ID: 1103854893

View in Genome Browser
Species Human (GRCh38)
Location 12:123960189-123960211
Sequence CTTTCTTAAAGGGCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103854893_1103854898 6 Left 1103854893 12:123960189-123960211 CCTGGGCTGGCCCTTTAAGAAAG 0: 1
1: 0
2: 4
3: 13
4: 167
Right 1103854898 12:123960218-123960240 TTCTAGGAGTTGCACATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 111
1103854893_1103854897 -10 Left 1103854893 12:123960189-123960211 CCTGGGCTGGCCCTTTAAGAAAG 0: 1
1: 0
2: 4
3: 13
4: 167
Right 1103854897 12:123960202-123960224 TTTAAGAAAGGCTTCTTTCTAGG 0: 1
1: 0
2: 0
3: 29
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103854893 Original CRISPR CTTTCTTAAAGGGCCAGCCC AGG (reversed) Intronic