ID: 1103860180

View in Genome Browser
Species Human (GRCh38)
Location 12:124006162-124006184
Sequence CCACAAAGTGGACTATGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103860180_1103860185 24 Left 1103860180 12:124006162-124006184 CCAGTTCATAGTCCACTTTGTGG 0: 1
1: 0
2: 0
3: 7
4: 95
Right 1103860185 12:124006209-124006231 TCTACCTCCATGTAAATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103860180 Original CRISPR CCACAAAGTGGACTATGAAC TGG (reversed) Intronic
900407428 1:2498740-2498762 CCACAAAGGGGTCGATGATCTGG - Exonic
901367447 1:8765140-8765162 CCACACAATGGACTATGATTTGG + Intronic
906938227 1:50233290-50233312 CAACAAAGTGGTCTGTGAACTGG + Intergenic
911896638 1:103444203-103444225 CCACAAAGTGCAATATGGAAAGG + Intergenic
918298911 1:183184727-183184749 ACAGAACGTGGAGTATGAACTGG - Intergenic
918713751 1:187764257-187764279 CTAAAAAGTGGACTATAAATGGG - Intergenic
924845428 1:247764377-247764399 CCACAACCTGGACTTTGAAAGGG - Intergenic
1063397117 10:5699119-5699141 CCACAAAGTGGAATATTATTTGG + Intronic
1064521490 10:16207577-16207599 TCAAAAAGTGGGCTAAGAACAGG - Intergenic
1066651610 10:37661336-37661358 CCACCATGTGGACTCTGCACAGG + Intergenic
1071097160 10:81989902-81989924 CCAGAAGGTTGACTATGAAGAGG + Intronic
1074932176 10:118139538-118139560 CCACATAGTTGACAAGGAACTGG + Intergenic
1084472507 11:69371318-69371340 CCACAAAATGGAATAAGAACGGG - Intergenic
1085929218 11:81060508-81060530 CCAGAAACTGGAGTTTGAACAGG + Intergenic
1087487204 11:98771154-98771176 TGACAAAGTGGAGGATGAACTGG + Intergenic
1093834247 12:23807033-23807055 CAACTAAGTGGACTTTTAACTGG - Intronic
1098216085 12:68221444-68221466 ACACAATGTTGCCTATGAACAGG + Intronic
1103860180 12:124006162-124006184 CCACAAAGTGGACTATGAACTGG - Intronic
1107550666 13:41471971-41471993 CCACACAGTGGATTATGATTTGG - Intergenic
1111559734 13:89929876-89929898 CCAAAAATTGGAACATGAACTGG - Intergenic
1115474971 14:33804832-33804854 CCAAAAACTGGAATATGAATGGG + Intergenic
1116658353 14:47676878-47676900 CAACAAAGTGGACTGCGTACAGG - Intergenic
1117755253 14:58968166-58968188 TCACAAAGCGGAGTATGAAAGGG + Intergenic
1117884296 14:60343530-60343552 CAGCAAAGTGGACTGTGAACAGG + Intergenic
1123541175 15:21293309-21293331 CCCCAAAGGGGACAATGAATGGG + Intergenic
1125605291 15:40936817-40936839 CCACACATTGGACTATAATCTGG + Exonic
1125957747 15:43802206-43802228 ACTCAAGGTGGCCTATGAACTGG - Intronic
1126194703 15:45918974-45918996 CCACAGTGTGGACAATGCACTGG - Intergenic
1202949488 15_KI270727v1_random:20450-20472 CCCCAAAGGGGACAATGAATGGG + Intergenic
1135094026 16:19547986-19548008 CTACTAAGTAGCCTATGAACAGG - Exonic
1141988021 16:87592663-87592685 CCACACAGTGGAAGATTAACTGG + Intergenic
1144860899 17:18301283-18301305 CCACCAACTGGCCTATGACCCGG + Intronic
1148952522 17:51326093-51326115 TCACAAAGTGAAGTGTGAACAGG - Intergenic
1164933086 19:32190292-32190314 CCACAGAGTGAACTGTGACCAGG + Intergenic
1167356270 19:49006189-49006211 CCGCAAAGAGGACTAAGAACAGG + Intronic
1168366541 19:55792916-55792938 CCACAAAATGGGCTAACAACAGG - Intronic
930363937 2:50415405-50415427 TGACAAAGTGCACTATGAATTGG + Intronic
931578019 2:63740588-63740610 CCACAAAGTATATTATGAATGGG + Intronic
931872956 2:66481326-66481348 CCACAAAGTGGCCTGGGAGCTGG - Intronic
931952091 2:67375890-67375912 CAACAAGATGGACAATGAACGGG + Intergenic
933715466 2:85356474-85356496 CCACACAGGGGACTGTGAGCTGG - Intronic
935900333 2:107784961-107784983 GCACAAAGTAGACGATAAACTGG + Intergenic
938049382 2:128153683-128153705 CCATAAAGTGGACTATAAAAAGG - Intronic
939401010 2:141693965-141693987 AAACAAAGTGGACTAGGAATTGG + Intronic
946696408 2:222364160-222364182 TCACATAGTGTACTATGAAAAGG + Intergenic
947495917 2:230636715-230636737 CCACAAATTTGACTATGCAATGG - Intergenic
1170335930 20:15270049-15270071 CACTAATGTGGACTATGAACTGG + Intronic
1172181821 20:33008267-33008289 CCACACAGTGGACTGGGACCAGG - Intronic
1182281381 22:29219477-29219499 CCACAAAATAGCCTAAGAACAGG + Intronic
949106395 3:205044-205066 CAATAGAGTGGGCTATGAACTGG - Intronic
949403565 3:3690961-3690983 CAAGAAAGTGGACAATGAAAGGG + Intergenic
955984475 3:64558715-64558737 CCACATAGGGGACTATTAAAAGG + Intronic
957155160 3:76536448-76536470 CCACCAAGTGGGCCATGAACTGG + Intronic
958864290 3:99483065-99483087 TCACAAAGAAGATTATGAACAGG + Intergenic
963604412 3:147402210-147402232 CCACAATGTGGTGTCTGAACAGG - Intronic
964288662 3:155150760-155150782 CCATAAAATTGAATATGAACAGG - Intronic
965906754 3:173717744-173717766 CCACAAAGTGGTTTAAGAAGTGG + Intronic
966934737 3:184698577-184698599 TCACATAGTGGACTTTGAAAAGG + Intergenic
968208775 3:196828724-196828746 CCCCAAAGGGGACAATGAATGGG - Exonic
969593557 4:8135300-8135322 CCAGAAAGTGGACATTGCACAGG + Intronic
970003398 4:11387008-11387030 GCACAAAGTGGGTTAGGAACTGG - Intergenic
970342805 4:15124367-15124389 CCACAAAGTTGACTGTGCCCAGG - Intergenic
971098561 4:23435991-23436013 ACACAAAGTGGACTAAGACGTGG + Intergenic
971186398 4:24381337-24381359 CCACAAACTTAACCATGAACTGG + Intergenic
971686718 4:29779013-29779035 CCACAAAGTGGTTTAGGAATTGG - Intergenic
976174983 4:82342771-82342793 GCACAAGGTGGACTATGCATTGG + Intergenic
976400595 4:84602364-84602386 CTGCAAAGTGGACTTTGAAGTGG + Intronic
981227361 4:142312857-142312879 CCACATAGAGGACTCTTAACAGG + Intronic
983926204 4:173405446-173405468 CCACAGAGTGTACTATGGAAAGG - Intronic
987293516 5:16530109-16530131 CCCGAAAGTGGACTATGAGATGG - Intronic
990068449 5:51748249-51748271 TCACAAAGTAGACTTTGAAATGG - Intergenic
991317970 5:65332750-65332772 CAACAGAGGGGACTCTGAACTGG - Intronic
994794077 5:104271135-104271157 CCTCAAAGTGGAATATGATTTGG + Intergenic
995041061 5:107588496-107588518 GCATAAACTGGTCTATGAACAGG - Intronic
999526165 5:152408430-152408452 TCAAAAAGTGGGCTAAGAACAGG - Intronic
1002590006 5:180284142-180284164 CAACAAAATGGACCATCAACTGG + Intronic
1007982963 6:46177996-46178018 CCACACAGTGCATTAGGAACAGG - Intergenic
1008542021 6:52553773-52553795 CCATAAAGAGGACTATGGAGGGG + Intronic
1010261776 6:73825225-73825247 CCAGACAGTGGTCTATGAAGAGG + Exonic
1011875460 6:91955792-91955814 CTACGATGTGGACTATGAATTGG - Intergenic
1012767716 6:103389068-103389090 CCACAAAGATGAATATGAAGAGG - Intergenic
1016693153 6:146962580-146962602 ACACAAAGGGAAGTATGAACTGG + Intergenic
1017695256 6:157008486-157008508 CCCCTAAATGGACTCTGAACCGG - Intronic
1022750684 7:33221286-33221308 GAACAGAGTGGACTATGTACTGG - Intronic
1022931451 7:35120254-35120276 CGACAAAGAGGAAAATGAACTGG - Intergenic
1029827341 7:103212760-103212782 CAACAAAGAGGAAAATGAACTGG - Intergenic
1030764430 7:113391205-113391227 CAACAAAGGTGACTAGGAACAGG + Intergenic
1030830343 7:114211568-114211590 TCACAAAGAGGAATGTGAACGGG - Intronic
1033963890 7:146949806-146949828 CCACATAATGGACCTTGAACAGG - Intronic
1045611069 8:103842790-103842812 CAACAAAGTGTACCATAAACTGG + Intronic
1051640495 9:19220454-19220476 GCACAAAGTAGACTGTGAAAAGG + Intergenic
1055024296 9:71703085-71703107 CCACAATGTGGACTAAGGATTGG + Intronic
1055890902 9:81122641-81122663 CCACAGACTGGAGTAAGAACTGG - Intergenic
1057256498 9:93552883-93552905 CCACAGAGTGGACGATAAATGGG - Intronic
1058694192 9:107545499-107545521 CCAAAAAATGGACTATCATCGGG + Intergenic
1185596296 X:1308876-1308898 CCTCATAGTTGACGATGAACAGG - Intronic
1186791901 X:13007823-13007845 CCAAAATGTGGTCTGTGAACTGG - Intergenic
1190371816 X:49749778-49749800 ACAAAAAGTTGACTATGAAAAGG + Intergenic
1190896913 X:54628678-54628700 CCAAAAAGTGGGCTAAGGACAGG - Intergenic
1198141175 X:133805232-133805254 CCACAAACTGGACTATCTACAGG + Intronic
1198202786 X:134438523-134438545 CCACAAAATGGACTATTATGCGG - Intergenic
1201937089 Y:19420862-19420884 CCACTAAGCGGGCCATGAACTGG - Intergenic
1202080308 Y:21077440-21077462 TCACAAACTGGACGATGGACTGG - Intergenic