ID: 1103855480

View in Genome Browser
Species Human (GRCh38)
Location 12:123966509-123966531
Sequence GCTGAACTGCAGAGTGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103855480_1103855483 10 Left 1103855480 12:123966509-123966531 CCAGGTTCACTCTGCAGTTCAGC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1103855483 12:123966542-123966564 TCACTTCAACCTTCCTTCAAGGG 0: 1
1: 0
2: 1
3: 26
4: 203
1103855480_1103855482 9 Left 1103855480 12:123966509-123966531 CCAGGTTCACTCTGCAGTTCAGC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1103855482 12:123966541-123966563 ATCACTTCAACCTTCCTTCAAGG 0: 1
1: 0
2: 0
3: 18
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103855480 Original CRISPR GCTGAACTGCAGAGTGAACC TGG (reversed) Intronic
900334464 1:2154836-2154858 GCTGAACTGCAGCATGAATTGGG + Intronic
902577372 1:17386767-17386789 GCAGAACTGCAGAGTCCATCGGG + Intronic
904066371 1:27755011-27755033 GCTGAACTGCAGAGGTAAGGTGG - Intronic
909820933 1:80059935-80059957 GGAGAAGTGCAGAGTGAAGCAGG + Intergenic
912056751 1:105609698-105609720 TCTGAACTGCAGATTGATTCTGG - Intergenic
912300574 1:108511961-108511983 GCTGAACAACAGAGGGAGCCAGG + Intergenic
912729310 1:112087972-112087994 GCTGAACTGCAAAGAGAAGTGGG - Intergenic
915535110 1:156530749-156530771 GCTGGAGTGAAGACTGAACCAGG - Intronic
916586643 1:166155084-166155106 CCTGAGCAGCTGAGTGAACCAGG + Intronic
916700780 1:167292387-167292409 GGTGTCCTGCAGAGTAAACCTGG - Intronic
918048468 1:180955018-180955040 GGTGAGCTGCAGAGGGACCCAGG - Intergenic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
918623038 1:186626714-186626736 GCTGAACCACAGAGTCAAGCTGG - Intergenic
920353724 1:205355030-205355052 GCTGAGCTTCAGATTGAACTGGG - Intronic
920414205 1:205787626-205787648 GCCGTCCTGCAGAGGGAACCAGG - Intergenic
922691595 1:227696491-227696513 GCTGACCTCCAGAGTGACCGGGG - Intergenic
923782034 1:237033242-237033264 CCTGGAGTGCAGAGTGAACAAGG - Intergenic
1064715225 10:18170038-18170060 GGTGCACTGCAGTATGAACCAGG - Intronic
1066201551 10:33146607-33146629 GCTGAACTGCAGGTGAAACCAGG - Intergenic
1069886192 10:71625245-71625267 CCTGCACTGCAGAGTGAACGGGG + Intronic
1070916582 10:80158914-80158936 GTTCAACTGCACAGGGAACCGGG + Intronic
1073011014 10:100359588-100359610 GATGATCTGCAGTGTGAACTGGG - Intronic
1073241001 10:102058063-102058085 GCGGAACAGGAAAGTGAACCAGG - Intergenic
1073267540 10:102236958-102236980 GCTGAACTGCAGTGTGCAAATGG + Intronic
1074113121 10:110436724-110436746 GCTAACATGGAGAGTGAACCTGG + Intergenic
1074702319 10:116103316-116103338 GCTGAACATTAGAATGAACCAGG - Intronic
1075126764 10:119706678-119706700 GGAGAAGTGCAGAGTGAAGCAGG - Intergenic
1083681313 11:64353091-64353113 GGTGAGCTGCAGGGTGAACGCGG + Exonic
1086126717 11:83356239-83356261 GCAGAACTGCAGGATGCACCAGG + Intergenic
1089634915 11:119805852-119805874 GCTGAAGATCAGAGTGAGCCAGG - Intergenic
1090289114 11:125526461-125526483 GCAGAACTGCACTGTGAACAAGG - Intergenic
1091205670 11:133819153-133819175 GGAGAACTGCACAGTGAACCTGG + Intergenic
1092509059 12:9134567-9134589 GCTAAACTGAAGAGGGAACGGGG - Intergenic
1092798576 12:12139670-12139692 GCTGCAGTGCAGTGTGAACTTGG - Intronic
1094437597 12:30438202-30438224 GCTGAAAAGCAGAGTAAAACTGG - Intergenic
1095858391 12:46887206-46887228 GCTGAAGTGCAGAGGGCACAAGG + Intergenic
1097539837 12:60927036-60927058 CCCAAACTGCAGAGTCAACCAGG + Intergenic
1097735553 12:63177411-63177433 GGAGAAATGCAGAGTGAAACAGG - Intergenic
1100777706 12:97990641-97990663 GCTGAAATGCAGTTTGAAGCAGG - Intergenic
1103741688 12:123095668-123095690 GCTGAGCTGCAGGGAGGACCAGG - Intronic
1103855480 12:123966509-123966531 GCTGAACTGCAGAGTGAACCTGG - Intronic
1105832792 13:24179492-24179514 GCTGAACTGTACACTGAAACTGG - Intronic
1110322046 13:74171546-74171568 GCTGAGCTGCAGGGAGAACCGGG - Intergenic
1112080920 13:95969279-95969301 GGTGAAGTCCAGAGTAAACCAGG - Intronic
1114063881 14:19043715-19043737 GTTGAGCTGCTGAATGAACCAGG + Intergenic
1114098377 14:19356281-19356303 GTTGAGCTGCTGAATGAACCAGG - Intergenic
1114270323 14:21097174-21097196 GGTGAGCTGCAGAGTGGAGCGGG - Intronic
1119778079 14:77260465-77260487 GCTGAACCACAGAGTGTCCCAGG - Intergenic
1122834010 14:104422195-104422217 GCAGAACAGCAGAGTGCCCCTGG - Intergenic
1123051711 14:105547229-105547251 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1123077125 14:105672932-105672954 GATGACCTGCAGAGGGAAGCCGG + Intergenic
1125927827 15:43577679-43577701 GCTGAACTGGAGAAAGAACCAGG - Exonic
1125940970 15:43677244-43677266 GCTGAACTGGAGAAAGAACCAGG - Intergenic
1126725989 15:51632963-51632985 GCTGTGCTGCAGAGAGAAGCAGG + Intergenic
1127053157 15:55105856-55105878 GGAGAAGTGCAGAGTGAAGCGGG + Intergenic
1127279620 15:57477874-57477896 GCTGAACTGGAGAGAAAACGTGG + Intronic
1129108011 15:73322527-73322549 GCTGGACCCCAGAGGGAACCTGG - Exonic
1130214409 15:81954631-81954653 GCTGAACTGCAAAGTCATCTAGG + Intergenic
1133395294 16:5442304-5442326 GCGGAGCTGCAGAGGGAGCCAGG + Intergenic
1134273192 16:12753232-12753254 GCTGTCCTGCAGTGTGATCCTGG + Intronic
1135322979 16:21509133-21509155 GCTGAAATGCTGTGTGAACTCGG + Intergenic
1136334462 16:29602318-29602340 GCTGAAATGCTGTGTGAACTCGG + Intergenic
1139330957 16:66189520-66189542 GCTGAACAGCGGAGGGAACATGG + Intergenic
1139970466 16:70771030-70771052 CCTGAACTTGACAGTGAACCTGG - Intronic
1140256838 16:73344952-73344974 GGGGAGCTGCAGAGAGAACCTGG + Intergenic
1140269027 16:73446393-73446415 GGAGAAGTGCAGAGTGAAGCTGG + Intergenic
1141151156 16:81565472-81565494 GCTGAGCTGCAGTCTGCACCAGG - Intronic
1141468565 16:84222943-84222965 GCAGAACTCCAGGGAGAACCAGG + Exonic
1141960471 16:87403913-87403935 GCTGTACTCCAGAGTGACACTGG - Exonic
1143902418 17:10184188-10184210 TCTGGACTGCAGTATGAACCAGG - Intronic
1144656337 17:17039571-17039593 GCTGATCTGGAGAATGAATCAGG - Intergenic
1144810104 17:17993603-17993625 GCTGAGCTCCAGAGGGAACCAGG + Intronic
1146155220 17:30518232-30518254 TCTGAAGTGAAGAGAGAACCAGG - Intronic
1149298463 17:55282992-55283014 GCTGAACACCAGAGAGAATCTGG - Intronic
1149641567 17:58206218-58206240 TCTGCACTGCAGAGAGAAACAGG + Intronic
1150092248 17:62337818-62337840 GCTGGACTGCAGAGCGATCTCGG + Intergenic
1150323498 17:64236487-64236509 GCTGGAGTGCAGTGTCAACCTGG - Intronic
1151813480 17:76459056-76459078 ACTGTACTGCAGAGTGACCTTGG - Intronic
1152782516 17:82232507-82232529 GCCGTCCTGCAGAGTCAACCTGG - Intronic
1153362770 18:4216177-4216199 GGAGAAGTGCAGAGTGAAGCTGG + Intronic
1155635637 18:27952135-27952157 ACTGAACTTCAGGGTGAACTTGG - Exonic
1156328156 18:36093334-36093356 GTGGAAGTGAAGAGTGAACCAGG + Intergenic
1157100004 18:44720792-44720814 GCTGGACTGCAGAGTTGACCTGG + Intronic
1157753499 18:50198080-50198102 GTTGAACTTCAGTGTGTACCAGG + Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1158448644 18:57543414-57543436 GCAGAAACACAGAGTGAACCAGG + Intergenic
1159567779 18:70073628-70073650 GCAGAACTGGAGTTTGAACCAGG - Intronic
1161655015 19:5508882-5508904 GCTGAAACTCAGATTGAACCCGG - Intergenic
1162963398 19:14142512-14142534 GCTGAAGTCCAGAGGAAACCAGG - Intergenic
1164669336 19:30063776-30063798 GCTGAACTCCGGAGGGACCCCGG - Intergenic
1167135973 19:47615766-47615788 GCTTAATTGCAGTGTGACCCTGG + Intronic
925707578 2:6701689-6701711 TCTGACCTGCAAACTGAACCAGG + Intergenic
925882072 2:8361225-8361247 GCAGAGCTGGAGAGTGAAGCAGG - Intergenic
926756489 2:16240525-16240547 GCAGCACTGCAGAGGGACCCTGG + Intergenic
927673291 2:25087106-25087128 GGAGAAGTGCAGAGTGAAGCAGG + Intronic
928246324 2:29631719-29631741 ACTGAACTTCACAGTTAACCTGG + Intronic
929404377 2:41624974-41624996 GCTACACTCCAGAGTCAACCTGG + Intergenic
930091798 2:47536137-47536159 GCTGAGCTGGAGAGTGATCTGGG - Intronic
931707443 2:64958821-64958843 GTTGAAATGAAGAGAGAACCAGG + Intergenic
935051991 2:99531878-99531900 AATGAACAGCAAAGTGAACCAGG + Intergenic
937037581 2:118794568-118794590 ACTGAACTCCCGAGGGAACCAGG + Intergenic
938481148 2:131662694-131662716 GTTGAGCTGCTGAATGAACCAGG + Intergenic
938965342 2:136383194-136383216 GGAGAACTGAAGAGTGAAGCAGG - Intergenic
941977601 2:171423095-171423117 GGAGAAGTGCAGAGTGAAGCAGG - Intronic
943936296 2:193920367-193920389 GGAGAAGTGCAGAGTGAAGCGGG - Intergenic
944975137 2:205041485-205041507 GCAGAAATGGAGAGAGAACCTGG - Intronic
948334585 2:237197504-237197526 GCTGAACCACAGCGTGAAGCAGG + Intergenic
948608009 2:239148146-239148168 GCAGAACTGCAGAGAGAAGGAGG + Intronic
1169305918 20:4490334-4490356 CCTTTTCTGCAGAGTGAACCTGG - Intergenic
1169368199 20:5008461-5008483 CCGGAGCTGCAGAGTGAACTGGG - Intronic
1169601478 20:7265808-7265830 GCTTGACTGCAGGGTAAACCTGG + Intergenic
1172665200 20:36594266-36594288 GCATGACTGCAGTGTGAACCCGG + Intronic
1172756679 20:37290000-37290022 CCTGAGCTCCAGAGTGAATCTGG + Intronic
1173539384 20:43840114-43840136 GCTGAACTGCTGTGTGACCATGG + Intergenic
1174356223 20:49999669-49999691 GGTGACCTGCAAAGTGAAGCTGG - Intergenic
1175621075 20:60448098-60448120 GCTGGACTGAAGAGTGACCCAGG + Intergenic
1177769825 21:25502096-25502118 GGAGAAGTGCAGAGTGAAGCTGG + Intergenic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179154850 21:38840790-38840812 GCTGAACTGCAGGGAGCCCCAGG + Intergenic
1180482373 22:15766348-15766370 GTTGAGCTGCTGAATGAACCAGG + Intergenic
1181432719 22:22892959-22892981 GAAGAACTGCAGACTGAACTGGG + Intronic
1183005787 22:34900522-34900544 GCAGAACTGCAAGTTGAACCTGG - Intergenic
1183187923 22:36303017-36303039 GCTGAAGTCCAGAGTCACCCAGG - Intronic
1183858915 22:40654919-40654941 TCTGAACTGCAGTGTGAAGATGG - Intergenic
1184337135 22:43860545-43860567 GCTTACCAGCAGAGTGACCCTGG - Intronic
1184355893 22:43979400-43979422 ACTGACCTGCACAGTGCACCCGG + Intronic
954945953 3:54424604-54424626 GCTGAGCTGCAGATGGAGCCAGG + Intronic
955373573 3:58374482-58374504 GCACAACTGCAGAGTGAAAATGG - Intronic
956855676 3:73272581-73272603 GCTGAAGTGCAGTGTGATCTTGG + Intergenic
957034376 3:75280347-75280369 GCAGAACTGCATTGTGAACAAGG - Intergenic
958637797 3:96766826-96766848 TCTTAACTGCAGAGTGAATGAGG + Intergenic
961214350 3:125148092-125148114 GCTGAGCTGGAGCTTGAACCTGG + Intronic
966638797 3:182165559-182165581 CCAGAACTGCAGAGAGAACCTGG + Intergenic
970349329 4:15185546-15185568 GATGAACCCCAGGGTGAACCTGG + Intergenic
970647724 4:18142007-18142029 TATGAACTGCAGTTTGAACCTGG - Intergenic
973199443 4:47483911-47483933 GCTACACATCAGAGTGAACCGGG - Intergenic
974832757 4:67210025-67210047 GGAGAAGTGCAGAGTGAAGCGGG - Intergenic
978388992 4:108204797-108204819 TCTGAACTGAAGCGTGAACAAGG - Intergenic
978461135 4:108953572-108953594 GCTGAATAGAAGAGTGAAGCTGG + Intronic
979869532 4:125801617-125801639 GCTGAACTTCACAGAGATCCTGG + Intergenic
981636605 4:146888229-146888251 GTAGAACTACAGAGAGAACCTGG + Intronic
982151861 4:152467287-152467309 GGAGAAGTGCAGAGTGAATCGGG - Intronic
983298160 4:165892083-165892105 GGAGAAGTGCAGAGTGAAGCAGG + Intronic
983329960 4:166313284-166313306 GCTTAACTGCATAATGTACCAGG - Intergenic
986359199 5:6959625-6959647 GCTGAGCTGCAGAGTGTCCTAGG + Intergenic
986443311 5:7799705-7799727 GCTGAACAGCAGAATAACCCAGG + Intronic
987982178 5:25100246-25100268 GGAGAACTGCAGACTGAAGCGGG + Intergenic
993741121 5:91541008-91541030 CCTGAAATCCAGAGTCAACCAGG - Intergenic
996012077 5:118492298-118492320 GCTTAACTGCAGAGTAGAGCAGG - Intergenic
1002847399 6:959921-959943 GCTGAACTAGAGAGTCAAACTGG - Intergenic
1003759174 6:9155879-9155901 GCAGCAATGCAGAGGGAACCTGG + Intergenic
1013417181 6:109935515-109935537 GGAGAAGTGCAGAGTGAAGCAGG + Intergenic
1015274177 6:131367326-131367348 CCTGAACTGCCGACTGAACCTGG - Intergenic
1015429062 6:133108894-133108916 TCTGAACTGCAGAGTGTTGCTGG - Intergenic
1015914902 6:138205919-138205941 GCAGAGCTGCAGAGTGGACAGGG + Intronic
1018975851 6:168565083-168565105 CCTGAAATTCAGATTGAACCTGG + Intronic
1019307145 7:341121-341143 CCTGCCCTGCAGTGTGAACCGGG - Intergenic
1019540715 7:1549928-1549950 GCAGAACTGCAGAGTGGCCTGGG + Exonic
1019550255 7:1598826-1598848 GCAGAAGTGCAGCGTGAAGCAGG + Intergenic
1019768594 7:2869518-2869540 GGTGAAGTGCTGAGTGAAGCGGG + Intergenic
1023628143 7:42136993-42137015 GCTGAACTGAGGTTTGAACCCGG - Intronic
1028892093 7:95999739-95999761 ACTGCACTGCTGAGTGACCCTGG + Intronic
1029649652 7:101882617-101882639 GCTCACTTGCTGAGTGAACCAGG - Intronic
1030063612 7:105642330-105642352 ACTCAACTGCAGAATTAACCTGG + Intronic
1032715651 7:134506969-134506991 GGTGGACTGCAGAGGGAAGCTGG + Intergenic
1033420585 7:141201339-141201361 TCTCAACCGCAGACTGAACCTGG + Intronic
1035531581 8:356416-356438 GCTGATCTGCAGATGGACCCAGG - Intergenic
1035725924 8:1824611-1824633 GGTGGAGTGCAGAGTGAACAGGG - Intronic
1036699376 8:11001888-11001910 GCTGAACAGCAGAGGGACCAGGG - Intronic
1037195652 8:16186258-16186280 TCTCAACAGCAGAGTGAGCCAGG + Intronic
1038686347 8:29722067-29722089 GCTGAGCTGGAAAGTGAGCCTGG - Intergenic
1041791388 8:61699892-61699914 GTTGAACAGCAGAGGGAACTGGG + Intronic
1042420207 8:68579616-68579638 GCTGATCTGCAGAGCGCACTTGG - Intronic
1043035213 8:75188923-75188945 GCTGAACTTCACTGTGAACCAGG + Intergenic
1043571323 8:81606137-81606159 TTTGAAGTGAAGAGTGAACCTGG - Intergenic
1046782044 8:118225909-118225931 GCTGCTCTGGAGACTGAACCAGG - Intronic
1048442076 8:134467401-134467423 GATGACCTGCAGAGGGAAACAGG - Intergenic
1048999733 8:139817123-139817145 GCTGACCTGCACAGAGCACCAGG - Intronic
1049244419 8:141554261-141554283 GCAGGTCTGCAGAGAGAACCAGG + Intergenic
1049420124 8:142512783-142512805 GCTGACCTCCAGAGTGGGCCTGG + Intronic
1051175633 9:14356697-14356719 GCTGAGCTGGAGAGTAAAACTGG + Intronic
1052242458 9:26291086-26291108 GCTTAACTGCAGACTTAAGCTGG + Intergenic
1056985999 9:91364211-91364233 GCTGTGCTGCAGAGGCAACCAGG - Intergenic
1057481440 9:95448201-95448223 GCTGAGCTGCAGTGTGAATCTGG - Intronic
1059535050 9:115072902-115072924 GCTAAACTGAAGAGACAACCAGG - Intronic
1060590524 9:124813487-124813509 GCTGAGCTGCTGTGTGAGCCTGG - Exonic
1061247591 9:129408849-129408871 GCACAAATGCAGAGTGAACCTGG - Intergenic
1061375595 9:130222617-130222639 GCAGCACTGCTGAGTGATCCTGG - Intronic
1062504943 9:136868612-136868634 CCTGAACTGCAGTGTTAACAAGG - Intronic
1185445163 X:254025-254047 GCACACCTGCAGAGGGAACCTGG - Intergenic
1185882161 X:3751097-3751119 GGAGAAGTGCAGAGTGAAGCGGG + Intergenic
1186627342 X:11308692-11308714 ACTGAAGTTCAGAGTGAATCAGG - Intronic
1195385488 X:104310037-104310059 CCTGATCCTCAGAGTGAACCTGG - Intergenic
1195797470 X:108666573-108666595 GCTGGACAGAAGGGTGAACCAGG + Exonic
1197128120 X:122971929-122971951 GCAGAAGTGCAGAGTGAAGTGGG - Intergenic
1200782809 Y:7232114-7232136 GGAGAAGTGCAGAGTGAAGCGGG - Intergenic