ID: 1103852064

View in Genome Browser
Species Human (GRCh38)
Location 12:123939888-123939910
Sequence TGTCCTTCCCCCAGGGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 1, 1: 0, 2: 9, 3: 65, 4: 441}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103852049_1103852064 28 Left 1103852049 12:123939837-123939859 CCCTGCAACCTGAAATGCTGACC 0: 1
1: 0
2: 2
3: 14
4: 192
Right 1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG 0: 1
1: 0
2: 9
3: 65
4: 441
1103852050_1103852064 27 Left 1103852050 12:123939838-123939860 CCTGCAACCTGAAATGCTGACCT 0: 1
1: 0
2: 0
3: 9
4: 183
Right 1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG 0: 1
1: 0
2: 9
3: 65
4: 441
1103852053_1103852064 20 Left 1103852053 12:123939845-123939867 CCTGAAATGCTGACCTGGGCACG 0: 1
1: 1
2: 0
3: 11
4: 106
Right 1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG 0: 1
1: 0
2: 9
3: 65
4: 441
1103852057_1103852064 7 Left 1103852057 12:123939858-123939880 CCTGGGCACGGCATTGGGCCTGG 0: 1
1: 0
2: 1
3: 22
4: 221
Right 1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG 0: 1
1: 0
2: 9
3: 65
4: 441
1103852048_1103852064 29 Left 1103852048 12:123939836-123939858 CCCCTGCAACCTGAAATGCTGAC 0: 1
1: 0
2: 0
3: 19
4: 192
Right 1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG 0: 1
1: 0
2: 9
3: 65
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103852064 Original CRISPR TGTCCTTCCCCCAGGGCCTG TGG Intronic
900156656 1:1205904-1205926 GCTTCTTCCTCCAGGGCCTGTGG - Intronic
900367378 1:2316708-2316730 TGTCCTGCCTCCAGGCCCAGGGG - Intergenic
900426018 1:2579214-2579236 CGTCCATCCCGCTGGGCCTGAGG - Intergenic
900482380 1:2905435-2905457 TGTCCTGACCGCTGGGCCTGGGG - Intergenic
900938650 1:5783276-5783298 TGTCCTTCCCCTGGTGTCTGTGG + Intergenic
901511930 1:9721867-9721889 TGCCCGCCCCCCAGGGCCTTGGG - Intronic
901661955 1:10804223-10804245 AGGCCTGGCCCCAGGGCCTGTGG + Intergenic
902458960 1:16556832-16556854 GGTTTTTCACCCAGGGCCTGTGG + Intergenic
902493196 1:16851084-16851106 GGTTTTTCACCCAGGGCCTGTGG - Intronic
902737663 1:18411943-18411965 TGTCCTTCCCTGAGTGGCTGGGG - Intergenic
902782122 1:18711618-18711640 CGTCCTTCCCCAGGGGCTTGAGG - Intronic
903022142 1:20401875-20401897 TGGCCTTCTCTCATGGCCTGGGG + Intergenic
903080262 1:20805247-20805269 TGTCCTTGGCCCAGGGGCTGGGG - Intergenic
903379314 1:22885853-22885875 AGTCCCTCCCCCAGGGCCTGGGG + Intronic
903796712 1:25934554-25934576 AGTCCCTCCCCTTGGGCCTGTGG + Intergenic
903797963 1:25944476-25944498 TCTTCTCCCCCCAGGGCTTGAGG - Intergenic
904036346 1:27561165-27561187 TTTCCTTCCTCCTGGGCCTCTGG - Intronic
904354035 1:29926951-29926973 TGCCCCTCCCCCAGGGCTTCGGG - Intergenic
905544877 1:38789872-38789894 TGTCGGTCCTCCAGGGCCTGGGG + Intergenic
905582833 1:39095204-39095226 ATTCCTTCCCCCAGGGTATGGGG + Intronic
905624542 1:39479512-39479534 TGTGCTTACCCCAGGGACAGTGG + Intronic
905772944 1:40650007-40650029 TGATGTTCCCCCAGGGCCTCAGG + Intronic
906290134 1:44614386-44614408 TGTCTTTTCCCGAGGGGCTGGGG - Intronic
906430690 1:45753617-45753639 TGTCCTTCCCCTATTGACTGGGG + Intergenic
907300376 1:53483057-53483079 TGCCCTTCCTCAAGGGCCTAGGG - Intergenic
907307839 1:53523388-53523410 TCTCCCTATCCCAGGGCCTGAGG + Intronic
907460490 1:54602591-54602613 TCTCCATCCCCCAGGGCCCAAGG - Intronic
907528894 1:55073030-55073052 ATTGCTTCCCCCAGGGGCTGGGG + Intronic
909583019 1:77259390-77259412 TGACTCTCCCCAAGGGCCTGTGG - Intergenic
910236825 1:85045694-85045716 AGTCCTTCCCCCAGGTCCTCAGG - Intronic
913075169 1:115336081-115336103 TCTCCTGCCCCAAGGGCCAGTGG - Intronic
913600967 1:120420927-120420949 TGGCCGTCCACCAGGTCCTGGGG + Intergenic
914086089 1:144455706-144455728 TGGCCGTCCACCAGGTCCTGGGG - Intronic
914191981 1:145419657-145419679 TGGCCGTCCACCAGGTCCTGGGG - Intergenic
914362104 1:146944369-146944391 TGGCCATCCACCAGGTCCTGGGG + Intronic
914589888 1:149097607-149097629 TGGCCGTCCACCAGGTCCTGGGG - Intronic
914825481 1:151135854-151135876 TGCCCTTCCCCCAGGCCCCAGGG + Intronic
914830976 1:151170655-151170677 TCTCCCTCCCCCAGCGCCAGTGG - Exonic
915120983 1:153629416-153629438 TGTCCAGCCCCCTAGGCCTGGGG + Intronic
915766042 1:158363963-158363985 TGTCAGTCCCCCTTGGCCTGTGG + Intergenic
916393821 1:164363460-164363482 TGTCCTTCAGCCTGGGCCTATGG + Intergenic
916818972 1:168379603-168379625 TGGCCCTTCCCCAGTGCCTGTGG - Intergenic
917725871 1:177826599-177826621 TTTCCTTCCCCCTGGGGCTCTGG + Intergenic
918039816 1:180907182-180907204 TGACTTTCTCGCAGGGCCTGGGG + Intergenic
919806433 1:201383442-201383464 AGGCCTGCCCCCAGGGCCTGAGG + Intronic
920379673 1:205528232-205528254 TTTGCTTCCCCAAGGGCCTCGGG + Intronic
920398263 1:205661709-205661731 TATCCTAGCCCCAGGGCCAGAGG - Intronic
920967200 1:210711166-210711188 TCTCCTTCCCCCATGGTCTGGGG - Intronic
921265436 1:213417523-213417545 TGGCTTTCCCCCAGGGTCTGGGG - Intergenic
923064282 1:230503962-230503984 TCACCTTCCCCCATGGCCTCAGG + Intergenic
1063320838 10:5051813-5051835 TGTCTTTCCCTTATGGCCTGTGG - Intronic
1063453864 10:6169530-6169552 TGTCTGTTCCCCAGGCCCTGAGG + Intronic
1063848986 10:10163082-10163104 TGTCACTCCCCCATGGACTGGGG + Intergenic
1065632334 10:27693212-27693234 TGTGCCTCCCCCAGAGCCTGTGG + Intronic
1066543063 10:36470001-36470023 TGTCCTTGCCCCTGGGTCTATGG + Intergenic
1067112413 10:43409439-43409461 TGTCCTTCCTCCAGGGCCTCAGG - Intergenic
1067359118 10:45560681-45560703 TGTCGTTCAGCCAGGGTCTGCGG + Intronic
1067779377 10:49188403-49188425 TGTCCTGTCCCCAGAGCCTTGGG - Intronic
1069775169 10:70922655-70922677 TGTCCCTCTCCCAGGGCCCATGG - Intergenic
1070509773 10:77150189-77150211 TGTTCTTCACCCACTGCCTGAGG + Intronic
1070795449 10:79213654-79213676 TGCCCTGAACCCAGGGCCTGAGG + Intronic
1071567942 10:86681160-86681182 CTTCCTGCCCCCAGGGCCCGAGG - Intronic
1073185359 10:101612428-101612450 TGACTTTCCCCCAGGGGCTGGGG - Exonic
1073205197 10:101765416-101765438 TGTCCTTCCCCTAGGTCATCAGG + Intergenic
1073242811 10:102069215-102069237 TGTCCCTACCCCTGGGCCTCTGG - Intergenic
1073480421 10:103783167-103783189 GGGCCATCACCCAGGGCCTGGGG + Intronic
1073483936 10:103804915-103804937 TCTGCTTCCCACAGGCCCTGGGG + Intronic
1073483939 10:103804923-103804945 TGCTCCTGCCCCAGGGCCTGTGG - Intronic
1073640302 10:105245758-105245780 TGTAATTTTCCCAGGGCCTGAGG - Intronic
1074693792 10:116029841-116029863 TGTCCTTCCCCCTGCTCCTCAGG + Intergenic
1075728658 10:124623464-124623486 GGTCCTGCCCCCTGGGCCGGAGG + Exonic
1076048293 10:127312588-127312610 TGTCCTTACCCCCGGGCTTGAGG + Intronic
1076404891 10:130205123-130205145 CCTTCTTCCACCAGGGCCTGTGG + Intergenic
1076507303 10:130986678-130986700 TGACCCTCCCCCCTGGCCTGGGG + Intergenic
1076586518 10:131552181-131552203 TGTGCTTCCCACAGAGCCTAGGG - Intergenic
1076666380 10:132095299-132095321 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1076904250 10:133354467-133354489 GGGGCTTCCCCCAGGGCCTGGGG - Intergenic
1076918470 10:133439091-133439113 TGTCCTGGACCCAGGGGCTGGGG + Intergenic
1076999477 11:315570-315592 TGCCCCTCCCACAGGGCCTAAGG - Intergenic
1077089482 11:771948-771970 TCTCCCTGCCTCAGGGCCTGTGG + Intronic
1077356412 11:2120952-2120974 TGGGTTGCCCCCAGGGCCTGAGG + Intergenic
1077518734 11:3018467-3018489 TGTCCTTCCACGAGTGCATGAGG + Exonic
1077552627 11:3207872-3207894 TTTCAGTCTCCCAGGGCCTGAGG - Intergenic
1077826084 11:5809305-5809327 TGTCACTCCCCCATGGGCTGGGG + Intronic
1078257633 11:9673652-9673674 TTTCCTTCCTCCAGGGTATGGGG + Intronic
1078552036 11:12287833-12287855 TGCCCCTCGCTCAGGGCCTGAGG - Intronic
1079627793 11:22635884-22635906 AGACCTTCCTCCATGGCCTGGGG + Intronic
1080119745 11:28663659-28663681 TGTCTTTGCCTCAGGGCCTTAGG + Intergenic
1080552959 11:33389940-33389962 TGGGATTCCCCCATGGCCTGAGG - Intergenic
1080651028 11:34222868-34222890 TGTCGTTCCCCCAGAAACTGGGG - Intronic
1081906860 11:46675705-46675727 TGGCCTTCCTCCAGGCACTGGGG - Intergenic
1082101596 11:48177358-48177380 TGTCACTCCCCCATGGGCTGGGG + Intergenic
1083355684 11:62064398-62064420 TGTCCTTCCTCCAGGGTATGGGG + Intergenic
1083777965 11:64903417-64903439 GATCCTTCCCCCAGGTGCTGGGG - Intronic
1083902267 11:65649400-65649422 TGGCAGTCCTCCAGGGCCTGGGG + Exonic
1083936083 11:65870879-65870901 TGTCCTTCCTCCAAGGCCTGTGG + Intronic
1083954178 11:65974018-65974040 TGTCCCTCTCCCTGGGGCTGGGG - Intronic
1086420470 11:86632848-86632870 TAGCCCTGCCCCAGGGCCTGGGG - Intronic
1087276831 11:96169412-96169434 TTTCCTGCTCCCAGGCCCTGGGG + Intronic
1088537804 11:110880589-110880611 TGTTCTTCCCCCTGCGCCAGTGG - Intergenic
1089009077 11:115118327-115118349 TGTCATTCCCCAAGGGCCCCAGG - Intergenic
1090186435 11:124741986-124742008 TCTCCATGGCCCAGGGCCTGGGG + Intronic
1091223454 11:133944393-133944415 TGTCCTTACCTGATGGCCTGTGG - Intronic
1091645529 12:2269800-2269822 TGTCATCACCCTAGGGCCTGAGG + Intronic
1092055736 12:5506794-5506816 GGTCCTTCCACCAGGGCAAGGGG - Intronic
1094616912 12:32044222-32044244 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1094681329 12:32669915-32669937 TGTCCCTACCCCATGGGCTGGGG + Intergenic
1096431704 12:51549721-51549743 AGTCCATGGCCCAGGGCCTGGGG - Intergenic
1096747535 12:53738599-53738621 TGTCCTCCCCCGAGGGACAGTGG + Intergenic
1096790501 12:54041574-54041596 TATCCTTCCCACCTGGCCTGTGG - Intronic
1096869715 12:54585677-54585699 TGTCATCCCCCCACGGCCAGTGG - Intronic
1097264074 12:57736063-57736085 CATCCTTTCCCCCGGGCCTGTGG - Intronic
1100308269 12:93371130-93371152 ATTCCTTCCCCCAGGGTATGGGG + Intergenic
1101897771 12:108768978-108769000 TGCCCTGCCCCCTGGGGCTGCGG + Intergenic
1102187161 12:110957785-110957807 CGTCCCTCCCCAAGGGCCCGAGG + Intergenic
1102285569 12:111653573-111653595 TTTCTTTCCCCCAGTGCCTTAGG - Intronic
1102421302 12:112804956-112804978 TCTCCTTTCACCAGGGCCAGTGG - Intronic
1102591701 12:113960992-113961014 GCTCCTTCCCCCAGGGGCAGTGG - Intronic
1102950603 12:117028324-117028346 TGCACTTCCCCCAGCGCCTGGGG + Exonic
1103852064 12:123939888-123939910 TGTCCTTCCCCCAGGGCCTGTGG + Intronic
1104847575 12:131854416-131854438 TGCCCTGCCTCCTGGGCCTGGGG - Intergenic
1104948759 12:132429335-132429357 TGTCCTTTCCATGGGGCCTGTGG + Intergenic
1105026634 12:132853457-132853479 GGTGCATCCCCCAGGGCCTGTGG + Exonic
1105292222 13:19060458-19060480 AGTCCCTGCCCCTGGGCCTGTGG - Intergenic
1107446284 13:40472684-40472706 TCTCCCTCCCCCTGGGACTGTGG - Intergenic
1108429604 13:50340809-50340831 TGTCCTTCCTCAAGGAGCTGAGG - Intronic
1108586973 13:51878538-51878560 GGTCCCTCCCCCAGCACCTGGGG + Intergenic
1108851819 13:54739390-54739412 TGTCCTTCCCCCAACACATGGGG - Intergenic
1109692238 13:65909239-65909261 TCCACTTCCCTCAGGGCCTGAGG - Intergenic
1110793528 13:79611866-79611888 TGGCCTTTCCCCAGTGCCTCTGG + Intergenic
1111864567 13:93752700-93752722 TGTCATCCCCACAGGACCTGAGG + Intronic
1113423865 13:110191908-110191930 TGTCCTTCCCTCAGGGTCTCTGG - Intronic
1113469111 13:110531812-110531834 TGACCTTCTCCCTGGTCCTGGGG + Intronic
1113809001 13:113126299-113126321 TGTCCTACCCCCATGAGCTGGGG + Intronic
1114675941 14:24440425-24440447 TGCCCTTTCGCCTGGGCCTGGGG - Exonic
1115122178 14:29950931-29950953 GGTCCCTCCCTCAGCGCCTGGGG - Intronic
1115247558 14:31311895-31311917 TGTTCTTCCCCCATGGGCTGTGG + Intronic
1119180114 14:72599930-72599952 TGTCCTGGCCCCAAGGCCTCAGG + Intergenic
1119391259 14:74292685-74292707 TGTCCTTGGCCCAGTGTCTGTGG - Intronic
1119480447 14:74954976-74954998 TGGCTGTCCCCCAGGTCCTGGGG - Intronic
1119627010 14:76186480-76186502 GTTCCTTCCCCCAAGCCCTGAGG - Intronic
1120026126 14:79586079-79586101 TATGCATCTCCCAGGGCCTGGGG - Intronic
1121026011 14:90616603-90616625 TGCACTGCCCGCAGGGCCTGGGG + Intronic
1121432142 14:93895142-93895164 TGTCCTTCCCTCATGGCCCTGGG + Intergenic
1121447275 14:93987171-93987193 TGCCCTGCCCTCAGGGCCTCTGG + Intergenic
1121815201 14:96923788-96923810 TCCCCTCCCCCCAGGGCCTCAGG + Intronic
1122395453 14:101425555-101425577 TGTCTTGCCCCCAGAACCTGAGG - Intergenic
1123457895 15:20442726-20442748 GGACCTTCCCCTAGAGCCTGTGG + Intergenic
1123473591 15:20571770-20571792 GGTCCCAGCCCCAGGGCCTGGGG + Intergenic
1123644418 15:22428583-22428605 GGTCCCAGCCCCAGGGCCTGGGG - Intergenic
1123660174 15:22557683-22557705 GGACCTTCCCCTAGAGCCTGTGG - Intergenic
1123733889 15:23166781-23166803 GGTCCCAGCCCCAGGGCCTGGGG + Intergenic
1124141953 15:27084956-27084978 TGTACATGTCCCAGGGCCTGTGG - Intronic
1124264043 15:28217879-28217901 GGACCTTCCCCTAGAGCCTGTGG + Intronic
1124314033 15:28652178-28652200 GGACCTTCCCCTAGAGCCTGTGG - Intergenic
1124504619 15:30262064-30262086 TGAGATTCCCCCAGGGCCTCGGG - Intergenic
1124507993 15:30295380-30295402 TGTTCTTCCCCCAGGGCTGGCGG - Intergenic
1124735562 15:32243277-32243299 TGTTCTTCCCCCAGGGCTGGCGG + Intergenic
1124738933 15:32276571-32276593 TGAGATTCCCCCAGGGCCTCGGG + Intergenic
1125222608 15:37356699-37356721 TGTCTTTCTCCCAGGGTTTGGGG + Intergenic
1125511325 15:40293976-40293998 ATGCCTTCCCCCAGGACCTGGGG + Intronic
1127384935 15:58459788-58459810 TGTCCTTCCCCCAAGGGGTAAGG - Intronic
1127863454 15:63013166-63013188 TGTCATTCTCCCTGGGCCTCAGG - Intergenic
1128080711 15:64855356-64855378 TGGGCCTCCCCCAGGGTCTGGGG - Intronic
1128111607 15:65079704-65079726 TCTCCATCCCCCAGGACCTGAGG + Intergenic
1128845600 15:70892033-70892055 TGCGCTTCTCCCAGCGCCTGAGG - Exonic
1129058002 15:72835808-72835830 TATCTTTCACCCAGGGCATGGGG - Intergenic
1129144506 15:73634352-73634374 TGTACTACCCTCAGGGCTTGTGG + Intergenic
1129394717 15:75237583-75237605 TATCCCTCCTCCAGGGCCAGAGG + Intergenic
1129892268 15:79079056-79079078 TGTGCTTGACCCAAGGCCTGGGG + Intronic
1130909828 15:88263361-88263383 TGTCCTACCACCTGGGCCTTTGG + Intergenic
1131136045 15:89936512-89936534 AGTCTATCCCCCAGGCCCTGCGG + Intergenic
1131519769 15:93105291-93105313 AGTCCTTCTCCGAGGGCCTGGGG - Intergenic
1131598561 15:93824339-93824361 TGTCCTTGCTCCAGTGCATGGGG + Intergenic
1132312181 15:100865247-100865269 TGCCCTTCCCCCATGGAATGTGG + Intergenic
1132513516 16:355148-355170 TGTTCTGGTCCCAGGGCCTGGGG - Intergenic
1132872550 16:2122293-2122315 TTCCCTTCCCCCAGGGGCTGTGG + Intronic
1133020053 16:2963347-2963369 TGGCCTCCCCCCAAGCCCTGGGG + Intergenic
1133411564 16:5573272-5573294 TGTCCCTTCCCCACGGCCTCGGG + Intergenic
1133912476 16:10078559-10078581 TCTCCTGCCCCCAGGGGCTGGGG - Intronic
1133962268 16:10504871-10504893 TGTCCTTTCCCCATTGGCTGAGG - Intergenic
1134551648 16:15141493-15141515 TTCCCTTCCCCCAGGGGCTGTGG + Intergenic
1136273852 16:29166352-29166374 TGCCCTTCTCCCAGGGCCCAGGG - Intergenic
1136414927 16:30097010-30097032 TGTCCTTTCCCCATTGGCTGGGG - Intergenic
1136415956 16:30103977-30103999 TGTCCTTTCCCCATTGACTGGGG - Intergenic
1136451881 16:30358285-30358307 TGGGCCTGCCCCAGGGCCTGTGG - Exonic
1136702373 16:32156127-32156149 GGACCTTCCCCTAGAGCCTGTGG + Intergenic
1136765294 16:32771361-32771383 GGACCTTCCCCTAGAGCCTGTGG - Intergenic
1136802805 16:33099023-33099045 GGACCTTCCCCTAGAGCCTGTGG + Intergenic
1137774262 16:51042414-51042436 TTTCCTTTCTCCAGGGACTGAGG + Intergenic
1138266544 16:55663914-55663936 ATTCCTTCCCCCAGGGCCTGGGG - Intronic
1139850825 16:69950910-69950932 GGTCCTCCTCCCAGGGCCCGGGG + Intronic
1139852591 16:69960064-69960086 TGTCCTCCTCCCAGAGCCTAAGG - Intronic
1139879808 16:70173822-70173844 GGTCCTCCTCCCAGGGCCCGGGG + Intronic
1139881562 16:70182972-70182994 TGTCCTCCTCCCAGAGCCTAAGG - Intronic
1140040519 16:71404479-71404501 TGTCACTCCCCCAGGAGCTGGGG - Intergenic
1140121221 16:72084526-72084548 TGTCTTTCCCCCATTGGCTGGGG - Intronic
1140370946 16:74412533-74412555 TGTCCTCCTCCCAGAGCCTAAGG + Intronic
1140372715 16:74421726-74421748 GGTCCTCCTCCCAGGGCCCGGGG - Intronic
1141593806 16:85085634-85085656 TCCCCTCCCTCCAGGGCCTGGGG - Intronic
1141795658 16:86271958-86271980 TCTCATTCCCCCAGGGTCAGCGG + Intergenic
1142077394 16:88128095-88128117 TGCCCTTCTCCCAGGGCCCAGGG - Intergenic
1142239288 16:88937872-88937894 TTTCCGTCCCCAGGGGCCTGGGG + Intronic
1142377998 16:89716814-89716836 TGTCCCTCCCCCAGAAGCTGGGG - Exonic
1203067682 16_KI270728v1_random:1033594-1033616 GGACCTTCCCCTAGAGCCTGTGG - Intergenic
1142737404 17:1909907-1909929 GCCCCTTCCCCCATGGCCTGGGG - Intergenic
1142865796 17:2790794-2790816 CGTCCTGCCCCGAGGGCCAGGGG + Intronic
1144517136 17:15926517-15926539 TGTCCCTGCCACAGGGCCTTTGG - Intergenic
1144775104 17:17781422-17781444 TGTCCTTCCCCCAAGAGGTGGGG - Intronic
1144941680 17:18946588-18946610 ATTCCTTCCCCCAGGGTGTGGGG + Intergenic
1145294214 17:21575172-21575194 TGTCCTTCCCTAAGGGTCTCAGG - Intergenic
1145369618 17:22298014-22298036 TGTCCTTCCCTAAGGGTCTCAGG + Intergenic
1145942293 17:28748910-28748932 CTCCCTTCCCCCATGGCCTGGGG + Intronic
1146352470 17:32106344-32106366 TGTGGTTCCTCCAGAGCCTGAGG + Intergenic
1147164783 17:38587329-38587351 TGTCTCTCCCCCAGGGCCCCAGG + Intronic
1147245401 17:39116969-39116991 TCTACTTCCCCCAGGAACTGGGG + Intronic
1147338832 17:39742127-39742149 TGTCCTTCCCCAAGGGCTTCAGG + Intronic
1147422630 17:40330325-40330347 GGGCCTCCTCCCAGGGCCTGTGG + Intronic
1147449623 17:40496053-40496075 GCTGCTTCCCCCAGGGACTGGGG - Exonic
1147508035 17:41039801-41039823 CTTCCTTCCTCCAGGGCATGGGG + Intergenic
1147743090 17:42679676-42679698 TGCGCTTCCGCCAGGACCTGCGG - Exonic
1147759314 17:42787457-42787479 TGTCTTCCCCCCTGAGCCTGAGG + Exonic
1148104373 17:45111589-45111611 TGTCCCTCCTCATGGGCCTGTGG + Exonic
1148191371 17:45681085-45681107 TGCCCCTCTCCCGGGGCCTGGGG + Intergenic
1148764539 17:50029408-50029430 TGTCATTCCCCCGGGCGCTGAGG - Intergenic
1149055362 17:52356842-52356864 TGCCCTGCCCCCAGGGCGTGGGG + Intergenic
1150757578 17:67929453-67929475 TGTGGTTCCTCCAGAGCCTGAGG - Exonic
1151368263 17:73630938-73630960 TCTTCGTCCACCAGGGCCTGAGG + Intronic
1151983909 17:77529734-77529756 TGTCCTTCCCGCAGGGCTTTAGG + Intergenic
1152546714 17:81004035-81004057 GGTCCCTCCCGCAGGGCCTGGGG - Intronic
1152772511 17:82179001-82179023 TGTGCGGCCACCAGGGCCTGGGG - Intronic
1152774030 17:82188641-82188663 TGTCCTTCTCCAGGGGGCTGTGG - Intronic
1152877290 17:82794095-82794117 GGCCCTTCTCCCAGGGCCTCGGG + Intronic
1153964359 18:10166622-10166644 AACCCTTGCCCCAGGGCCTGCGG + Intergenic
1154933886 18:21031133-21031155 CCTCTTTCCCCCAGGGCTTGCGG - Intronic
1155161283 18:23197753-23197775 TGACCTCCCTCCAGGTCCTGAGG - Intronic
1157422441 18:47558202-47558224 TGCCCTCCCCTCAGGGACTGAGG + Intergenic
1157959052 18:52132038-52132060 ATTCCTTCCCCCAGGGTATGCGG + Intergenic
1158558235 18:58492698-58492720 AGTCCATTCCCCAGGACCTGAGG - Intronic
1160346241 18:78134876-78134898 TGTCCTTCCCCCAGGGAAATGGG + Intergenic
1160346292 18:78135106-78135128 TGTCCTTCCCCCAGGGAAATGGG + Intergenic
1160930874 19:1568835-1568857 GGTGCACCCCCCAGGGCCTGGGG + Intergenic
1161041449 19:2112830-2112852 TGTCACTCCCCCAGGGGCTGTGG - Intronic
1161068067 19:2248093-2248115 CGTCCATCCCCCAGCCCCTGGGG + Exonic
1161206981 19:3046602-3046624 AGTCCTGCCACCGGGGCCTGTGG + Intronic
1161226507 19:3148908-3148930 TGGCCTTGCCCCAGGGTCTGGGG - Intronic
1161686196 19:5703854-5703876 GCTCCTTCCCCCAGGAGCTGAGG - Intronic
1161864930 19:6826752-6826774 CCTGCTGCCCCCAGGGCCTGGGG - Intronic
1162221196 19:9178161-9178183 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1162843306 19:13372109-13372131 TGCCATTCCCCCAGGGCCCCAGG - Intronic
1163057155 19:14728898-14728920 TGTCCTTCCCCCATGGGCTGGGG + Intronic
1163601853 19:18254064-18254086 CGTCATCCCCACAGGGCCTGGGG - Intronic
1163650190 19:18512989-18513011 TGTCCTTCCCCCAGGCCCATCGG - Intronic
1163875849 19:19866802-19866824 TGTCCTTCCCCCATTGGCCGGGG + Intronic
1163908445 19:20168018-20168040 TGTCCTTCCCCTATTGGCTGGGG - Intronic
1163933804 19:20423808-20423830 TGTTCTTCCCCTATTGCCTGGGG + Intergenic
1165878678 19:39027482-39027504 TGTCCTTCTCCCATGGCATCAGG - Intronic
1166098070 19:40554133-40554155 CCTCCTGCCCCCAGGGCCTGCGG + Exonic
1166233782 19:41441584-41441606 GGTCCTTGGCCCAGGGACTGGGG + Intergenic
1166441990 19:42823312-42823334 TGTCCTTGCCCTGGGCCCTGTGG - Intronic
1166700148 19:44877666-44877688 TGTCCTCCCCCGAGGGGGTGTGG + Intronic
1166718921 19:44986529-44986551 TGCCCTTCACCCACGGCGTGTGG - Exonic
1167468377 19:49662249-49662271 TCTCCTGCCCGGAGGGCCTGCGG - Exonic
1168154490 19:54465260-54465282 TGTCCTTCCACCTGGATCTGGGG - Exonic
1168202703 19:54828084-54828106 GGTCCTTCCCCCAGCCTCTGAGG + Intronic
1168588786 19:57615651-57615673 TGTCACTCCCCCATGGGCTGGGG + Intronic
925099958 2:1235754-1235776 TGTTCTTCTCCAAAGGCCTGGGG - Intronic
925118329 2:1398735-1398757 TGCCCTTCCCCCAAGGAATGGGG + Intronic
925784753 2:7421170-7421192 TGTCTTTCCACCAGTGCCTGTGG + Intergenic
926044749 2:9702397-9702419 TGTCTTTCCCCAAGTCCCTGTGG + Intergenic
926045804 2:9708854-9708876 TGACCCTCCCACAGGGCCTGAGG + Intergenic
926058259 2:9789400-9789422 TGTCCTTCCAGCTGGGCCTGGGG - Intergenic
926611296 2:14950958-14950980 TGTCCTTTCCCCAAGCCCTCAGG - Intergenic
927173127 2:20387062-20387084 TAGCCTTCTACCAGGGCCTGTGG + Intergenic
927209913 2:20632757-20632779 GCTCCTTCCTCCAGGGCCAGGGG + Intronic
927909151 2:26884281-26884303 TGTCCTTCTTCCAGGACCTGCGG + Intronic
927980119 2:27369875-27369897 GGAGCTTCCCCCTGGGCCTGGGG - Exonic
928073805 2:28244168-28244190 TGTCCTTCCCACTGGGCTTAAGG - Intronic
928105663 2:28469147-28469169 TGTCCTTCCCCCAGGACAGTAGG - Intronic
928619306 2:33072438-33072460 ATTCCTTCCTCCAGGGTCTGGGG + Intronic
929822722 2:45286245-45286267 AGTCCTGTCCCCAGAGCCTGGGG - Intergenic
929873127 2:45774644-45774666 TGTCTGTCTCCCTGGGCCTGTGG - Intronic
930535797 2:52644602-52644624 TTTCCTTCCCCCAGAGCAGGAGG - Intergenic
931676293 2:64699819-64699841 GGTCCCTCCCCCAGTGCATGGGG - Intronic
932812294 2:74835125-74835147 TCTCCTTCCCCGCGGCCCTGCGG + Intronic
934747806 2:96770916-96770938 TGTCCATCCCCCACGGGCTGGGG - Intronic
935559713 2:104547534-104547556 TGTCCTTCCTCAAGGTCCTGGGG + Intergenic
936006318 2:108892197-108892219 TGTCCTTCCCACAGTCCCAGTGG + Intergenic
936248855 2:110852033-110852055 TGCCCTTCTGCCAGGGCCAGGGG + Intronic
937254705 2:120546990-120547012 TTTCATACACCCAGGGCCTGTGG + Intergenic
938062330 2:128263204-128263226 TGCCCTTGCTCCCGGGCCTGTGG - Intronic
938074449 2:128324230-128324252 TGTGCTCCACCCAGGGCCTCAGG + Intergenic
938238104 2:129722728-129722750 TCTCCTCTCCCCAGAGCCTGAGG + Intergenic
938763756 2:134446816-134446838 CCTCCCTCCCCCAGAGCCTGCGG - Intronic
939788342 2:146543370-146543392 TGTCACTCCCCCATGGGCTGGGG + Intergenic
940381867 2:153024528-153024550 TGTTTTTACCCCAGTGCCTGTGG + Intergenic
941385126 2:164842111-164842133 TTTCCTTCCCCCAGGGCTTCGGG + Intronic
942177281 2:173346137-173346159 TGTCTTTCCCCCATTGGCTGGGG - Intergenic
942429722 2:175897927-175897949 ATTCCTTCCCCCAGGGTATGGGG + Intergenic
946149845 2:217756807-217756829 GATCCTGGCCCCAGGGCCTGGGG - Intergenic
947810093 2:232998667-232998689 TGTCTTTCCCACAGTGGCTGTGG + Intronic
948268273 2:236654637-236654659 TGTCTTTCCCCAAGGGGCAGGGG + Intergenic
948569152 2:238906711-238906733 CATCCTCCCCCCAGTGCCTGGGG + Intronic
948669878 2:239561527-239561549 TGTGCTTCCCGCAGAGCGTGTGG + Intergenic
949064836 2:241983760-241983782 TGTCCTAACCCCAGAGCCTGTGG + Intergenic
1169199942 20:3704044-3704066 TGTTCCTCCCCGAGGGGCTGAGG + Exonic
1169261689 20:4143802-4143824 AGTCCTTCCTCCAGGGAATGGGG - Intronic
1170126469 20:12969662-12969684 TGTCATTCAGCCAGGGTCTGTGG + Intergenic
1170683483 20:18547636-18547658 TCCCCTTCCCCCTGGCCCTGTGG + Intronic
1170780567 20:19422040-19422062 TCTCTTTCCCCCAGTGCTTGAGG + Intronic
1171168467 20:22994164-22994186 GGTCCTTCTCCCAGGGCATGTGG - Intergenic
1171190448 20:23155391-23155413 TGTCTTTCCCCCATTGACTGGGG - Intergenic
1171501079 20:25593779-25593801 CCTCCTTTCCCCAGGGCCTTTGG + Intergenic
1171877768 20:30594273-30594295 CGTCCTCCCTCCAGCGCCTGAGG + Intergenic
1172148981 20:32777478-32777500 TCGCCTTCATCCAGGGCCTGGGG - Intronic
1173017958 20:39243951-39243973 TTACCTTCCCCCAGGAACTGAGG - Intergenic
1173433604 20:43012994-43013016 TGTCCTTCCAACAGAGCCTGAGG - Intronic
1173644394 20:44624470-44624492 TGTCCTAACCACATGGCCTGCGG + Intronic
1173672673 20:44809638-44809660 TCTCCTTCCCTCATGGGCTGGGG - Intronic
1173929064 20:46803510-46803532 AGAGCTTCTCCCAGGGCCTGTGG + Intergenic
1174482558 20:50841839-50841861 GGGCCTTCCCTCAGGCCCTGCGG + Exonic
1175522220 20:59609242-59609264 TGCCCTGAGCCCAGGGCCTGGGG - Intronic
1175581385 20:60102447-60102469 TGTCCTACAGCCAGGGCCTCAGG - Intergenic
1175876116 20:62230985-62231007 CGTCATTCCCTCAGGGCCTTGGG - Intergenic
1175961832 20:62641338-62641360 TTTCCTTCCTCCAGGGCTTGGGG - Exonic
1178815193 21:35923125-35923147 TGTCCATCACCCAGAGCCCGTGG - Intronic
1178913899 21:36696583-36696605 TGTCCTTTTCCGAGGGCCCGAGG + Intergenic
1178983542 21:37284415-37284437 GGACCTTCCCTAAGGGCCTGTGG - Intergenic
1179008750 21:37536946-37536968 TGTCCTTCCCCCATTGGCTGGGG + Intergenic
1179120848 21:38544283-38544305 CAGCCTTCCTCCAGGGCCTGAGG - Intronic
1180840677 22:18957557-18957579 TGCACTGCCCCCAGGGTCTGGGG + Intergenic
1181042064 22:20196966-20196988 TGTCCTTCCCCTGAGCCCTGGGG + Intergenic
1181597395 22:23925286-23925308 TGTCACTCCCCCATGGGCTGGGG - Intergenic
1181642970 22:24214454-24214476 TGGGCTTCCTCCAGGGCCTCAGG + Intergenic
1181779716 22:25183927-25183949 TCACCTACACCCAGGGCCTGTGG - Intronic
1182041527 22:27242127-27242149 TGTCCTTCCCCAAGGGTAGGGGG + Intergenic
1183102844 22:35594385-35594407 TGTCCTTCCCATGAGGCCTGTGG + Intergenic
1183573371 22:38671056-38671078 TGTCCTTCCTCCAGAGACAGGGG + Exonic
1184063914 22:42104634-42104656 TGTCATTCCTCCATGGGCTGTGG + Intergenic
1184244823 22:43230664-43230686 TGTCTTCTCCTCAGGGCCTGAGG - Intronic
1184354902 22:43973338-43973360 AGTCCTTCCCTCTGGGCTTGGGG + Intronic
1184533278 22:45070445-45070467 TGTCCTGCCCCCAGGGCTCATGG + Intergenic
1184560416 22:45259853-45259875 TCTCACTCCCCCATGGCCTGCGG + Intergenic
1184647991 22:45906528-45906550 TGCTCTGCCCCCAGGGCCTCAGG + Intergenic
1184761469 22:46547173-46547195 TGTGCTGACCCCAGGGCCTGAGG + Intergenic
1184893661 22:47394472-47394494 TGTCCGTGCCCCAGAACCTGTGG + Intergenic
1185137384 22:49080516-49080538 TCTCCAGCCCCCTGGGCCTGTGG + Intergenic
1185253287 22:49816949-49816971 TATCCATCCGCCAGGACCTGAGG + Intronic
950015155 3:9750005-9750027 TCTCCCGCCCCCAGAGCCTGTGG - Exonic
950071292 3:10154932-10154954 ATTCCTTCCCCCAGGGTATGGGG - Intergenic
950643013 3:14360511-14360533 TGCCCACCCCCCAGGCCCTGGGG + Intergenic
950655252 3:14432504-14432526 TCTCCTTCCCCCATGGCCCAGGG - Intronic
950855566 3:16101503-16101525 TGTCCTTCCCCTATTGGCTGGGG + Intergenic
951219812 3:20057180-20057202 TGTCCTTCTCCCAGCTCCTAAGG - Intronic
954090258 3:48278621-48278643 TGTCACTCCCCCATGGGCTGTGG - Intronic
955198596 3:56829252-56829274 TGCCCTCCATCCAGGGCCTGCGG + Intronic
957893520 3:86389770-86389792 TGTCACTCCCCCATGGGCTGGGG + Intergenic
958182466 3:90077608-90077630 TGTCTTTCCCCCAAGGCTGGTGG + Intergenic
959177059 3:102926724-102926746 TGTCACTCCCCCATGGGCTGGGG + Intergenic
960706737 3:120489659-120489681 TGTCCTTCCCCTATTGGCTGGGG - Intergenic
960707675 3:120495969-120495991 TGTCCTTCCCCTATTGGCTGAGG - Intergenic
961404395 3:126668062-126668084 GGTCCTGTCCCCAGTGCCTGGGG + Intergenic
965322474 3:167266608-167266630 TGTTCTTCCCCCGTGGGCTGGGG - Intronic
965323513 3:167274821-167274843 TGTCCTTCCCCCATGGGCTGGGG - Intronic
967098630 3:186197500-186197522 TGTGCAGCCCCCGGGGCCTGTGG + Intronic
967881701 3:194306227-194306249 TTCCCTTCCCCCAGGGCAAGAGG + Intergenic
967981671 3:195069666-195069688 TGTCCTTCCCCCAGATCTGGAGG + Exonic
968284348 3:197499299-197499321 TGAGAATCCCCCAGGGCCTGGGG - Intergenic
968454941 4:692960-692982 AGTCCTTCCCCCAGGGCTTCGGG - Intergenic
969864780 4:10067681-10067703 TGACATCCCACCAGGGCCTGTGG + Intergenic
970300653 4:14678387-14678409 TGTCCTTCCTTCAGGCTCTGAGG - Intergenic
971949563 4:33327514-33327536 TGTCATTCGGCCAGGGTCTGTGG - Intergenic
976876854 4:89863255-89863277 TCTCCTTTCCACAGAGCCTGTGG - Intergenic
977601397 4:98937286-98937308 TGTCCCTCCCCGATGGGCTGGGG - Intergenic
979576025 4:122293541-122293563 AGTCCTACCACCAGGGCCTTGGG + Intronic
980351735 4:131692888-131692910 TGTCCTTCCCCCAGCATGTGGGG + Intergenic
982077844 4:151756332-151756354 TGTCCTTCCCCTAAGCCCTATGG - Intronic
984475053 4:180225117-180225139 TGGCCTTTTCCCAGGGCCTCTGG + Intergenic
985137514 4:186802027-186802049 TGTCCTTCCCCTATTGGCTGGGG + Intergenic
985240884 4:187929804-187929826 TGGCCTTCTCCCAGTGCCTCTGG + Intergenic
985630738 5:1012738-1012760 TGGCCTTCCCCCAGAGGCAGGGG + Intronic
985659947 5:1152061-1152083 GGACCTTCCCACAGGGCCAGGGG + Intergenic
985692202 5:1319642-1319664 TGCCCTTCCCTCAGGGCCTGGGG - Intronic
985708725 5:1416154-1416176 TGTGCTTCTCCCTGGGCGTGGGG - Exonic
986670696 5:10140361-10140383 TGACCTTCCCGTAGGGCCAGGGG - Intergenic
986870179 5:12036459-12036481 TGGCCTTTTCCCAGTGCCTGTGG - Intergenic
987045461 5:14103449-14103471 TGTCCCTCCCCCATGGGCTGGGG - Intergenic
988813564 5:34808570-34808592 TTTCCTTCCCCCAGCGGCTCAGG + Exonic
989380894 5:40808478-40808500 AGAACATCCCCCAGGGCCTGAGG - Intergenic
991944139 5:71883340-71883362 AGTCCTGCCCCAAGGTCCTGGGG - Intergenic
994310877 5:98268631-98268653 TGTGTTTCACCCAAGGCCTGCGG - Intergenic
994656858 5:102604851-102604873 TGTCCTTTCTCCAGGATCTGTGG - Intergenic
996754566 5:126922115-126922137 TTCCCTTCCCCCACGACCTGTGG - Intronic
997250034 5:132381446-132381468 TGTCCATCCCACAGGGCCCTGGG - Intronic
997519201 5:134511841-134511863 TGTTCTTCCCTCAGGGCCTTGGG - Intergenic
997524532 5:134543913-134543935 TGTCCTTCCCACAGGGGCTGGGG + Intronic
999312644 5:150561751-150561773 TGTCCTGCCCCCTGGGCCTGAGG + Intergenic
999326498 5:150647503-150647525 TGTTCCTGCCCCAGGGCCTTTGG - Intronic
999400006 5:151257339-151257361 TCTTCTTTCCCCAGGCCCTGGGG - Intronic
1000509417 5:162163787-162163809 TGCCATTCCACCAGGGCCTTGGG + Intergenic
1000711789 5:164588847-164588869 AGTCCTTCCCCCAAGACATGGGG + Intergenic
1002051459 5:176573942-176573964 TGTCCTTCCCACCAGGGCTGCGG - Intronic
1002401536 5:178994067-178994089 GCTCCTGCCCCCTGGGCCTGCGG - Intronic
1003921158 6:10834840-10834862 TGTCATTCAGCCAGGGTCTGCGG - Intronic
1004325493 6:14670540-14670562 TGTTCTTCCACCGGGGCCGGTGG - Intergenic
1005375273 6:25175464-25175486 ATTCCTTCCCCCAGGGTATGAGG - Intergenic
1005574388 6:27178274-27178296 TGTCCTTCCCCTATTGGCTGGGG - Intergenic
1006501019 6:34458823-34458845 CTTCCTTCCCCCAGGGTCTGGGG + Intergenic
1006841015 6:37027934-37027956 TCTCCTCCCCCCAGGACATGAGG + Exonic
1006854676 6:37124584-37124606 ATTCCTTCCTCCAGGGTCTGGGG - Intergenic
1007782394 6:44262096-44262118 TGTCCTTTCTCCAGGGCCTAAGG - Intronic
1013031415 6:106336822-106336844 TGTCCTTTCCCCAGGGCTGGGGG + Intergenic
1014818743 6:125961898-125961920 TTTCCTTCCTCCAGGGTATGAGG + Intronic
1018834447 6:167472524-167472546 TGTGCTTCCCTCACAGCCTGTGG - Intergenic
1018875139 6:167815764-167815786 TTTCCTTGCCTCAGTGCCTGTGG - Intergenic
1018945590 6:168345520-168345542 TCTTCCTCCCCCAGGGCGTGAGG - Intergenic
1019200161 6:170307324-170307346 TGTCTTTCCCCCAAGAGCTGGGG - Intronic
1019593236 7:1846191-1846213 TGCCCTTCCCGCAGGGCCAGGGG + Intronic
1019678380 7:2329637-2329659 TTTCCTTCCCCCAGGGAATAGGG - Intronic
1021355648 7:19650956-19650978 CGTGCTCCACCCAGGGCCTGAGG - Intergenic
1022044564 7:26612642-26612664 TGGCCCTCACCCAGGGCCAGTGG + Intergenic
1022503547 7:30897069-30897091 TTTCCTTACCCCTGGGCCCGGGG + Intergenic
1023392253 7:39721522-39721544 ATTCCTTCCCCCAGGGTATGAGG + Intergenic
1023862207 7:44223544-44223566 TGTCCTTGCCCCTGGGCCCCAGG + Intronic
1027174066 7:75892266-75892288 TGGCCTTATCCCAGGGGCTGGGG + Intergenic
1027224415 7:76235014-76235036 TGTCTGTCCCTCAGGGCCAGCGG + Exonic
1028843956 7:95459554-95459576 GCTCCTTCCTCCAGGGTCTGTGG - Intergenic
1029601105 7:101563902-101563924 TCCCCTTTCCCCAGGGGCTGTGG - Intergenic
1029627251 7:101727726-101727748 TTTCCTCCTCCCAGGGCCAGAGG - Intergenic
1029730348 7:102434267-102434289 TGTCCCTCCCCCTGGGCCACCGG + Intronic
1031562593 7:123256081-123256103 TGTTGTGCCCCCAGGGCCTCCGG - Intergenic
1032922730 7:136567448-136567470 TGCCCTTCTCCCAGTGCCTCTGG + Intergenic
1034431699 7:151044311-151044333 TGGCCTGGCCCCAGGGCCTTGGG + Intronic
1034952939 7:155313262-155313284 GGTGCTTCCTCCTGGGCCTGTGG - Intergenic
1035278644 7:157763578-157763600 TGGCCTTCCCCCATGGCCAGGGG - Intronic
1035557004 8:574779-574801 TGTCCTTCCTCCATGAACTGGGG + Intergenic
1035740840 8:1927287-1927309 TGTCCTGCCTACAGGGCCTGGGG - Intronic
1035874219 8:3170014-3170036 TGTCCTTTCCCCATTGGCTGGGG - Intronic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037367753 8:18140960-18140982 TGTCATTCCCTCATGGACTGGGG - Intergenic
1038328477 8:26589874-26589896 AGTCATTCCCCCAGTGCCTTGGG + Intronic
1038797539 8:30723121-30723143 TCCCTTTGCCCCAGGGCCTGGGG - Intronic
1039525087 8:38207555-38207577 AGTATTTGCCCCAGGGCCTGGGG - Exonic
1039779278 8:40768098-40768120 TGCCCTGCCCTCAGGGTCTGGGG + Intronic
1040921950 8:52631029-52631051 TGTCCTTCCCCTATTGGCTGGGG + Intronic
1041359866 8:57041732-57041754 TGTCCCTCCCGCATGGGCTGGGG + Intergenic
1041669491 8:60478482-60478504 ATTCCTTCCCCCAGGGCATGGGG + Intergenic
1041904010 8:63012176-63012198 ATTCCTTCCCCCAGGGTATGCGG + Intergenic
1042175243 8:66032216-66032238 TGTGCTCCCCACAGGCCCTGAGG + Intronic
1042536052 8:69860205-69860227 AGTATTTGCCCCAGGGCCTGGGG + Intergenic
1042787721 8:72567788-72567810 TTCCCTTCCTCCAGAGCCTGTGG + Exonic
1046651944 8:116845169-116845191 TGAACTTCCCCCAGGTACTGTGG + Intronic
1047313032 8:123708375-123708397 TGTTCTGCCACAAGGGCCTGGGG - Intronic
1048285090 8:133135297-133135319 TCTACTTCCTCCAGGGCCTGTGG - Intergenic
1048708109 8:137177354-137177376 GATCCTTCCCTCAGGACCTGAGG - Intergenic
1048719604 8:137308518-137308540 TGTCCATCCCCCAGCCTCTGTGG - Intergenic
1048956672 8:139543328-139543350 TCCCCTTCCCCCAGGATCTGGGG + Intergenic
1048991936 8:139765631-139765653 TGTCCTTCATCAAGGGCCTCTGG - Intronic
1049491399 8:142905048-142905070 ACCACTTCCCCCAGGGCCTGAGG + Intronic
1050289654 9:4140488-4140510 TTTCCTTCCCTCTGGGTCTGAGG - Intronic
1050640287 9:7660325-7660347 TGTACTTCCCCAAGTCCCTGAGG - Intergenic
1051733286 9:20170408-20170430 TGTCCCTCCCCCATGGGCTGGGG + Intergenic
1052989103 9:34508320-34508342 TATCCTTTACCCAGAGCCTGGGG + Intronic
1053443621 9:38135470-38135492 TCTCCTTTCCCTGGGGCCTGAGG + Intergenic
1054858405 9:69925489-69925511 TGTCACTCCCCCATGGGCTGGGG + Intergenic
1054859451 9:69933779-69933801 TGTCACTCCCCCATGGGCTGGGG + Intergenic
1054915032 9:70487812-70487834 AATCCTTCCCACAGAGCCTGGGG + Intergenic
1056092510 9:83218512-83218534 GGTCCTACCCCCACGGTCTGTGG - Intergenic
1056599767 9:88037588-88037610 TGTCACTCCCCCAGGGGCTGGGG + Intergenic
1056764247 9:89435132-89435154 TGCACATCCCCCAGGGCATGTGG + Intronic
1056777579 9:89525030-89525052 TGTCCTGTCCCCACCGCCTGGGG + Intergenic
1059439887 9:114301025-114301047 TGTCCTTGTTCCAGGGCCTGGGG - Intronic
1059712002 9:116877153-116877175 TGTCCTTCCCCTATTGGCTGGGG - Intronic
1060059264 9:120444462-120444484 TCTCCTACCCCCAGTGCATGAGG + Intronic
1060213777 9:121726147-121726169 TCTCCCTGCCCCAGGGGCTGTGG - Intronic
1060509620 9:124222429-124222451 TGTCCCTCAGCCAGGGACTGAGG + Intergenic
1060520256 9:124290335-124290357 AGTCCGGCCCCCAGGGCCTGTGG + Intronic
1060572669 9:124656880-124656902 CTTCCCTCCCCCAGGCCCTGGGG - Intronic
1060810402 9:126608788-126608810 TCTCCTTCAACCAGGGCTTGAGG - Intergenic
1061024742 9:128041174-128041196 ATTCCTTCCCCCAGGGTGTGAGG - Intergenic
1061071576 9:128314025-128314047 TGCCCTTCCTCCTGGGGCTGTGG - Intronic
1061118538 9:128629332-128629354 CCTCCTGCCCCCAGGTCCTGGGG + Intronic
1061791601 9:133061960-133061982 TGGCCCTCCCCCTGGGCCTCGGG - Exonic
1061812285 9:133169288-133169310 ATTCCTTCCTCCAGGGTCTGGGG + Intergenic
1061829028 9:133278877-133278899 TGTCCTTCCCCTATTGGCTGGGG + Intergenic
1061887076 9:133596533-133596555 TGTCTCTCCCCCATGGCTTGAGG - Intergenic
1062247381 9:135576156-135576178 TCTCCTCCCCCCGGGGCCTGAGG + Intergenic
1062351810 9:136143226-136143248 AGTCCGTGCCCCATGGCCTGGGG + Intergenic
1062425346 9:136503677-136503699 TGTGCTTCCTGCAGGGCCTGGGG - Intronic
1062466130 9:136682416-136682438 TGTCCTTTCCTCAAAGCCTGGGG + Intronic
1062503725 9:136862322-136862344 TGTCCTTTCCCCGGAGCTTGAGG + Exonic
1062525742 9:136977443-136977465 TGGCCTCCACCCAGGGCCCGGGG - Intergenic
1062654003 9:137592726-137592748 AGTCCCTCCCCGAGGGCCAGGGG + Intergenic
1186032527 X:5385495-5385517 TTTCTTTCCCCCAGGGCCAGAGG + Intergenic
1187487300 X:19716711-19716733 TGGCCTTCCCTCATGTCCTGAGG + Intronic
1189182582 X:39017990-39018012 TGACCTCCCACCAGGGACTGTGG + Intergenic
1190094426 X:47467334-47467356 TGACCTGTCCCCAGGGCCTAAGG - Intronic
1190594812 X:52042003-52042025 TCCCATTCCACCAGGGCCTGGGG - Intergenic
1190614012 X:52212070-52212092 TCCCATTCCACCAGGGCCTGGGG + Intergenic
1190620300 X:52280840-52280862 TGTCACTCCCCCATGGGCTGGGG + Intergenic
1192174882 X:68879343-68879365 TGTCCCTGCCCCATGGACTGTGG + Intergenic
1194044433 X:88984252-88984274 TGTCACTCCCCCATGGGCTGGGG + Intergenic
1194121727 X:89971383-89971405 TCCACTTCCCCCAGGGCCTGAGG - Intergenic
1195090077 X:101450350-101450372 AGTACTTCCCCATGGGCCTGTGG - Intronic
1196055252 X:111348559-111348581 TGCCCTTCCACAAGGCCCTGGGG + Intronic
1198729756 X:139716768-139716790 TCTGCTTCCCCGTGGGCCTGAGG - Intergenic
1199369907 X:147035290-147035312 TGAACTTCCCAGAGGGCCTGGGG - Intergenic
1199584241 X:149396394-149396416 TGTCCCTCCCCCATGGGCTGGGG - Intergenic
1200058997 X:153475776-153475798 TGTCCTTTTCCCAGGGCCCAGGG - Intronic
1200474583 Y:3628834-3628856 TCCACTTCCCCCAGGGCCTGAGG - Intergenic
1200777660 Y:7183847-7183869 TGTCACTACCCCATGGCCTGGGG + Intergenic
1200788510 Y:7279519-7279541 TGTCCTTTCCCCATTGGCTGGGG + Intergenic
1200802698 Y:7400849-7400871 TGTCCTTCCCCTATTGGCTGGGG - Intergenic
1200949262 Y:8878397-8878419 TGCCATTCCCCCATGGCCAGTGG + Intergenic
1201362053 Y:13163218-13163240 TGTCACTTCCCCATGGCCTGGGG + Intergenic
1201912138 Y:19143592-19143614 TGTCCTTTCCCCAGTGGCTGGGG - Intergenic