ID: 1103857434

View in Genome Browser
Species Human (GRCh38)
Location 12:123982670-123982692
Sequence AGATTCATTTAGTGTGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103857431_1103857434 22 Left 1103857431 12:123982625-123982647 CCACGCTCACCGTATCGGTTTTA 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1103857434 12:123982670-123982692 AGATTCATTTAGTGTGAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 119
1103857432_1103857434 13 Left 1103857432 12:123982634-123982656 CCGTATCGGTTTTACTGTTGCAG 0: 1
1: 0
2: 0
3: 8
4: 68
Right 1103857434 12:123982670-123982692 AGATTCATTTAGTGTGAGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103857434 Original CRISPR AGATTCATTTAGTGTGAGCC TGG Intronic
903214365 1:21835282-21835304 AGATTGAATCAGTGTGAACCGGG - Intronic
903447856 1:23433683-23433705 TGCTTCATTTACTGTGAGCGGGG + Exonic
907705123 1:56826240-56826262 AGACTCATTTGGTGTGAGGTGGG - Intergenic
908681985 1:66672373-66672395 AGATTCCTTTGGTGTGTGGCAGG - Intronic
913694852 1:121314935-121314957 TGAATCATTTATTTTGAGCCAGG + Intronic
914142709 1:144965123-144965145 TGAATCATTTATTTTGAGCCAGG - Intronic
918309449 1:183275344-183275366 AGAATCATTGAGTCTGAGACAGG - Intronic
920482181 1:206333318-206333340 TGAATCATTTATTTTGAGCCAGG + Intronic
920712945 1:208312405-208312427 AGGTTGATTAAGTATGAGCCTGG + Intergenic
921301515 1:213755527-213755549 AGAGTCATGCAGTGTGGGCCAGG + Intergenic
923776952 1:236987279-236987301 AGAATCAATTAGTGTTTGCCAGG - Intergenic
924854759 1:247865132-247865154 AGAATCATATAGTTTGAGTCTGG + Intronic
1064156149 10:12904842-12904864 AGAAGCATTTATTGTGTGCCTGG + Intronic
1065812508 10:29455284-29455306 TGATGCATTTAGTGAGAGCGGGG + Intergenic
1065959130 10:30719942-30719964 TGATGCATTTAGTGAGAGCGGGG - Intergenic
1067240543 10:44488325-44488347 TGAATCATTTATTTTGAGCCAGG + Intergenic
1074030183 10:109679522-109679544 TTAAACATTTAGTGTGAGCCAGG + Intergenic
1078346674 11:10555869-10555891 GGATTTATTCTGTGTGAGCCAGG + Intergenic
1078727312 11:13943143-13943165 AGAATCATTTAGTTTGAGCAGGG - Intergenic
1079112332 11:17611972-17611994 CGATGCACTTAGTGTGAGCTCGG - Intronic
1081210053 11:40322050-40322072 AGATTCATTAAATGTGGGGCTGG + Intronic
1084506454 11:69571371-69571393 TGATTCATTGAGTCTGAGCAGGG + Intergenic
1084890192 11:72232968-72232990 CGATTCAGTGAGTGTGGGCCTGG + Exonic
1085713975 11:78855470-78855492 AGAATCATTTATTCTGAGCCAGG + Intronic
1088741694 11:112772842-112772864 GGATACTTTTAGTGAGAGCCAGG + Intergenic
1091427700 12:405768-405790 ATATACACTTAGTATGAGCCAGG + Intronic
1093506117 12:19868693-19868715 AGATTTATTTAGAATCAGCCTGG + Intergenic
1097158264 12:57028242-57028264 TGATTCATTAAGTGTGTCCCTGG - Intronic
1099615243 12:84926381-84926403 TGATTTATTTATTGTGAGCATGG - Intergenic
1101342976 12:103859494-103859516 AAACTCTTTTAGTGTGTGCCAGG + Intergenic
1103079351 12:118011034-118011056 AGGTGCTTTTAGTGTCAGCCTGG + Intergenic
1103857434 12:123982670-123982692 AGATTCATTTAGTGTGAGCCTGG + Intronic
1112287556 13:98117579-98117601 AGAAACATTTAGTCTGGGCCAGG - Intergenic
1114272656 14:21112196-21112218 AGTTACATTTAGTGTAACCCAGG + Intergenic
1117981337 14:61344863-61344885 AGATTTATTTATTTTTAGCCCGG + Intronic
1118783037 14:69022809-69022831 AGAGTCATTCAGGGTGGGCCGGG - Intergenic
1128085102 15:64880725-64880747 AGACTCATTGAATGTGACCCAGG + Intronic
1128248507 15:66149098-66149120 AGGATCATTGAGTGGGAGCCAGG - Intronic
1132251077 15:100335703-100335725 GAAATCATTTAGTGAGAGCCTGG - Intronic
1137845501 16:51684097-51684119 AGATCCATTTAGTGAGTGTCTGG - Intergenic
1139217095 16:65136796-65136818 AGATTCATTTTGCTTGACCCAGG + Intergenic
1139712834 16:68789719-68789741 GGATTCAGTTAGTCTGAGGCAGG + Intronic
1141929667 16:87193673-87193695 AGATGCATTTAGGCTGGGCCTGG - Intronic
1144052343 17:11507879-11507901 AATTCCATTTAGTGTGAGACTGG + Intronic
1148815801 17:50327149-50327171 AGAATCGTTTGGTGAGAGCCTGG + Intergenic
1149437813 17:56648725-56648747 AAATACATTTCTTGTGAGCCAGG - Intergenic
1150890330 17:69141276-69141298 AGTTTCAAGTAGTTTGAGCCTGG - Intronic
1154442739 18:14407183-14407205 TGATTCATTGAGTTTGAGCTGGG + Intergenic
1155425167 18:25699442-25699464 AGAAACTTTTAGTGGGAGCCCGG + Intergenic
1157630895 18:49093948-49093970 AAAATCATTTAGTGTGAAACTGG + Intronic
1160123717 18:76152003-76152025 AGCTTGATTTAGTGTGAGGGAGG - Intergenic
1160900952 19:1428295-1428317 AGATTCTTTAAGCGTTAGCCTGG + Intronic
1166695994 19:44851663-44851685 AGCTTCATGAAGTGTGAGCTGGG - Intronic
1166789080 19:45386971-45386993 AGATTCATTTATTCTGGGCTGGG + Intronic
1168314764 19:55479944-55479966 AGAGACATGTAGTGTGAGCCAGG + Intronic
925598981 2:5588820-5588842 AGGTTAATTTAGTCTGAGTCTGG - Intergenic
929803839 2:45127558-45127580 AGTTTAATCTAGTGTCAGCCTGG + Intergenic
934528973 2:95073404-95073426 AGGTTCATTTATGGTCAGCCAGG + Intergenic
937276392 2:120686822-120686844 AAATTCCTATAGGGTGAGCCTGG - Intergenic
938914400 2:135920941-135920963 AGTTTCACTTAGTTTGAGTCAGG - Intronic
939101475 2:137899355-137899377 TGATTCATTGAGTTTGAGCTGGG - Intergenic
940272161 2:151903215-151903237 ATATTCATTTACTTTGAGGCCGG + Intronic
941500983 2:166275841-166275863 AGTATCATTTAGTGTGTGACTGG + Intronic
942643952 2:178090936-178090958 AGATGCATTAAGAGTAAGCCTGG + Intronic
946777334 2:223157133-223157155 TGATTCATTGAGTCTGAGGCTGG - Intronic
1175027147 20:55914326-55914348 GGATTCATGTAGAGGGAGCCAGG - Intergenic
1176453346 21:6884010-6884032 TGATTCATTGAGTTTGAGCTGGG - Intergenic
1176831521 21:13749058-13749080 TGATTCATTGAGTTTGAGCTGGG - Intergenic
1182101131 22:27658421-27658443 AGATTGATTCACTGTGACCCAGG + Intergenic
1183250972 22:36730178-36730200 AGAGTCATTTGTTGAGAGCCAGG - Intergenic
949318542 3:2783828-2783850 ACATTCATTAAGTGTCAACCTGG - Intronic
955955222 3:64281786-64281808 AGAGCCATTTACTGTGAACCAGG - Intronic
956201000 3:66705865-66705887 TGATTCATTAAGTCTGAGGCAGG + Intergenic
965759058 3:172055605-172055627 AGCTTCATTTAGTGTGATTTTGG + Intronic
967404817 3:189103654-189103676 AAATTCTTTTGGTGTGAGCTTGG - Intronic
968768930 4:2491137-2491159 TGGTTCATTCAGTGTGAGCATGG + Intronic
971763158 4:30795533-30795555 AGATGCATTTACTGTATGCCAGG - Intronic
973019679 4:45187237-45187259 AGATTCATTTAGTTTGATGTAGG + Intergenic
975937526 4:79599922-79599944 AGATTCATCTGCTGAGAGCCAGG - Intergenic
977797055 4:101178971-101178993 AGAATCATTGAGAGTTAGCCAGG - Intronic
979226339 4:118289818-118289840 AGATTCTTTTAATGTGAGTAGGG - Intronic
979660589 4:123249814-123249836 AGATTTAAGTAGTGTTAGCCAGG + Intronic
979866412 4:125760490-125760512 AGAATCATTTGGGGTCAGCCTGG - Intergenic
981448928 4:144873161-144873183 AGTTCCATTTGGTGTGAGACTGG - Intergenic
982248529 4:153380503-153380525 AGATCCTTTCAGTGTGAGCAAGG - Intronic
982865145 4:160500816-160500838 GGATTCATTTAGTTTGTACCAGG - Intergenic
987049602 5:14138307-14138329 AGATTCATTCATTCTGATCCTGG - Intergenic
987381094 5:17286841-17286863 AGATTCATTTGGCCTGGGCCAGG - Intergenic
988677335 5:33445921-33445943 AGTTCCTTTCAGTGTGAGCCTGG - Intronic
990804665 5:59645496-59645518 AGATTCATTTAGTTTCAGTTTGG + Intronic
998124866 5:139610845-139610867 AGATTTATTTATTTTGAGACAGG - Intronic
1002488541 5:179557131-179557153 AGACTTATCAAGTGTGAGCCAGG + Intronic
1002803287 6:547360-547382 AGACTCCTCTGGTGTGAGCCAGG - Intronic
1002982703 6:2157415-2157437 TGATTCATTTTAAGTGAGCCAGG + Intronic
1004354911 6:14922475-14922497 ATATTTATTGAGTCTGAGCCGGG + Intergenic
1006559537 6:34898112-34898134 AGAATCATCTAATGGGAGCCAGG + Intronic
1008088538 6:47269480-47269502 AGATTCCTTAAGGGTGAACCTGG + Intronic
1009178049 6:60484786-60484808 AGAATCATTGAGTGCTAGCCTGG + Intergenic
1010980431 6:82364388-82364410 GGGTTTATTTAGTGTGGGCCAGG + Intronic
1021883292 7:25114267-25114289 AGATTCATTTAGGCTGAGCATGG - Intergenic
1022202412 7:28129428-28129450 TGATTCATTTGGTGTGAACTGGG + Intronic
1023110710 7:36808072-36808094 AGATTCATTTGGTGGGGGTCTGG + Intergenic
1024189760 7:46994093-46994115 ATATTCATTTACTGTCTGCCAGG - Intergenic
1034250990 7:149690686-149690708 AGAATCATCTAGTGTGTGCTGGG + Intergenic
1035857256 8:2988990-2989012 GGACTCATTGAGTGTGACCCTGG - Intronic
1037716516 8:21405663-21405685 TGATTTAATTAGTGTGAGGCTGG - Intergenic
1041816206 8:61974490-61974512 AGTTTCATTTACTCTGAGTCCGG + Intergenic
1043673280 8:82915547-82915569 AGATTCAGTTAGTGTCAGGTAGG + Intergenic
1046127420 8:109927763-109927785 AAATTCATTTTTTGGGAGCCAGG - Intergenic
1048574997 8:135683287-135683309 AGATTGATTTGGTCTGAGCGGGG + Intergenic
1051552917 9:18350225-18350247 AGACTCATGCAGTGGGAGCCAGG + Intergenic
1051866166 9:21685291-21685313 AGATAAATTTAGTGTCAGCCTGG + Intergenic
1055026511 9:71728073-71728095 AGATTCATTTAGCCTGAGTATGG + Intronic
1055211786 9:73803807-73803829 ATATTCACTCAGTGTGAGCAAGG + Intergenic
1055765238 9:79655960-79655982 ATAATCATTCAGGGTGAGCCTGG + Intronic
1056425335 9:86469861-86469883 AGAATCTTGTGGTGTGAGCCAGG + Intergenic
1057523564 9:95780036-95780058 AGATGCACTTAGTGTGAATCAGG + Intergenic
1059634754 9:116159885-116159907 AGTTTAATTTTGTGTGACCCTGG - Intronic
1060989548 9:127840539-127840561 AGAGTGATTTGGTGTAAGCCAGG + Intronic
1203515834 Un_GL000213v1:505-527 TGATTCATTGAGTTTGAGCTGGG + Intergenic
1187654294 X:21452385-21452407 AAATTCATTTAGAGTGGGCCAGG - Intronic
1189110078 X:38280381-38280403 ACATCCTTTTATTGTGAGCCAGG + Intronic
1193459493 X:81773774-81773796 ATATCCATTTTGTGTGAGTCTGG + Intergenic
1196928641 X:120659348-120659370 AGAATAATTTATTTTGAGCCAGG + Intergenic
1198603801 X:138314294-138314316 AGATTCATTTAGGGTTATCAGGG - Intergenic
1199580502 X:149355487-149355509 AGATTCAGTTAGTGCCAGCTAGG + Intergenic