ID: 1103855340

View in Genome Browser
Species Human (GRCh38)
Location 12:123965026-123965048
Sequence GACCCAGCAGCTCATCCGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103855340_1103855344 -6 Left 1103855340 12:123965026-123965048 CCCCACGGATGAGCTGCTGGGTC 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1103855344 12:123965043-123965065 TGGGTCTTTTTTTGAATACTGGG 0: 1
1: 0
2: 2
3: 14
4: 248
1103855340_1103855343 -7 Left 1103855340 12:123965026-123965048 CCCCACGGATGAGCTGCTGGGTC 0: 1
1: 0
2: 1
3: 13
4: 129
Right 1103855343 12:123965042-123965064 CTGGGTCTTTTTTTGAATACTGG 0: 1
1: 0
2: 1
3: 22
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103855340 Original CRISPR GACCCAGCAGCTCATCCGTG GGG (reversed) Intronic
900196774 1:1380676-1380698 GACACAGCAGCTGCTCTGTGTGG + Intergenic
900524904 1:3123809-3123831 GACCCCGCAGCTCATCCACTCGG - Intronic
901022647 1:6262872-6262894 GGCTCAGCCACTCATCCGTGTGG - Intergenic
901532673 1:9863472-9863494 ACCCCAGCAGATCATCCGTGTGG + Intronic
905772868 1:40649670-40649692 GACAAAGGAGCTCATCGGTGAGG + Intronic
906882397 1:49606239-49606261 GACCCAGCAGCTCTCGCCTGTGG - Intronic
910431348 1:87162345-87162367 GACCCAGACCCTCATCCTTGAGG - Intronic
913533173 1:119747625-119747647 GACCCAGCTTCTCATTCCTGTGG + Intergenic
915400359 1:155617418-155617440 GACCCAGAAGATCATCCCTGTGG - Intergenic
915648626 1:157291690-157291712 TACCCAGCATGTCATCCCTGAGG - Intergenic
918094117 1:181320711-181320733 GTCCCAGCTGCTCAGCCGGGGGG + Intergenic
920535564 1:206734420-206734442 GAGCCAGCACCTCATTGGTGAGG + Intergenic
922786806 1:228286942-228286964 GGCCCAGCTGCTCATCACTGGGG + Exonic
924078791 1:240370530-240370552 GACCCAGCAGCTCAACATTTCGG - Intronic
924519025 1:244789672-244789694 CACCCTGCAGCTCACGCGTGAGG - Intergenic
924525214 1:244840366-244840388 GCCCCAGCATCCCATCCTTGGGG + Intronic
1065637221 10:27744447-27744469 GAGCCAGCAGCTCACCTCTGGGG + Intronic
1067182441 10:43998846-43998868 GAGCCAGCTGCTCAACAGTGAGG - Intergenic
1073106815 10:101036903-101036925 GGCCCAGCAGCTCATGTCTGGGG - Intronic
1076659389 10:132045215-132045237 GAGCCACCTGCTCACCCGTGAGG - Intergenic
1076871875 10:133198513-133198535 GACCCAGCAGCTCCGGGGTGTGG - Intronic
1077445005 11:2586773-2586795 CACCCAGGAGCCCATCAGTGTGG + Intronic
1080693302 11:34578256-34578278 TAGCCAGCAGCTCATGAGTGTGG + Intergenic
1081867637 11:46368248-46368270 GATACAGCAGCTAATCAGTGAGG - Intronic
1083698377 11:64457629-64457651 GACCCAGACTCTCATCCCTGAGG - Intergenic
1084563180 11:69915427-69915449 GAGCCAGCATCCCGTCCGTGGGG - Intergenic
1086197426 11:84157568-84157590 GACATAGCAGCTCATGCTTGAGG - Intronic
1091894359 12:4089132-4089154 GACTCAGCAGCTCATTCCAGAGG - Intergenic
1094832690 12:34307676-34307698 TTCCCAGCAGCCCCTCCGTGGGG + Intergenic
1096614942 12:52826926-52826948 GGCCCAGCAGTGCCTCCGTGGGG - Intronic
1103855340 12:123965026-123965048 GACCCAGCAGCTCATCCGTGGGG - Intronic
1104322622 12:127765951-127765973 GGCCCCGAAGCTCATCCGTAGGG + Intergenic
1104429440 12:128704960-128704982 GACCCAGTAGCTCATGCATCTGG - Intronic
1104448976 12:128853978-128854000 GACCCCGCTGCGCATCCCTGCGG - Intronic
1107978610 13:45713760-45713782 CACCCTGCAGCTCCTCCGGGAGG + Exonic
1113740684 13:112710598-112710620 AACCCAGCAGCTCAGCCCTGCGG - Intronic
1118602212 14:67478737-67478759 GACCCAGCTCCTCCTCTGTGAGG + Intronic
1119322681 14:73740960-73740982 CACCCAGCAGCTCTTCCCAGGGG - Intronic
1121641745 14:95489245-95489267 TCCCCAGCAGCACATCCATGGGG + Intergenic
1122231686 14:100309199-100309221 AACCCAGCAGCACACCCGTGTGG - Intergenic
1122717790 14:103705896-103705918 CTCACAGCAGCTCTTCCGTGCGG + Intronic
1131092203 15:89631590-89631612 GAGCCAGCAGCAGATCCGCGGGG - Exonic
1131894329 15:97009107-97009129 GTCCCAGCAGCTCACTCCTGAGG - Intergenic
1132533809 16:467415-467437 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533823 16:467459-467481 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533852 16:467547-467569 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533867 16:467591-467613 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533882 16:467635-467657 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533934 16:467789-467811 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132533949 16:467833-467855 GCCCCAGCACCTCCTCCCTGAGG - Intronic
1132533956 16:467855-467877 GTCCCAGCACCTCCTCCCTGAGG - Intronic
1132658147 16:1049813-1049835 CACCCTGCAGCCCATGCGTGTGG + Intergenic
1136417360 16:30112305-30112327 GAACGAAGAGCTCATCCGTGAGG - Exonic
1139651199 16:68363138-68363160 TACCCAGCAGCTCTTTCATGGGG + Intronic
1141143050 16:81509753-81509775 GCCCCAGCTGCACATCCTTGGGG + Intronic
1141366677 16:83450023-83450045 GGCCCAGCTGCTCATCACTGGGG + Intronic
1141831083 16:86510334-86510356 GATCCAGCAGCTCCTCGGGGAGG + Intergenic
1142105379 16:88299685-88299707 CTCCCAGCAGCTCATCCAGGTGG - Intergenic
1146686725 17:34846059-34846081 GTCCCAGCAGGTCATCCCTGTGG + Intergenic
1148070248 17:44904516-44904538 GAACCAGCACCTCAGGCGTGTGG - Exonic
1148830124 17:50425897-50425919 GAGCCAGCAGCACATCCGTGAGG - Intergenic
1149003648 17:51782367-51782389 GACAAACCAGCTCATCAGTGAGG + Intronic
1149097358 17:52859455-52859477 AACTCAGCAGCTCATCAGTAAGG + Intergenic
1149890379 17:60384304-60384326 GCCCCAGCATCTTATCCCTGTGG - Intronic
1150203325 17:63379408-63379430 GACGCAGCAGCTCATGCCTTTGG + Intronic
1151641146 17:75395064-75395086 AACCCAGCAGCTCATTTGAGGGG + Intronic
1151791312 17:76307638-76307660 GAGCAAGCAGCTCAAGCGTGTGG - Exonic
1152532559 17:80927871-80927893 CACCCTCCAGCTCCTCCGTGCGG - Intronic
1152897820 17:82923436-82923458 GACACAGCAGGTCACCCTTGAGG - Intronic
1157712335 18:49858526-49858548 GCCCCAGCAGCCCCTCCCTGGGG - Intronic
1159962162 18:74563820-74563842 GACCCAGCTGCTAATGCATGCGG + Intronic
1160683277 19:422316-422338 GACGCAGCTGTTCCTCCGTGGGG + Exonic
1160898305 19:1413218-1413240 GAGCCAGCAGCTCCTCCTTTTGG + Intronic
1163375101 19:16925229-16925251 AACCCAGCAGCTCAGCCCTGAGG - Exonic
1165326309 19:35116352-35116374 GCCCCAGCTGCTCACCTGTGTGG - Exonic
924981156 2:222769-222791 CACCCAGCAGCCCCTCCGTGGGG + Intronic
925553270 2:5099353-5099375 AACCCAGCAGTTCCACCGTGAGG - Intergenic
926296627 2:11573647-11573669 GACCCAGCTGCTCTTCTGTGAGG - Intronic
929543592 2:42841376-42841398 CACACAGCAGCTCCTCCATGTGG + Intergenic
932139704 2:69264465-69264487 GACCCAGATCCTCATCCCTGTGG - Intergenic
932323626 2:70839620-70839642 TACACAGCAGCTCTTCCATGTGG - Intergenic
933354644 2:81196581-81196603 GAACCAGCAGCTTATCTCTGGGG + Intergenic
937122629 2:119451495-119451517 CACCCAGCATCTCTTCCCTGGGG + Intronic
937316507 2:120935180-120935202 CACCCAGCATCTCATCCCAGGGG - Intronic
946396160 2:219444735-219444757 ACCCCAGGAGCTCACCCGTGGGG - Exonic
947974656 2:234355297-234355319 GAGCCTGCAGCTCATCCAGGTGG - Intergenic
948804323 2:240446955-240446977 GCCCGAGCATCTCATCCATGGGG + Intronic
948980849 2:241494028-241494050 GGGCCAGCAGCTCAGCCGGGAGG + Exonic
1171228730 20:23464839-23464861 GACCAAGCAGGTCAGCAGTGGGG + Intergenic
1175322575 20:58099786-58099808 TACCAAGCAGTTCATCGGTGTGG - Intergenic
1178264480 21:31130231-31130253 GAACCTGCAGCGCTTCCGTGGGG + Exonic
1178421674 21:32448222-32448244 CACCCAGCAGCCCATCCTCGTGG + Intronic
1179815981 21:43906673-43906695 GACCCAGCAGCTCTGCTCTGAGG + Intronic
1179970562 21:44834945-44834967 GACCCAGCAGGTCCTCGGTGGGG + Intergenic
1180141792 21:45897697-45897719 GCCCCAGCAGCTCCTGTGTGTGG + Intronic
1181044567 22:20208423-20208445 GACCTAGCAGCTAATCTCTGCGG + Intergenic
1182807675 22:33088987-33089009 TTCCCAGAAGCTCATCCATGGGG - Intergenic
1183714097 22:39523642-39523664 GTCCCCGCAGCACACCCGTGAGG + Intergenic
1184259701 22:43307587-43307609 GACCCAGCAGCCCAGCCAGGGGG + Intronic
1184718001 22:46292836-46292858 GACCGAGCGGCTCATCCGCAAGG + Exonic
1184861826 22:47176710-47176732 GAGCCACCAGCCCACCCGTGGGG - Intergenic
955067068 3:55542987-55543009 GACCTAGCAGATCATCCCAGTGG - Intronic
955760716 3:62278926-62278948 TACCCAGCAGCTCATTTGTATGG + Intronic
957049604 3:75401292-75401314 CACCCAGCAGCACATCCTCGTGG - Intergenic
957585598 3:82127913-82127935 GACCTAGCCCCTCATCCCTGAGG - Intergenic
959267100 3:104156489-104156511 GACCCAGCCCCACATCCCTGAGG + Intergenic
961881921 3:130067730-130067752 CACCCAGCAGCCCATCCTCGTGG - Intergenic
962240201 3:133745818-133745840 GAGGGAGCAGCTCCTCCGTGGGG + Intergenic
964901362 3:161662880-161662902 GAACCAGCAACTCCTCCATGTGG - Intergenic
968066457 3:195762084-195762106 CACCCAGGAGCCCCTCCGTGCGG + Exonic
968503950 4:963446-963468 GACCACGCAGCTCATGTGTGAGG - Intronic
968958996 4:3733379-3733401 GCCCCAGCAGCTGACCCCTGAGG + Intergenic
969821976 4:9727674-9727696 CACCCAGCAGCCCATCCTCGTGG + Intergenic
973759803 4:54105342-54105364 GACCCAGTAGCCCATCCTTAGGG + Intronic
975831364 4:78372647-78372669 GACCCAGCAGTTCATTTATGAGG - Intronic
983269805 4:165547946-165547968 GACCCTGCAGCTGACCAGTGGGG - Intergenic
984636199 4:182112266-182112288 AACACGGCAGCTCATCTGTGGGG - Intergenic
985573651 5:663814-663836 GGCCCAGCAGGTCACACGTGTGG + Exonic
985801844 5:2009566-2009588 GCACCACCAGCCCATCCGTGAGG - Intergenic
993898923 5:93571297-93571319 GACCCGGGACCTCATCCCTGAGG + Intergenic
996524497 5:124463675-124463697 GACACAGCAGCTCCTCAGTGAGG + Intergenic
996760165 5:126978828-126978850 GCCCCAGAAGCCCATCCATGAGG - Intronic
999161528 5:149504271-149504293 ATCCCAGCAGCTCATCTGTTAGG - Intronic
1001579451 5:172789058-172789080 GGCTCAGCAGCTCAGCCCTGTGG - Intergenic
1004162591 6:13228131-13228153 GACCCAGCAGCCCAGCAGTCTGG + Intronic
1012525217 6:100169393-100169415 GACACAGCAGCTTATCCTTCAGG + Intergenic
1013289582 6:108708738-108708760 GACCCAGCCCGTCATCCTTGAGG + Intergenic
1014074769 6:117223479-117223501 GACCCAGAACCTCATCCTTGAGG + Intergenic
1015978048 6:138811319-138811341 GGCCCTGCAGCTCATTCATGTGG - Intronic
1016042779 6:139449144-139449166 GACCCAGCAGCTCTACTTTGAGG - Intergenic
1018058289 6:160070907-160070929 GCCCCAGCAGCTCATGAGTCTGG - Intronic
1019039740 6:169093978-169094000 GAGCCAGCAGCCCCTCCCTGGGG - Intergenic
1021695636 7:23273231-23273253 GACCCAGCAGCGCCACCGTGTGG - Intronic
1029603377 7:101583193-101583215 GACCCAGGCCCTCATCCCTGAGG - Intergenic
1031918406 7:127584288-127584310 GACCAAGCAGCTGACCCGTGAGG - Exonic
1045737747 8:105317778-105317800 GACTCAGCACCTCATCCACGTGG + Intronic
1047126369 8:121965548-121965570 AACACAGCAGCTCATCTGCGTGG + Intergenic
1047141197 8:122141592-122141614 GACACAGATGCTCATCCCTGAGG + Intergenic
1051028990 9:12651270-12651292 GACTCAGCAGCTCTCCAGTGTGG - Intergenic
1053432488 9:38052237-38052259 TACCAAGCAGCCCATCCATGAGG - Intronic
1053452107 9:38202132-38202154 CACCCGGCATCTCATCAGTGAGG - Intergenic
1062389587 9:136328569-136328591 GTCCCAGCAGCTGATCCCGGGGG + Intronic
1191716955 X:64200316-64200338 GACCCAGCTGCTCCTCTGTAGGG - Intronic
1197767214 X:130067029-130067051 GAACCAGCAGCCCCTCCATGGGG + Exonic