ID: 1103860253

View in Genome Browser
Species Human (GRCh38)
Location 12:124006748-124006770
Sequence TCGAGTGCACAGGATGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103860247_1103860253 -10 Left 1103860247 12:124006735-124006757 CCTCCAGTGTGAGTCGAGTGCAC 0: 1
1: 1
2: 0
3: 2
4: 58
Right 1103860253 12:124006748-124006770 TCGAGTGCACAGGATGCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103860253 Original CRISPR TCGAGTGCACAGGATGCTGG GGG Intronic
900765295 1:4500938-4500960 AGGGGTGCTCAGGATGCTGGTGG - Intergenic
902137636 1:14324044-14324066 TAGGGTGCACAGGTTGCTGTGGG - Intergenic
902913668 1:19621773-19621795 AGGAGAGCCCAGGATGCTGGAGG + Intronic
903265412 1:22155073-22155095 TGGAGTGCACAGGCTGGTGGGGG + Intergenic
905004538 1:34699140-34699162 TCTAGAGCACAGGAAGCTGCAGG + Intergenic
905695224 1:39968753-39968775 GGGAGGGGACAGGATGCTGGAGG + Intronic
907775791 1:57513225-57513247 TCTAGGGCAGAGGCTGCTGGGGG - Intronic
918043193 1:180925734-180925756 TCGAGGACACAGGTGGCTGGAGG + Intronic
919473597 1:198008825-198008847 TAGAGTGAAAAGGATGCTCGGGG + Intergenic
1064639262 10:17398803-17398825 TACAGTGCTCAGGATGCTGGTGG - Intronic
1067053920 10:43040538-43040560 GGGAGGGCACAGGATGGTGGTGG + Intergenic
1067513908 10:46920532-46920554 TCCAGAGCAGAGGGTGCTGGGGG + Intronic
1067648346 10:48131300-48131322 TCCAGAGCAGAGGGTGCTGGGGG - Intergenic
1069789843 10:71012482-71012504 TGGAGTGCACAGTGTGGTGGGGG + Intergenic
1069844068 10:71358546-71358568 GGCAGTGTACAGGATGCTGGGGG - Intronic
1071449071 10:85777321-85777343 TTGAGTGGACAGTAGGCTGGAGG - Intronic
1074590674 10:114809991-114810013 TTGAGTGCACAGGAAACTGATGG + Intergenic
1076142407 10:128090349-128090371 TTGAGTGCCCAGGTTTCTGGTGG - Intergenic
1076527962 10:131124260-131124282 TCGGCTGCATAGGATGCTAGTGG - Intronic
1076798795 10:132811304-132811326 TCCAGGGCAGAGGAGGCTGGGGG - Intronic
1077135997 11:999025-999047 TCTGGTGCACAGGCTGCTGTGGG + Intronic
1077319862 11:1936335-1936357 TGGATCGCTCAGGATGCTGGCGG + Intronic
1077724279 11:4658349-4658371 TGGAGTGCACAGTCTCCTGGTGG + Intergenic
1080407749 11:31994828-31994850 TGTAGTGGACAGGATGCTGCAGG - Intronic
1084153803 11:67303222-67303244 TGCAGGGCACAGGACGCTGGAGG + Intergenic
1084615821 11:70235172-70235194 TGGTGTGCCCAGGCTGCTGGTGG - Intergenic
1084960782 11:72715242-72715264 GCCAGTGCACAGGATGCACGGGG + Intronic
1087075937 11:94127456-94127478 TTGGGTGCACAGGTGGCTGGTGG + Intergenic
1091580879 12:1788317-1788339 TCAAGTGCACATGAGGCTGTTGG - Exonic
1101791812 12:107934417-107934439 TGGAGTGCACAGGATGGAGCTGG - Intergenic
1102718583 12:114996534-114996556 TCGACTGCATTGCATGCTGGGGG - Intergenic
1103860253 12:124006748-124006770 TCGAGTGCACAGGATGCTGGGGG + Intronic
1107560095 13:41550700-41550722 GCAAGTGCAGAGGATGCAGGAGG - Intergenic
1108508405 13:51133984-51134006 GAGCGTGCACAGGATGCTGCAGG - Intergenic
1113416521 13:110132663-110132685 GCCAGTGCACAGGAGGCTGCAGG + Intergenic
1115079498 14:29433927-29433949 TGGAGAACACAGGAAGCTGGTGG + Intergenic
1115455195 14:33593916-33593938 AGGTATGCACAGGATGCTGGTGG - Intronic
1115514138 14:34168288-34168310 ACCAGAGCACAGGATGCTGGAGG - Intronic
1119382693 14:74239293-74239315 TCGAATGGCCAGGGTGCTGGGGG - Intergenic
1120443805 14:84567917-84567939 TACAGAGGACAGGATGCTGGGGG - Intergenic
1120829447 14:88985084-88985106 TACAGTGCAAAGGATGCTGTAGG + Intergenic
1121097599 14:91228690-91228712 CTGAGTTCTCAGGATGCTGGAGG - Intergenic
1121693699 14:95895688-95895710 TCTGGTGCATAGGGTGCTGGGGG - Intergenic
1122441305 14:101734111-101734133 GCGAGTGCACAGCATGCTCTGGG + Intergenic
1122557782 14:102591059-102591081 TGGAGTGCCCTGGATGCTGCAGG - Intergenic
1124345694 15:28920054-28920076 TAGACTGCACATGATGCTGCTGG - Intronic
1124373032 15:29114218-29114240 GGGAGGGCACAGGCTGCTGGGGG + Intronic
1125574347 15:40745092-40745114 TCCAGTGCCCTGGAGGCTGGAGG - Exonic
1128601374 15:68998166-68998188 TCTTGTGCTAAGGATGCTGGAGG + Intronic
1129523871 15:76201998-76202020 TGGACTGCACTGGGTGCTGGGGG - Intronic
1130258952 15:82339291-82339313 GCCAGGGCACAGGCTGCTGGGGG - Intergenic
1130269724 15:82439833-82439855 GCCAGGGCACAGGCTGCTGGGGG + Intergenic
1130462065 15:84167131-84167153 GCCAGGGCACAGGCTGCTGGGGG + Intergenic
1130473684 15:84246053-84246075 GCCAGGGCACAGGCTGCTGGGGG + Intergenic
1130481099 15:84360117-84360139 GCCAGGGCACAGGCTGCTGGGGG + Intergenic
1130490612 15:84427642-84427664 GCCAGGGCACAGGCTGCTGGGGG - Intergenic
1130502200 15:84506412-84506434 GCCAGGGCACAGGCTGCTGGGGG - Intergenic
1130595968 15:85250650-85250672 GCCAGGGCACAGGCTGCTGGGGG + Intergenic
1132207714 15:99997917-99997939 GTGAGTGAAGAGGATGCTGGCGG + Intronic
1133365378 16:5204924-5204946 TAAAGTGCACAGGATCCTGCAGG - Intergenic
1133387415 16:5381096-5381118 TGGAGAGGACAGGATGCTGAAGG + Intergenic
1133526787 16:6613326-6613348 TTGAATGCTCAGGATGGTGGGGG + Intronic
1136085444 16:27881737-27881759 TGGAGTGCACAGAATTCAGGAGG - Intronic
1136187654 16:28597518-28597540 TGGAGTGCATGGGCTGCTGGAGG - Intergenic
1136190130 16:28610498-28610520 TGGAGTGCATGGGCTGCTGGGGG - Intronic
1138567578 16:57844779-57844801 TCCAGGGCACAGGCTGCTGTGGG - Intronic
1140148243 16:72333177-72333199 TGGTGGGCACAGGATGTTGGTGG + Intergenic
1141963434 16:87424865-87424887 TCAAGTCCACAAGAAGCTGGGGG + Intronic
1143574513 17:7782979-7783001 TGGAGGTCACAGGATGATGGTGG + Intronic
1144842790 17:18198629-18198651 AAGATTGCACAGGCTGCTGGTGG + Intronic
1146905934 17:36617927-36617949 CCGAGGGCACAGGAAGCCGGTGG - Intergenic
1147314377 17:39612591-39612613 TCAAGTCCAAAGGATGCTGGGGG + Intergenic
1149010282 17:51849452-51849474 TTGAGTGCCTTGGATGCTGGAGG + Intronic
1150437911 17:65168327-65168349 TGGAGAGCACAGGATGGAGGTGG - Intronic
1151411058 17:73930022-73930044 GCCAGTGCAGAGGATGCGGGTGG + Intergenic
1154290529 18:13102395-13102417 TGGAGTGTACTGGGTGCTGGTGG - Intronic
1156339170 18:36195940-36195962 TGGAGTGGAGTGGATGCTGGAGG + Intronic
1160904474 19:1445954-1445976 TCGAATGCGGAGGAGGCTGGGGG - Intergenic
1161402494 19:4073839-4073861 TGGAGTGCAGAGGATACTGACGG - Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1163439764 19:17316188-17316210 ACCAGTGCTCAGGAGGCTGGAGG + Intronic
1163611274 19:18303033-18303055 TCGAGTGGACAAGAAGCTGCTGG - Intergenic
1164507893 19:28874463-28874485 CCCAGTGGACTGGATGCTGGGGG + Intergenic
1167149919 19:47702479-47702501 TCGAGTCCCCAGGAGGCTGAGGG - Exonic
1167473814 19:49689146-49689168 TCGAGTGCACAGTATTGTGGGGG - Exonic
926861794 2:17317597-17317619 CCCAGGGCACAGGATCCTGGTGG + Intergenic
928248354 2:29651947-29651969 TCGAGTGTACAGGATGCTATGGG + Intronic
936236705 2:110748336-110748358 TGGAGTGCCCAGGATGCAGGGGG + Intronic
940332354 2:152489075-152489097 TAGAGTGCAAAGGATGCCTGTGG + Intronic
943218301 2:185068788-185068810 TAGAGTGCACAACATGCTGTGGG - Intergenic
944281249 2:197900511-197900533 TTGAGTGCAGAAGATGCTGTGGG + Intronic
944659581 2:201910257-201910279 TGGAGAGCACAGCATGATGGGGG - Intergenic
945270188 2:207930655-207930677 TCGAGTGCCCAGGACGGTGAAGG - Intronic
1172773476 20:37394626-37394648 TGGGCTGCACTGGATGCTGGAGG + Intronic
1172962384 20:38807667-38807689 CTGAGTCCCCAGGATGCTGGGGG + Intronic
1174122431 20:48276298-48276320 TCGAGGCTAAAGGATGCTGGAGG - Intergenic
1175388877 20:58614032-58614054 CCTAGAGCACTGGATGCTGGGGG + Intergenic
1176158415 20:63635565-63635587 ACGAGTGCACAGCAGGCTGTGGG + Intergenic
1176173105 20:63705131-63705153 TCCAGTGCGCAGCATGCTTGGGG - Intronic
1179612476 21:42561203-42561225 TCCAGTGCACAGACGGCTGGGGG + Intronic
1179793287 21:43768009-43768031 TCGAGAGGCCAAGATGCTGGTGG - Intergenic
1181387698 22:22557863-22557885 TGGAGAGCAGAGGAGGCTGGGGG + Intronic
1185399062 22:50606694-50606716 TCGAGGTCACAGGAGGCAGGAGG - Exonic
950730297 3:14950454-14950476 TCTAGAGCACAGGAAGCTAGGGG - Intronic
953643549 3:44731577-44731599 TAGAGAGCCCAGGATGGTGGTGG + Intronic
954111117 3:48433706-48433728 TCTCGAGCACAGGATGCTGCAGG - Exonic
966837188 3:184058422-184058444 TCCAGTGGACAGCATGCTGCTGG + Exonic
967289037 3:187901560-187901582 TCCAGGGCAGAGGATGTTGGTGG - Intergenic
969136490 4:5033333-5033355 TGGAGTCCACAGGAACCTGGAGG - Intergenic
969170574 4:5359408-5359430 TTGAGTGCACAGGTGGATGGAGG - Intronic
970149291 4:13071993-13072015 TCGAGTGATAAGGAAGCTGGAGG + Intergenic
970158854 4:13169148-13169170 TCTATTGCCCAGGCTGCTGGAGG + Intergenic
976222262 4:82766191-82766213 TGGAGTCCACAGAATGGTGGTGG - Intronic
977808835 4:101335782-101335804 AAGAGAGCACAAGATGCTGGAGG + Intronic
985427916 4:189848020-189848042 GCAAGTCCACAGGGTGCTGGGGG - Intergenic
985982554 5:3483092-3483114 TCGTGTGCCCAGGAGGCTGGTGG + Intergenic
992404752 5:76446609-76446631 TAGAGTGCAAAGGATGGGGGTGG - Intronic
998527992 5:142860047-142860069 CCCAGTGCACAGAATTCTGGTGG - Intronic
999282023 5:150372279-150372301 CAGAGTGCTCAGGCTGCTGGGGG - Intronic
1001777633 5:174340698-174340720 TCAAGGGAACAGGATGTTGGAGG - Intergenic
1002190576 5:177475287-177475309 TTGAGTGTGCAGGAGGCTGGGGG - Intergenic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1002424007 5:179165248-179165270 GCAAGGGCACAGGATGGTGGGGG - Intronic
1004715330 6:18211480-18211502 TTGAGAGCACACAATGCTGGAGG + Intronic
1006085201 6:31590111-31590133 CAGAGAGCACAGGATCCTGGGGG + Exonic
1007079066 6:39085997-39086019 TCCACTGCTCAGGCTGCTGGTGG - Exonic
1011855025 6:91679208-91679230 CGGAGTGTCCAGGATGCTGGTGG + Intergenic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1019333399 7:471343-471365 AGGGGTGCACAGGATCCTGGCGG - Intergenic
1019795419 7:3044467-3044489 TCGAGGGCACAAGCTGATGGTGG - Intergenic
1020258024 7:6513170-6513192 TCGTGTGCTCATGATCCTGGTGG + Intronic
1022834839 7:34103549-34103571 TCAAGTGCATACGATGCTAGGGG - Intronic
1023416382 7:39937029-39937051 GCCCGTGCACAGGCTGCTGGAGG - Intergenic
1023996266 7:45160940-45160962 TCTAGTGCACATGAGGCTTGAGG - Intronic
1031895143 7:127339804-127339826 TCAAGAGCACAGAATTCTGGAGG + Intergenic
1034244133 7:149631784-149631806 TGCAGAGCAGAGGATGCTGGGGG - Intergenic
1034675228 7:152888069-152888091 TCGAGTTCACAGGTGGCTGCAGG - Intergenic
1034872659 7:154697409-154697431 CTGAGTGCACAGGGTGCTGCAGG - Intronic
1038227922 8:25673858-25673880 TCAAGAGCACAGGCTTCTGGAGG + Intergenic
1039450833 8:37673867-37673889 TGGAGTGGACAGCAGGCTGGAGG + Intergenic
1040940372 8:52826645-52826667 TCAGGTGCAGAGGAGGCTGGAGG - Intergenic
1041382113 8:57261147-57261169 TCGTGGGCACAGCATGCAGGTGG - Intergenic
1043399630 8:79871481-79871503 TGGGCTGCACAGGATTCTGGGGG - Intergenic
1048550241 8:135427190-135427212 TGGAGGGCACAGGAGGCTGGAGG + Intergenic
1049738407 8:144222211-144222233 GCCAGTGCCCAGGAGGCTGGGGG + Intronic
1053150424 9:35739611-35739633 TTGAGGGTACAGGATGCTGGTGG - Exonic
1054710280 9:68504238-68504260 AGGAGTGCACAGGAGGCTGGCGG - Intronic
1057173098 9:92975617-92975639 TCCAGTGCACAGGAGGGAGGAGG + Intronic
1057991694 9:99776937-99776959 TAGAGTACACAGGATGTTTGGGG + Intergenic
1059099250 9:111453903-111453925 TCCCTTGCACAGGATCCTGGGGG + Intronic
1061860568 9:133466018-133466040 TCTAGTGCATAGGAGGCTGGTGG + Intronic
1062253132 9:135608284-135608306 TGGAGTGCACAGTGTGCTGTGGG - Intergenic
1062516740 9:136940675-136940697 TGGGGTACACAGGATACTGGGGG - Exonic
1062541888 9:137045258-137045280 TCGAGGGCAGGGGATGCAGGCGG + Intronic
1186151549 X:6679889-6679911 TAGAGTGGACAGGATGGTGATGG + Intergenic
1186216099 X:7302848-7302870 TCGACTGCAGAGGATGCCTGCGG + Intronic
1187504526 X:19868020-19868042 TCCAGTCCACAGCAAGCTGGAGG + Intronic
1193198206 X:78658104-78658126 TGGAGTTCCCAGGCTGCTGGGGG + Exonic
1200851888 Y:7891887-7891909 TAGAGTTCCCAGGATGATGGGGG + Intergenic
1202367621 Y:24177912-24177934 GTGAGGGCACAGGCTGCTGGGGG + Intergenic
1202377213 Y:24248023-24248045 GTGAGGGCACAGGCTGCTGGGGG - Intergenic
1202493567 Y:25422098-25422120 GTGAGGGCACAGGCTGCTGGGGG + Intergenic
1202503162 Y:25492211-25492233 GTGAGGGCACAGGCTGCTGGGGG - Intergenic