180854406 22:19037043-19037065 ATGCCTGCTGCTCTGGAACCTGG + Exonic
1181865271 22:25849775-25849797 CTGAAGGCTGCTATGGGGCTGGG + Intronic
1182285697 22:29245557-29245579 CTGCATGAAGCTTTGGGGGCTGG + Intronic
1182559548 22:31149036-31149058 CTCCTTGCTGCTCTGGGGTCTGG + Intergenic
1183191625 22:36325340-36325362 CTGCATGCAGGTCTGGGGTGTGG - Intronic
1183365259 22:37403446-37403468 CTGGATCCTGGTCTGGGTCCCGG + Intronic
1183366468 22:37409601-37409623 CGGCACGCTGCCCTGGGGCACGG - Intronic
1183386400 22:37518001-37518023 CTTCACGCTGCTCACGGGCCAGG - Exonic
1183425878 22:37739184-37739206 ACGGATGCTGCTCTGAGGCCTGG + Intronic
1183725902 22:39589667-39589689 CTCCATGCTCCTCTGAGGCCAGG - Intronic
1183937556 22:41272072-41272094 CTGCGTGCAGCTCTGAGGCTGGG - Intronic
1184601828 22:45548517-45548539 CTGGGGGCTGCACTGGGGCCCGG - Intronic
1184680438 22:46070144-46070166 CTCCATGCGGCTCTGGGCCAGGG + Intronic
1184743462 22:46442533-46442555 CTGCCTCCTGAGCTGGGGCCTGG + Intronic
1184837937 22:47035178-47035200 CTGCAGGCTGCTCTGCTGCCAGG + Intronic
1184850989 22:47120530-47120552 CTGCTTCCTGCTCTGGGACCAGG + Intronic
1185119525 22:48957679-48957701 CTGAAGGCTGCTGTGGGCCCAGG - Intergenic
1185227953 22:49663918-49663940 CTCGATCCTGCTCTGGGGTCTGG - Intergenic
1185275358 22:49948255-49948277 CTGCAGGCTGCCCTGGGTCTGGG - Intergenic
949268207 3:2185010-2185032 CTGCAAGCTCCTCCTGGGCCTGG + Intronic
950191185 3:10977287-10977309 CTGCATGAGGCTCTGGGCCCAGG - Intergenic
950398422 3:12751899-12751921 CTCCATCCTGCTCTGTGTCCTGG + Intronic
950688088 3:14633369-14633391 CTGGCTACTGCTCTGGTGCCAGG - Intergenic
953149142 3:40308976-40308998 CTGCCTGCTGGTCTGGGATCAGG - Intergenic
954486029 3:50851910-50851932 CGACATTCTGCTCTTGGGCCTGG + Intronic
954626405 3:52024255-52024277 CTGGATGCTGGTCTGGGACCTGG - Intergenic
954712473 3:52512025-52512047 CTGCAAGCTGCACCTGGGCCTGG + Intronic
954800338 3:53183535-53183557 CGGCAGCCTGCTCTGGGGACTGG + Exonic
955212581 3:56955661-56955683 GTGCATGCTGTTCTAGGGCAGGG - Intronic
958156560 3:89762429-89762451 TGGCATCCTGCTCTGGGTCCTGG + Intergenic
960056278 3:113278739-113278761 CTGGCTGCTGCTCTGGGGACTGG - Exonic
961529669 3:127532882-127532904 CAGGATGCTTCTCTGGAGCCTGG + Intergenic
961565833 3:127762776-127762798 CTGCATGCTGCTCTGGGCCAGGG + Intronic
961822618 3:129582869-129582891 CTCCATGCTTGTCAGGGGCCAGG - Intronic
962021091 3:131502736-131502758 CTGGGTGCTGCCCTGGGCCCGGG - Exonic
962846924 3:139281283-139281305 CTGGAGGCTGCTCTAGGGCCAGG + Intronic
962932123 3:140048483-140048505 GTGCTTGCTCCTCGGGGGCCAGG + Intronic
963837096 3:150068572-150068594 CTCCATGCTGCTTTGTGCCCTGG - Intergenic
963890585 3:150631913-150631935 CTGCATTCTGCTCTGTGGTATGG - Intergenic
964195339 3:154058026-154058048 CTCCATGCTACTCTGTGCCCTGG - Intergenic
966389486 3:179437206-179437228 GTGGGTGCTGCTCTGGGGTCTGG - Intronic
966648186 3:182270118-182270140 TTGCAAGCTGCTCTAGGGCAAGG - Intergenic
967305850 3:188058740-188058762 CTGCAGGCTCCTCTAGGGCAAGG - Intergenic
968521812 4:1037604-1037626 CTGCAGGCAGCCCTGAGGCCCGG + Intergenic
968609201 4:1549484-1549506 CTGCCTGGGGCTCTGGGGCTGGG - Intergenic
968643198 4:1725349-1725371 CTACATCCTTCTCTGGGCCCTGG + Intronic
968645314 4:1737736-1737758 CTGCAGGCCGCTCTGGGGCTTGG + Intronic
968652340 4:1765215-1765237 CTGCAAGCTGCACTGGGGCCAGG - Intergenic
968680486 4:1915585-1915607 CTGGATGCTTCCCTGGGTCCAGG + Intronic
968709468 4:2102395-2102417 CTGCCTGCTGGCCTGGGGGCTGG + Intronic
968882958 4:3310524-3310546 GTCCATGCTGCTCTGGGTCCAGG + Intronic
969098477 4:4751733-4751755 CTCCATGACGCCCTGGGGCCGGG - Intergenic
969204504 4:5633257-5633279 CTGCATTCTCCTCTGGAGCTTGG - Intronic
969661960 4:8535592-8535614 CTGCCCTCTGCCCTGGGGCCTGG + Intergenic
969682709 4:8652183-8652205 GGGCATTCTGCTCAGGGGCCAGG - Intergenic
973260924 4:48162236-48162258 CTGCATTCTGTTCAGAGGCCAGG - Intronic
973546918 4:51991425-51991447 CTCCATCCTGCTCTGTGGCCTGG + Intergenic
974730771 4:65862908-65862930 CTCCATGCAGCTCTGCAGCCTGG + Intergenic
975615782 4:76245563-76245585 CAGCAAGCTGCACTGGGGGCTGG - Intronic
976149054 4:82074951-82074973 CTGCTGGCAGCTCTGTGGCCTGG + Intergenic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
978761659 4:112359773-112359795 CTGCATGATGCTCTGCTTCCTGG - Intronic
982220831 4:153123879-153123901 GTGCATGCTGTTGTGGGGGCTGG - Intergenic
982546466 4:156739046-156739068 CTGCATGATGCACAGGTGCCTGG + Intergenic
983538310 4:168881497-168881519 CTGCATGCTGTTCTGTGAGCCGG + Intronic
985439601 4:189970975-189970997 CTGCTTGCTGGACTGGGGACAGG - Intergenic
985688186 5:1293264-1293286 CTGCATTCAGCTCTGGGGCCTGG + Intronic
987416793 5:17670632-17670654 CTGCAGGCAGCTCTGGCGTCAGG + Intergenic
988509729 5:31855010-31855032 CTGCAGGCGGCCCGGGGGCCTGG - Intronic
990003682 5:50922361-50922383 CTGCCTGGGGCTCTGGGGCTGGG + Intergenic
992127102 5:73653497-73653519 TTGCATGCTGCACTGAGGACAGG - Intronic
992637515 5:78739127-78739149 CTGCCTGCTGGACTCGGGCCAGG - Intronic
992715894 5:79510956-79510978 CTGCATGGGGCTGTGGGGCTGGG + Intronic
994932568 5:106207768-106207790 CAGAAAACTGCTCTGGGGCCAGG - Intergenic
995570169 5:113471755-113471777 CTGCCTGCCTCTCTGGGGGCAGG - Intronic
997260619 5:132463190-132463212 CTGCAGCATGCTCTGGGGCCAGG - Exonic
997336951 5:133115179-133115201 CTGCTTGTGGCTCTGGGGCCTGG + Intergenic
998183813 5:139963816-139963838 CTGCATGCTGGGGTGGGGCTTGG - Intronic
998250204 5:140547493-140547515 CTGGAAGCTGGTGTGGGGCCTGG + Intronic
1000252754 5:159510845-159510867 CTGTAAGCTGTTTTGGGGCCAGG + Intergenic
1001533519 5:172481841-172481863 CTGCTTGCTGCTGTGTGACCTGG - Intergenic
1001705973 5:173741510-173741532 CTCCATGCTGCCCTGGGCCCTGG - Intergenic
1002107022 5:176884660-176884682 CTTCATCCTGCCCAGGGGCCTGG - Intronic
1002675878 5:180912118-180912140 CAGCAGCCTGCTCTGAGGCCAGG - Intronic
1003035259 6:2636084-2636106 GTGAATGCTGACCTGGGGCCAGG + Intergenic
1003528920 6:6921312-6921334 CTTCCTGCTGCTGTGGAGCCGGG - Intergenic
1003965460 6:11248599-11248621 CTGCTGGCTGCTCAGGGTCCTGG + Intronic
1005466641 6:26122502-26122524 CTGCAGGCCGCTTTGTGGCCTGG - Intronic
1005896305 6:30182080-30182102 CTGCATTCTGCCCCTGGGCCTGG - Intergenic
1006045129 6:31288638-31288660 CTGCTTGCTGGTCTTGGGCTGGG + Intronic
1006747847 6:36357436-36357458 CTTCATCCTGCTCTGTGGCCAGG - Intronic
1007553097 6:42745356-42745378 CTGCAAGCTGCTCTGCGGTCCGG - Exonic
1007849321 6:44788700-44788722 CTGCATGCTGCTCTGCGGGGAGG + Intergenic
1008508611 6:52255401-52255423 CTGCCTTCTGCTCTGGACCCCGG - Intergenic
1008676063 6:53819995-53820017 ATGCATGCTGCCTTTGGGCCAGG + Intronic
1010287892 6:74100311-74100333 CTGAATGCTGGTCAGGGGCCTGG + Intergenic
1012539246 6:100341772-100341794 CTGCATGCTGCTCTGACACCTGG + Intergenic
1013190008 6:107794371-107794393 CTCCAGGCTGCTTTGGGACCAGG - Intronic
1015770410 6:136762699-136762721 CTGCAAGCTCCTCTAGGGACAGG + Intronic
1015964353 6:138683153-138683175 CTGTCTGCTTCACTGGGGCCGGG - Intronic
1015970091 6:138734923-138734945 CTGCATGCAGCCCTAGGCCCAGG + Intergenic
1016799855 6:148157546-148157568 CTGCAAGCTGCAGTGTGGCCAGG - Intergenic
1017039934 6:150300148-150300170 CCGCATGCTGCCCTGGCCCCTGG + Intergenic
1017629829 6:156385815-156385837 CTGCATGCTTCACTGGGCACAGG + Intergenic
1017813075 6:157998118-157998140 CTGCCTGCTGCTCTGCTTCCAGG + Intronic
1018047897 6:159980797-159980819 CTGAATTCTGCGCTGGGGGCTGG + Intronic
1018963524 6:168465897-168465919 CGGCATGCTGCTCTGAGAGCTGG + Intronic
1019063082 6:169271231-169271253 CGCCTTCCTGCTCTGGGGCCTGG - Intergenic
1019070592 6:169341797-169341819 CTGGAGGCTGCTCAGGGCCCTGG - Intergenic
1019159378 6:170058799-170058821 CTGCAGGCCGTTCTGGGGCAGGG + Intergenic
1019166897 6:170103089-170103111 CTTCCTGCTGCCCCGGGGCCAGG + Intergenic
1019313095 7:372213-372235 CTGCGTGCTGCTCGGGTGGCCGG + Intergenic
1019403240 7:868410-868432 CTGCAGGCTGCACCGTGGCCGGG + Intronic
1019648837 7:2145379-2145401 CTGCATTCTGGTCTTGGGGCTGG - Intronic
1021962196 7:25884276-25884298 GTGCATGCTGGTGTTGGGCCTGG - Intergenic
1023016363 7:35971664-35971686 CTCCATGCTGCTCGGCGGCGAGG + Intergenic
1023270465 7:38456444-38456466 CAGCATGCTGTTCAGGGGCCTGG + Intronic
1024604859 7:51014840-51014862 CTGCATGCTGCCCCGGCTCCTGG + Intergenic
1024869656 7:53948386-53948408 CTGCTTGGTTCTCTGGGGACAGG + Intergenic
1024996547 7:55276968-55276990 CCACATGCAGCTCTGGGGCCTGG + Intergenic
1025235031 7:57228634-57228656 CTGCCTGCTTCTCTGGGCCCAGG + Intergenic
1025635301 7:63315800-63315822 CTGGCTGTTGCTCTTGGGCCAGG - Intergenic
1025647394 7:63432370-63432392 CTGGCTGTTGCTCTTGGGCCAGG + Intergenic
1026568255 7:71507863-71507885 CTGCATGCTGATCTGAGGCGTGG - Intronic
1027001586 7:74658032-74658054 CTCCAGGCAGCTCCGGGGCCGGG - Exonic
1028198522 7:87934495-87934517 CTTCTTGCTGCTCTGTGTCCTGG + Exonic
1028581857 7:92417217-92417239 CTGAGAGCTGGTCTGGGGCCTGG - Intergenic
1029206017 7:98869792-98869814 CTGCCTCCTGCCCTGGGCCCCGG - Exonic
1029638660 7:101803916-101803938 CTGCATGCTGCTTTTTGGCTGGG - Intergenic
1030677409 7:112398555-112398577 CTCCACCCTGCTCTGGGCCCTGG + Intergenic
1032163707 7:129529647-129529669 CTGCACACTGCTCTGAGGGCTGG - Intergenic
1032428206 7:131838733-131838755 CTGCATTCTGGTCTGGGGAATGG - Intergenic
1033251542 7:139764759-139764781 CTGGGTGCTGCTCTCAGGCCTGG - Intronic
1033305354 7:140221528-140221550 CTGAATGCATCTCTGGGGCTTGG + Intergenic
1033616242 7:143017140-143017162 CAGCATGCTTCTCTCGAGCCAGG - Intergenic
1033663834 7:143422852-143422874 ATGCATGCTGCTCACTGGCCTGG + Intergenic
1034174807 7:149091442-149091464 CTGCAGGCGGCCCTGAGGCCGGG - Intergenic
1034355116 7:150445231-150445253 CTGAATGCAGCTCTGGGGTGGGG + Intergenic
1034355126 7:150445274-150445296 CTGCAGGCTGGTCTAGTGCCAGG + Intergenic
1034421713 7:150994198-150994220 TTGAATGCTGCTCTGCCGCCAGG + Intronic
1034444849 7:151108558-151108580 CCGAAGGCTGCTCTGAGGCCCGG - Intronic
1035296574 7:157870758-157870780 AGGAATCCTGCTCTGGGGCCAGG + Intronic
1035667942 8:1392661-1392683 CTCCATGCATCTCTGGGGACTGG + Intergenic
1037855654 8:22368939-22368961 CTCCATGGGGCTCTGGGGTCTGG - Intronic
1040079370 8:43271927-43271949 CTGCTTGCAGCTGTGGGGCCGGG - Intergenic
1041679446 8:60573424-60573446 CTGAAGGCTGCTGTGGGACCTGG + Intronic
1041928855 8:63266038-63266060 CTGCAGCCTGCTCTGGGGCGGGG + Intergenic
1044387250 8:91603492-91603514 CTGCATCTTGCTCTGTTGCCGGG - Intergenic
1044389601 8:91633880-91633902 CTGCAGGCTGGGCTGTGGCCTGG + Intergenic
1047916002 8:129584456-129584478 CTCCATAATACTCTGGGGCCAGG + Intergenic
1047977932 8:130149947-130149969 CTCCAGGCTGCTCTGGGGGCAGG + Intronic
1048047831 8:130790129-130790151 GTGCATGCTGCTTTGAGGGCTGG + Intronic
1048690857 8:136961571-136961593 CTGCAGGCAGCTCTGGTGCAAGG - Intergenic
1049016537 8:139924065-139924087 CTGCACTGAGCTCTGGGGCCTGG - Intronic
1049355828 8:142187563-142187585 CAGCCTGCTCCTCTGGGGGCCGG + Intergenic
1049606067 8:143529739-143529761 CTGGGTCCTGCTCTGGGGCTGGG + Intronic
1049649987 8:143761311-143761333 CTGCCTGCTGCTCCGGCCCCGGG + Intergenic
1049846340 8:144803697-144803719 GTGCCTGCTGGTCGGGGGCCAGG - Exonic
1049939526 9:531948-531970 GTGCATGCTGCTTGGAGGCCAGG - Intronic
1050546018 9:6709665-6709687 TTGCATTCTAATCTGGGGCCTGG + Intergenic
1051561622 9:18447801-18447823 ATGCATGCCCCTCAGGGGCCTGG + Intergenic
1053645270 9:40116444-40116466 CTGCATGCTTACCTAGGGCCTGG + Intergenic
1053661979 9:40290659-40290681 GAGCACGCTGCTCAGGGGCCTGG + Intronic
1053747966 9:41220065-41220087 CTGCTTGCTGGACTGGGGACAGG - Intergenic
1053760445 9:41347084-41347106 CTGCATGCTTACCTAGGGCCTGG - Intergenic
1053912429 9:42920823-42920845 GAGCATGCTGCTCAGGGGCCTGG + Intergenic
1054326292 9:63714344-63714366 CTGCATGCTTACCTAGGGCCTGG + Intergenic
1054374105 9:64436895-64436917 GAGCACGCTGCTCAGGGGCCTGG + Intergenic
1054479318 9:65645298-65645320 CTGCTTGCTGGACTGGGGACAGG + Intergenic
1054522630 9:66085625-66085647 GAGCACGCTGCTCAGGGGCCTGG - Intergenic
1054539302 9:66259527-66259549 CTGCATGCTTACCTAGGGCCTGG - Intergenic
1054575432 9:66851971-66851993 CTGCATGTTATTCTGGGGCATGG + Intergenic
1055781870 9:79829307-79829329 CTGCATGGGTCTCTAGGGCCAGG - Intergenic
1057216307 9:93230691-93230713 CAGCTGGCTGCTCAGGGGCCTGG + Intronic
1057758508 9:97854702-97854724 CCGCAGGCTGCACCGGGGCCCGG + Exonic
1058674866 9:107391619-107391641 TGCCATGCTGCTCTGGGGTCAGG - Intergenic
1060378696 9:123143358-123143380 GTGCTTGCTGCTCTGCAGCCAGG + Intronic
1060814854 9:126629701-126629723 CTTCTTACTGCTCTGGGGGCAGG + Intronic
1060930427 9:127486345-127486367 CTGATGGCTGCTCTGGGGTCCGG + Intronic
1060941695 9:127546286-127546308 GGGGATGCTCCTCTGGGGCCTGG - Intronic
1061153172 9:128841047-128841069 CTGCATACTGTTCTGTTGCCTGG - Intronic
1061309010 9:129750329-129750351 CTGCATTCTCCTCTGGGGTAGGG - Intronic
1061531807 9:131219913-131219935 CTGCAGGATGATATGGGGCCTGG + Intronic
1062058560 9:134482246-134482268 CTGCGTCCTGCTCTATGGCCTGG + Intergenic
1062390864 9:136333366-136333388 CTGCTGCCTGCTCTGGGGCCTGG - Intronic
1062542526 9:137047962-137047984 CTGCCTTCTGCTCTGGAGCCAGG - Intergenic
1202784102 9_KI270718v1_random:30844-30866 CTGCTTGCTGGACTGGGGACAGG - Intergenic
1185471943 X:389274-389296 CTTCAGTCTGCGCTGGGGCCCGG + Intergenic
1192495882 X:71616463-71616485 GTGGATGCTGCTCTTGCGCCTGG - Exonic
1192759859 X:74085904-74085926 CTGCATCCTGCCCTGAGTCCTGG + Intergenic
1192759908 X:74086167-74086189 CTGTGTTCTGCTCTGGGGCTAGG + Intergenic
1196750211 X:119109184-119109206 CCCCATGCTGCTCTTGGCCCTGG + Exonic
1196935590 X:120727466-120727488 CTGCAAGCTGCCCTAGGGGCAGG + Intergenic
1198827318 X:140713059-140713081 CAGAATGCGGCTGTGGGGCCAGG + Intergenic
1199965711 X:152818953-152818975 TTCCTTGCTGCTCTGGGGCCTGG - Intergenic
1202109819 Y:21407283-21407305 CGGCAGGCTGCTCTGAGGGCAGG - Intergenic
1202301745 Y:23423022-23423044 TTACATGCTAGTCTGGGGCCTGG + Intergenic
1202366943 Y:24172108-24172130 CTGCTGGGGGCTCTGGGGCCAGG - Intergenic
1202373463 Y:24213375-24213397 CTGCTGGGGGCTCTGGGGCCAGG + Intergenic
1202497318 Y:25456745-25456767 CTGCTGGGGGCTCTGGGGCCAGG - Intergenic
1202503839 Y:25498015-25498037 CTGCTGGGGGCTCTGGGGCCAGG + Intergenic
1202569066 Y:26247576-26247598 TTACATGCTAGTCTGGGGCCTGG - Intergenic