ID: 1103854893

View in Genome Browser
Species Human (GRCh38)
Location 12:123960189-123960211
Sequence CTTTCTTAAAGGGCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103854893_1103854898 6 Left 1103854893 12:123960189-123960211 CCTGGGCTGGCCCTTTAAGAAAG 0: 1
1: 0
2: 4
3: 13
4: 167
Right 1103854898 12:123960218-123960240 TTCTAGGAGTTGCACATTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 111
1103854893_1103854897 -10 Left 1103854893 12:123960189-123960211 CCTGGGCTGGCCCTTTAAGAAAG 0: 1
1: 0
2: 4
3: 13
4: 167
Right 1103854897 12:123960202-123960224 TTTAAGAAAGGCTTCTTTCTAGG 0: 1
1: 0
2: 0
3: 29
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103854893 Original CRISPR CTTTCTTAAAGGGCCAGCCC AGG (reversed) Intronic
900741355 1:4332834-4332856 CTTCCCTAAAGACCCAGCCCAGG + Intergenic
901873951 1:12155354-12155376 CCTTTTCCAAGGGCCAGCCCTGG + Intergenic
902364330 1:15961616-15961638 GTTTGTTGAAGGGCGAGCCCTGG - Intronic
905563006 1:38941917-38941939 CATTCATCCAGGGCCAGCCCAGG - Intergenic
908669638 1:66532811-66532833 CTTTCAGAAGGGCCCAGCCCTGG - Intergenic
910769239 1:90813984-90814006 CTCTCTAAAAGATCCAGCCCTGG - Intergenic
910968778 1:92833023-92833045 GTTTCTTCAAGGACCAGCACCGG - Intronic
911255989 1:95634245-95634267 CTTTCTTAAAGTTCCAGTCCTGG + Intergenic
912301924 1:108526665-108526687 CTTTCTTAAAAGCCCTGGCCTGG - Intergenic
912651577 1:111444171-111444193 CATTACTAGAGGGCCAGCCCAGG + Intronic
913324457 1:117614524-117614546 AGGACTTAAAGGGCCAGCCCAGG - Intronic
915287085 1:154860033-154860055 CTTCCACAAAGGGCAAGCCCTGG + Intronic
919468274 1:197948423-197948445 CTTTTTTAAAGGGCCAGGATAGG + Intergenic
920684711 1:208100737-208100759 CTTTCTGACAGAGGCAGCCCTGG - Intronic
921112172 1:212049221-212049243 CTTTCTTAAAAGTCCAAGCCAGG - Intronic
924114172 1:240729327-240729349 TATTTTTAAAGGGTCAGCCCTGG + Intergenic
924152245 1:241141247-241141269 CTTCCTAAGAGGGCCAGCCCAGG + Intronic
1065206466 10:23362043-23362065 CTTTCAGAATGGGCCAGCCTTGG + Intergenic
1066512842 10:36120785-36120807 CTTTCTTAAAGCAAAAGCCCGGG - Intergenic
1068049604 10:51932635-51932657 CTCTTTAAAAGGCCCAGCCCTGG + Intronic
1068688064 10:59889547-59889569 ATTTCTTCCTGGGCCAGCCCTGG + Intronic
1073741105 10:106408212-106408234 CTGTCCTCAAGGGCCAGCTCAGG - Intergenic
1075613330 10:123871106-123871128 CCTTCTTAAATGTCCAGCTCAGG + Intronic
1078150555 11:8756140-8756162 TTTTCTCCAAGGGCCTGCCCTGG - Intronic
1078486459 11:11727448-11727470 CATTCTTAAATGGCCAGCAAAGG - Intergenic
1078817027 11:14835666-14835688 CTTATTAAAAGGGCCAGGCCTGG + Intronic
1079008508 11:16809725-16809747 TTTTCTAAAAGGGCCACCTCAGG - Intronic
1080616630 11:33950104-33950126 TCTTCTTAAAGAGCCAGTCCTGG - Intergenic
1085902025 11:80711885-80711907 CTTCCTTGAAGGGACAACCCTGG + Intergenic
1089100209 11:115956749-115956771 CTTCCGGAAGGGGCCAGCCCGGG + Intergenic
1089651719 11:119918860-119918882 CTTTCTGGAAGGGGTAGCCCTGG - Intergenic
1096725599 12:53559353-53559375 CAGTCTTAAAGGGCCAGGCATGG - Intronic
1096763512 12:53863330-53863352 CTTTCTTAATTGGCCTTCCCTGG + Intergenic
1097199506 12:57266384-57266406 CTTTTTTAAAAGGCCAGGCATGG - Intronic
1098136052 12:67403349-67403371 CTTTCTTAAAGGGGATGCCTTGG - Intergenic
1099109377 12:78538368-78538390 CTTTCTTAACATGCCAGCCAAGG + Intergenic
1101184918 12:102265883-102265905 CTTTCTTTAAGAGCTAGCTCTGG + Intergenic
1101665328 12:106807516-106807538 CTGTCTTCAAGAGCCAGACCTGG + Intronic
1103367750 12:120395409-120395431 CCTTATAAAAGGGCCAGCCATGG - Intergenic
1103545053 12:121694771-121694793 ATTTTTTAAAAGGCCAGGCCTGG + Intergenic
1103854893 12:123960189-123960211 CTTTCTTAAAGGGCCAGCCCAGG - Intronic
1105766603 13:23566341-23566363 TTTTCTTAAAGGGCCAGTTCAGG - Intergenic
1106269262 13:28138394-28138416 TTTTCTTAAAGGGGCCGCGCGGG - Intergenic
1107731548 13:43354267-43354289 CTTTATTAAAGGCACAGCCATGG + Intronic
1107766731 13:43743463-43743485 TTTTCTAATAGGTCCAGCCCAGG + Intronic
1108583779 13:51849910-51849932 GTTTCTGAAAGAGACAGCCCAGG - Intergenic
1112559064 13:100495358-100495380 CTCTCTGAAATGGCCAGCACTGG + Intronic
1114449154 14:22813429-22813451 CTTCCTTAAAGGGCAATGCCAGG - Exonic
1117627141 14:57651582-57651604 CATGCTCAAAGGGCCAGTCCTGG - Intronic
1118772567 14:68951983-68952005 CTCCCTTAAAGGGCCGGCCCTGG - Intronic
1118904875 14:70016633-70016655 TTGTCCTGAAGGGCCAGCCCAGG - Intronic
1119906981 14:78314534-78314556 TTTTCCTAAAGGGCCATGCCTGG + Intronic
1122671057 14:103372730-103372752 CTGACTCAGAGGGCCAGCCCTGG + Intergenic
1123787240 15:23686362-23686384 CTTTCTTAAAGACCCTGGCCAGG + Exonic
1126259908 15:46677096-46677118 CTGTCTTAAACCCCCAGCCCTGG - Intergenic
1128475849 15:67996288-67996310 CTTTCCCCAAGGGCCAGACCAGG + Intergenic
1129463856 15:75712958-75712980 CCTTCTTAAAGGGCCCGTGCGGG + Intergenic
1133035701 16:3032971-3032993 CGTTCTCTAAGGGACAGCCCAGG - Intronic
1136506761 16:30709398-30709420 CTTTCCTAAGAGGCCAGCCCAGG + Intronic
1141518062 16:84559573-84559595 CTGTCCTCCAGGGCCAGCCCTGG + Intergenic
1142455631 16:90219862-90219884 CTTTTTTAAAAGGCCAGGCATGG + Intergenic
1143094943 17:4473814-4473836 CTGTCATCAAGGGTCAGCCCAGG + Intronic
1143848270 17:9789855-9789877 CCTTCTTCAAGGGCAAGCCAGGG - Intronic
1147184664 17:38706546-38706568 ATTTCTTAAAGGGCCAGTGAGGG - Intronic
1150667415 17:67154832-67154854 TTTTCTTAAAAGGCAAGCACTGG + Intronic
1151730915 17:75910550-75910572 CTTTCCAAATGTGCCAGCCCGGG - Exonic
1157076634 18:44474141-44474163 GTTTCTTATAGGGCCAAGCCTGG - Intergenic
1157508843 18:48253094-48253116 CATCCTTAAAGGGCCAGCTCAGG - Intronic
1160216113 18:76933166-76933188 TTTTTTTAAAGAGCCAGCCGAGG + Intronic
1160862415 19:1243125-1243147 CTTTCATCACCGGCCAGCCCAGG - Intronic
1165296032 19:34926744-34926766 GCTTCTTAGAGGGCCAACCCAGG - Intergenic
1167046070 19:47049403-47049425 CTGTCTTAAAGAGACAGACCTGG - Intergenic
1167751557 19:51383575-51383597 CTTTCCTGAGGGGCCATCCCTGG - Intronic
1168277826 19:55286889-55286911 CATTGTTAAACAGCCAGCCCAGG + Intronic
926312730 2:11686292-11686314 CTTTCTCAAAGGGACAGCCCAGG - Intronic
926401608 2:12502851-12502873 CTGACTTCCAGGGCCAGCCCTGG - Intergenic
929695141 2:44108065-44108087 CTTTCTTAAAGGGCTACGCTAGG + Intergenic
930718219 2:54613283-54613305 CTTTATTAAAGGGGCAGAACAGG - Intronic
932750550 2:74368961-74368983 CTTGCTTCTAGGGCAAGCCCAGG + Intronic
934736078 2:96690528-96690550 CCTTCTTAAAGTGCCAGCCTTGG - Intergenic
937162017 2:119772827-119772849 ATTTCTTTAAGGGCCAGGCACGG - Intronic
942565689 2:177263876-177263898 CTCTCTTGAAAGCCCAGCCCCGG - Intronic
943361173 2:186921375-186921397 TGTTCTTAAAGGTCCAGCTCAGG + Intergenic
944549561 2:200832813-200832835 CTTTTTTATAGGACCAGTCCTGG - Intergenic
946998758 2:225428134-225428156 CTTTCTTACTAGGTCAGCCCAGG - Intronic
947128581 2:226897668-226897690 CTTTCTTTAAGAACCAGCTCTGG + Intronic
947937641 2:234021746-234021768 CAGTTATAAAGGGCCAGCCCTGG - Intergenic
948249394 2:236513435-236513457 CTTCCTTGAAGGGCCAGAGCAGG + Intergenic
949087128 2:242164659-242164681 CTTTTTTAAAAGGCCAGGCATGG + Intergenic
1169454437 20:5739632-5739654 CTTTCTTAAAGCCCAAGCCATGG - Intergenic
1169923725 20:10761374-10761396 CTCCCTTGAAGTGCCAGCCCTGG + Intergenic
1170539129 20:17370710-17370732 CTTCCTTAAAGGGACTGCCCTGG + Intronic
1171333046 20:24358159-24358181 GTTTCTTCAAGGGCCATTCCAGG - Intergenic
1173120517 20:40285005-40285027 CTATCTTAAATAGCCAGTCCTGG + Intergenic
1174402565 20:50283799-50283821 CCTGCTGAAAGGGTCAGCCCAGG + Intergenic
1175741955 20:61425712-61425734 CATTCTCAAAGGCCCCGCCCAGG + Intronic
1175741979 20:61425800-61425822 CATTCTCAAAGGCCCCGCCCAGG + Intronic
1175741990 20:61425844-61425866 CATTCTCAAAGGCCCCGCCCAGG + Intronic
1175855372 20:62118223-62118245 GATTCTGATAGGGCCAGCCCTGG - Intergenic
1176238673 20:64065914-64065936 CTCTCATGAAGGGCCAACCCGGG - Intronic
1176277150 20:64278909-64278931 CCTCCTTAAAGGGCCAGCCTGGG + Intronic
1177083149 21:16667595-16667617 CATTGTTAAAGGGCCAGCCCTGG + Intergenic
1178780470 21:35598482-35598504 CTTTCTGAATGAGACAGCCCTGG + Intronic
1181563200 22:23717471-23717493 CTTCCCTAAAGGCCTAGCCCAGG - Intergenic
1181973273 22:26709908-26709930 GTTTTTTAAAGGGCCCACCCAGG - Intergenic
1182288241 22:29260375-29260397 GCTTCTTGACGGGCCAGCCCAGG - Exonic
1183701083 22:39451389-39451411 CATCCTTAAAGACCCAGCCCAGG - Intergenic
953861617 3:46549001-46549023 AGTTCCTAAAAGGCCAGCCCAGG + Intronic
953972046 3:47355552-47355574 CTCTCTAAAAGGGACACCCCCGG + Intergenic
958720874 3:97841776-97841798 ATTTCATAACGGGTCAGCCCTGG + Intronic
960270795 3:115672241-115672263 CTTTCCAAAAGGGACAGCCCTGG - Intronic
961248850 3:125482077-125482099 CTTTCTTCAAGGTTCAGTCCTGG + Intronic
963256477 3:143149765-143149787 CTTTCTCAGAAGGCCATCCCTGG - Intergenic
965181842 3:165414162-165414184 TTTTTTTTAGGGGCCAGCCCTGG - Intergenic
966629960 3:182061480-182061502 CTTTCTTAAAGGAACTGACCAGG + Intergenic
968463626 4:738539-738561 GTTTCTTAAAGTGTCAGCACTGG - Intronic
968500834 4:949143-949165 CGTTCTGAAAGGGGCAGCCAAGG - Intronic
969941370 4:10735256-10735278 CTTTCCTACTGAGCCAGCCCAGG - Intergenic
970474858 4:16411981-16412003 GTTTATTAACAGGCCAGCCCAGG - Intergenic
972799405 4:42458553-42458575 CTTTCTTACAGGAGCTGCCCAGG - Intronic
975918982 4:79360318-79360340 CTTACTTAAAGTGCCAGTCTGGG - Intergenic
986054881 5:4126987-4127009 CTTAGTTAAAAGGGCAGCCCAGG + Intergenic
987077582 5:14398388-14398410 CTTTCTTCAAGGACCTGTCCTGG - Intronic
987976672 5:25023759-25023781 CTTTCTTAAAGGGACACCTGTGG - Intergenic
992376634 5:76194179-76194201 CTTTCATATAGCTCCAGCCCAGG - Intronic
992420294 5:76597145-76597167 CTTCCTTATAGGACCAGCTCTGG - Intronic
992950256 5:81851294-81851316 CTTTCTTAGAGGGCCAGAGGTGG + Intergenic
994423362 5:99551380-99551402 CTTTCTTAAAGGGCTGGCGATGG + Intergenic
994706459 5:103212514-103212536 CTTCCATTAAAGGCCAGCCCAGG - Intronic
996868415 5:128156844-128156866 CTTTTTTAAAGGACACGCCCTGG + Intronic
998157597 5:139795574-139795596 CTTTCTTAAAGGGCCCGCGCGGG + Intergenic
999175107 5:149626660-149626682 GTTTCTTAAATAGCCAGCCAGGG - Intronic
999683498 5:154081767-154081789 CTTTCTTCAGAGGCCTGCCCTGG + Intronic
1000533407 5:162452100-162452122 CTTTCTTACAAAGCCATCCCAGG + Intergenic
1001985904 5:176074331-176074353 CATCCTTATTGGGCCAGCCCAGG + Intronic
1002230965 5:177763793-177763815 CATCCTTATTGGGCCAGCCCAGG - Intronic
1002264373 5:178019955-178019977 CATCCTTATTGGGCCAGCCCAGG + Intronic
1002301149 5:178257772-178257794 CTTTCTGCAAATGCCAGCCCTGG - Intronic
1003002600 6:2350037-2350059 CTGTCTCAAAAGCCCAGCCCAGG - Intergenic
1003631241 6:7789748-7789770 CATTTTTAAAAGGCCAGCCAGGG - Intronic
1004022190 6:11786117-11786139 ATTTCTTCAGAGGCCAGCCCTGG - Intronic
1006902683 6:37513211-37513233 CTTCCTCAAGGGGCCAGCACTGG - Intergenic
1007605283 6:43113590-43113612 CTTCCAGAAAGGGCCAGGCCCGG - Intronic
1011157706 6:84351674-84351696 TTTTTTTAAATGGCCAGTCCTGG - Intergenic
1016438235 6:144059318-144059340 ATGGCTTAAAGGGCCAGGCCTGG - Intronic
1016784223 6:147992278-147992300 CATTCTTAAAGGACCAGCCTAGG + Intergenic
1017151322 6:151283029-151283051 CTTTCATAAAGGCTCAGTCCTGG - Intronic
1018537329 6:164835324-164835346 TTTGCTTACAGGGCCACCCCAGG + Intergenic
1020176017 7:5882705-5882727 ATTTCTTCAATGGCCAGCCTTGG + Intronic
1029082809 7:97988314-97988336 ATTTCTTCAATGGCCAGCCTTGG - Intronic
1030902939 7:115147572-115147594 GTTAGTTAGAGGGCCAGCCCTGG - Intergenic
1031020770 7:116625428-116625450 CTTCTTTAAAGGGTCAGCCAAGG - Intergenic
1032990926 7:137394458-137394480 CTTTCTTATAGGCTGAGCCCTGG + Intronic
1035497598 8:66681-66703 CTTTTTTAAAAGGCCAGGCATGG - Intergenic
1037746230 8:21647062-21647084 CTGTTTTAATGAGCCAGCCCAGG - Intergenic
1039071089 8:33649968-33649990 CTTTCTTAATGTACTAGCCCAGG + Intergenic
1039461531 8:37749615-37749637 CTTACTTGAATGACCAGCCCAGG - Exonic
1039983649 8:42429698-42429720 CTTTCAGGAAAGGCCAGCCCAGG + Intronic
1043597926 8:81905511-81905533 GTTCCTTAAAGGGCCAGCTGAGG - Intergenic
1044137005 8:88598768-88598790 CTTTCCTTAAGGGCTTGCCCTGG - Intergenic
1044628826 8:94260117-94260139 CTTTCTTCCTGGGCCACCCCTGG + Intronic
1045694686 8:104795113-104795135 ATTTCTTCAGGGGCCAGGCCTGG + Intronic
1047976210 8:130133292-130133314 CTTTTTTAAAATGCTAGCCCTGG - Intronic
1048383139 8:133885972-133885994 CTTACTTAAAGGTGCAGCCCTGG - Intergenic
1049553910 8:143272993-143273015 CCCTCTTAAAGTGACAGCCCGGG + Intronic
1051176344 9:14364680-14364702 CTTCCTTAAAGGGCTGGCTCAGG - Intronic
1053369868 9:37551636-37551658 CCAGCTTAAAGGGCCAGGCCCGG - Intronic
1055572936 9:77634665-77634687 CTTTCTTCAAGGCCCAGCCCAGG + Intronic
1055938145 9:81622550-81622572 CAGTCTTAAAGGTCCAGCCACGG - Intronic
1057545475 9:96017293-96017315 CTTGGCTAAAGGGCCACCCCAGG + Intergenic
1058611821 9:106785908-106785930 TTTTCTTAAAGAGCTAGTCCAGG - Intergenic
1060915166 9:127384607-127384629 CGCTCTTCAAGGCCCAGCCCTGG - Intronic
1061368994 9:130187398-130187420 CGCTCTTAAAGGGCCAGAGCCGG + Intronic
1061479348 9:130889080-130889102 TTTTCTTAAAAGGCCAGGCAAGG + Intergenic
1062574198 9:137198990-137199012 CTTTCTTGAGGAGCCAGCCTTGG + Exonic
1185867100 X:3633793-3633815 CTGTCTTCCAAGGCCAGCCCCGG - Intronic
1187632158 X:21185375-21185397 AATTCTTAAAGGGCAAGCCTTGG - Intergenic
1187767138 X:22654761-22654783 GTTTCTTAAAGTGCAAGCCAAGG - Intergenic
1189184275 X:39038956-39038978 CTTGCTTAAGGGGCAATCCCAGG - Intergenic
1189503382 X:41585453-41585475 CTATCATAAAGGGCCAGGCACGG + Intronic
1192545228 X:72007408-72007430 CTTTATTAAAAGGGCATCCCCGG - Intergenic
1193338134 X:80314242-80314264 TGTTCTTAAAGGGCCACACCCGG + Intergenic
1195038743 X:100994214-100994236 CTTTCTCAGTGGGGCAGCCCAGG + Intergenic
1196274833 X:113754963-113754985 CTCCCTTAAATGGCCAGCCCAGG + Intergenic
1196501504 X:116388463-116388485 ATTTCTTAAGAGACCAGCCCTGG - Intergenic