ID: 1103852383

View in Genome Browser
Species Human (GRCh38)
Location 12:123941464-123941486
Sequence CCATTTCCACCAAGCCTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103852383_1103852386 1 Left 1103852383 12:123941464-123941486 CCACTAAGGCTTGGTGGAAATGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1103852386 12:123941488-123941510 CTGTGTCTTTTACAAGGAACTGG 0: 1
1: 0
2: 0
3: 20
4: 249
1103852383_1103852385 -5 Left 1103852383 12:123941464-123941486 CCACTAAGGCTTGGTGGAAATGG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1103852385 12:123941482-123941504 AATGGTCTGTGTCTTTTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103852383 Original CRISPR CCATTTCCACCAAGCCTTAG TGG (reversed) Intronic
903276410 1:22224670-22224692 CCAGTTCAACCAACCCTGAGGGG - Intergenic
903674969 1:25057831-25057853 CCATCCCCACCAATCCCTAGAGG + Intergenic
905620578 1:39442444-39442466 TCAGTTCCAGCATGCCTTAGAGG + Exonic
906535623 1:46549518-46549540 CCATCTCCACCAATCCTATGGGG - Intronic
907400258 1:54220941-54220963 TCATTTCCAGCAAGCTTCAGTGG + Intronic
909853027 1:80493489-80493511 CCTTTTCCACTCAGCCTTCGTGG - Intergenic
911674668 1:100646294-100646316 CCACCCCCATCAAGCCTTAGGGG - Intergenic
913564504 1:120058606-120058628 CCATTTCCACCAAGTTTGTGAGG + Intronic
913633626 1:120734958-120734980 CCATTTCCACCAAGTTTGTGAGG - Intergenic
913971468 1:143421027-143421049 CCCCCTCCACCAAGCCATAGGGG + Intergenic
914065845 1:144246640-144246662 CCCCCTCCACCAAGCCATAGGGG + Intergenic
914113306 1:144719714-144719736 CCCCCTCCACCAAGCCATAGGGG - Intergenic
914285091 1:146217955-146217977 CCATTTCCACCAAGTTTGTGAGG + Intronic
914546122 1:148668694-148668716 CCATTTCCACCAAGTTTGTGAGG + Intronic
914620442 1:149401971-149401993 CCATTTCCACCAAGTTTGTGAGG - Intergenic
915146826 1:153800427-153800449 CCTTTCCCACCAAGACTTAGTGG - Intergenic
916346352 1:163796078-163796100 CCATTTCCACCTACCTTTTGTGG - Intergenic
918181321 1:182087714-182087736 CCATTTTCCCCAAGCAATAGAGG - Intergenic
919994740 1:202738924-202738946 TCATTTCCACCAAGTATTTGTGG - Intronic
920296264 1:204958994-204959016 CCATTTCCACCATGGCACAGAGG + Intronic
923956809 1:239031546-239031568 CCATTTCGAACCTGCCTTAGGGG - Intergenic
1064138215 10:12768528-12768550 TCATTTACACCAAACCTTAAAGG - Intronic
1065143598 10:22744006-22744028 CCTCTTCCCCCAAGACTTAGAGG - Intergenic
1067715247 10:48685467-48685489 CCATTTCCAACGGGCCTCAGAGG + Intronic
1072675912 10:97466007-97466029 CCCTTTCCAGCAAGGCTTTGGGG - Intronic
1076489692 10:130849984-130850006 CCATTGCCAACAGGCCTTATAGG + Intergenic
1077308408 11:1878000-1878022 CCCCCTCCACCAAGCCATAGGGG - Intronic
1078363563 11:10688712-10688734 CGATTTCCACCAAGCCGTGGTGG + Intronic
1078841375 11:15078359-15078381 GCAGCTCCACCAAACCTTAGGGG + Intronic
1085843653 11:80041887-80041909 CCATTTCCTCCAAGTCTGAAAGG - Intergenic
1086063450 11:82723187-82723209 CCATTTCCATCAAGCTTGTGTGG - Intergenic
1090445027 11:126756953-126756975 ACATATCCACCAAGACTCAGGGG + Intronic
1092146250 12:6216641-6216663 CCATTCCCATCCAGTCTTAGTGG + Intronic
1092785377 12:12021934-12021956 CCATTTCCCCCAACTCTTATTGG - Intergenic
1092854235 12:12657683-12657705 CCATCTCCACCAAGCATGTGGGG - Intergenic
1098520179 12:71426499-71426521 CCATTTCCAGCAATCCTGAGGGG + Intronic
1098974384 12:76887243-76887265 TAATTTCCACCAAGCCCTAATGG - Intergenic
1100022276 12:90083933-90083955 ACATTTTCACCAAGCCTTCAAGG - Intergenic
1103852383 12:123941464-123941486 CCATTTCCACCAAGCCTTAGTGG - Intronic
1113929392 13:113958281-113958303 CCCATTTCATCAAGCCTTAGGGG + Intergenic
1115800349 14:36986630-36986652 CCTGTTACAGCAAGCCTTAGTGG + Intronic
1122412200 14:101531403-101531425 CCATTTCCACCAGGATTAAGTGG - Intergenic
1129329828 15:74821305-74821327 CCTTTCCCTCCAGGCCTTAGGGG - Intronic
1133970980 16:10567814-10567836 CCATTTCCCCCTTGCTTTAGTGG - Intronic
1137393007 16:48097278-48097300 TCAATTCCACAAAGCCTTTGAGG - Intronic
1138295816 16:55884353-55884375 CCATCTCCACCACTCCTTACAGG + Intronic
1139934042 16:70554691-70554713 CACCTTCCAGCAAGCCTTAGGGG + Intronic
1141482830 16:84318298-84318320 CCATTGCCACCAAGCCATCGAGG - Exonic
1141975513 16:87513396-87513418 GCAGTGCCACCAAGCCTGAGGGG - Intergenic
1145783467 17:27579011-27579033 CTTTTTCCAGCAGGCCTTAGAGG + Intronic
1146568975 17:33936968-33936990 CCACCTCCACCAAGCCCAAGCGG + Intronic
1146569241 17:33938762-33938784 CCACCTCCACCAAGCCTGAGAGG + Intronic
1146572978 17:33968708-33968730 CCATTACCGCCATGCCTTACAGG + Intronic
1152073211 17:78144286-78144308 CCATTTTCCCCAGGCCTTGGGGG - Intergenic
1152277058 17:79363980-79364002 CCTTTTCCACCAGGCTTTATGGG + Intronic
1152973419 18:188190-188212 ATATTTCCACCAAACCTGAGGGG - Intronic
1155174663 18:23291737-23291759 CCATTTCCATCACACCTTATTGG + Intronic
1157738520 18:50072000-50072022 CCCTTTAGCCCAAGCCTTAGAGG - Intronic
1158975095 18:62703956-62703978 CCATTTTACCCAAGCATTAGGGG + Intergenic
1160251369 18:77206157-77206179 CCATGTGCACCAAGTATTAGTGG + Intergenic
1164345474 19:27250299-27250321 CCATTTCCACCAAGGCTTCAAGG - Intergenic
1165752981 19:38272394-38272416 ACATTTCCAAAAAGTCTTAGGGG + Intronic
1167747998 19:51364090-51364112 CCACCTCTACCCAGCCTTAGGGG - Intronic
1168276059 19:55279455-55279477 CCATCTGCAGCAAGCCTTGGAGG + Exonic
925127428 2:1469584-1469606 CCATTTCCACCTTGCCTCACAGG - Intronic
925773816 2:7311865-7311887 CAATTTACTCCAAGCCTTAGGGG - Intergenic
934176160 2:89581960-89581982 CCCCCTCCACCAAGCCATAGGGG + Intergenic
935268037 2:101411311-101411333 GCACCTCCACCAAGCCTCAGAGG - Intronic
937702512 2:124879924-124879946 CCATTCTCACCAAGCTTCAGAGG - Intronic
938942182 2:136178977-136178999 CCATTTTCACCAAGACTTTGTGG - Intergenic
944310290 2:198225505-198225527 CCTTTTGCCCCCAGCCTTAGTGG - Intronic
946870882 2:224083728-224083750 TCATTTCCACCAAACCTTGCTGG - Intergenic
946870995 2:224084904-224084926 TCATTTCCACCAAACCTTGTTGG + Intergenic
947117791 2:226790961-226790983 GCATTTCCTCCAAGCCTTTAAGG + Intronic
948581994 2:238993876-238993898 TCATTTCCACCAAGAATTGGTGG - Intergenic
1171023496 20:21608157-21608179 CCATTTCCAGCAACTCTGAGCGG + Intergenic
1175066985 20:56297325-56297347 ACTTTTCCACCAAGAATTAGAGG - Intergenic
1179343083 21:40531163-40531185 CCATGTCCTGCAAGCCTTGGTGG - Intronic
1181632224 22:24157220-24157242 CCCTTTCCTCCCAACCTTAGGGG + Intronic
1181784930 22:25220158-25220180 TCATTTCTACCATGCTTTAGTGG - Intronic
1181931544 22:26405697-26405719 GCATTTTCAGCAAGCCTTTGGGG + Intergenic
955188445 3:56737401-56737423 CCATTCACACCAAGTCTTAGGGG + Intronic
959596284 3:108132380-108132402 CCATTTCCACCATGCCATGTGGG + Intergenic
963546887 3:146671440-146671462 CCCTTTCCCCCACCCCTTAGAGG + Intergenic
968971036 4:3794012-3794034 CCATTTCCAGCAAGCAACAGAGG + Intergenic
970551204 4:17182908-17182930 GCATTTCCAACATGCCTTCGGGG + Intergenic
973697736 4:53507282-53507304 CCATGTCCATCCAGCCTTATGGG + Intronic
975804033 4:78093980-78094002 CCACTTCCACCAAGTCTTGATGG + Intronic
979271520 4:118767885-118767907 CCCCTTCCACAAAGCCTCAGTGG - Intronic
979864420 4:125736113-125736135 GCATTTCCACCAAGCTTTTAGGG - Intergenic
979962538 4:127037428-127037450 CCCTTTCCCCCACTCCTTAGAGG - Intergenic
982107311 4:152022261-152022283 AGATTGCCACCAAGCCTTTGGGG + Intergenic
986768954 5:10954431-10954453 TGATTTCCACCAAGGCTTCGTGG + Intergenic
989212317 5:38868184-38868206 CCATTGCCACCAACCATCAGTGG + Intronic
989398763 5:40986610-40986632 CTATTTTCACCAAGCTATAGGGG - Intergenic
992037456 5:72794196-72794218 CCATTAGCAGCAAGACTTAGAGG - Intergenic
997765809 5:136501860-136501882 CCATTTCCACCTTGCCTCACAGG - Intergenic
1000562735 5:162810850-162810872 GCATTTTCACCAAGATTTAGAGG - Intergenic
1002384965 5:178859935-178859957 CCATTTCCTAGAGGCCTTAGCGG + Exonic
1006415822 6:33903356-33903378 CTGGTTCCACCAAGTCTTAGGGG + Intergenic
1007630025 6:43268305-43268327 CCATCTGCACCAAGGGTTAGGGG - Intronic
1009377624 6:62991429-62991451 AAATTTCCACAGAGCCTTAGGGG + Intergenic
1010444545 6:75935564-75935586 CCATGACCACAAAGCCTTGGTGG - Intronic
1014266952 6:119289979-119290001 CCCATTCCAACAACCCTTAGTGG + Intronic
1018467502 6:164063582-164063604 GGATTTCATCCAAGCCTTAGAGG - Intergenic
1021458704 7:20860257-20860279 CCTTTTCCATTAAGCCTTAGTGG + Intergenic
1022052608 7:26692465-26692487 GCATTTCAACCAAGCTTGAGAGG + Intronic
1038308385 8:26425128-26425150 CCATTTCCACCAGCACTTATAGG - Intronic
1038945056 8:32349992-32350014 CCATTTCCTCAAAACCTGAGAGG - Intronic
1041328747 8:56699251-56699273 CCATTTCCTCCCAACCTCAGTGG + Intergenic
1041630792 8:60084304-60084326 CCATTTTCATCAACCCTCAGCGG + Intergenic
1042521436 8:69715676-69715698 AAATTTCCACCTGGCCTTAGTGG - Intronic
1055235111 9:74112687-74112709 CCATTTCTCCCAAGTCTCAGAGG - Intergenic
1057700955 9:97362737-97362759 CCCTGCCCACCAAGCCTCAGTGG + Intronic
1057989365 9:99751426-99751448 GGATTTCCAACAAGCCTTAATGG + Intergenic
1186845176 X:13523756-13523778 CTGTTCCCACCAAGCCCTAGGGG - Intergenic
1190097033 X:47489883-47489905 CCATTTCTACCATACCTTATTGG - Intergenic
1193128794 X:77897909-77897931 CCATTTCCACCAATTCCTATAGG - Intergenic