ID: 1103862737

View in Genome Browser
Species Human (GRCh38)
Location 12:124027377-124027399
Sequence AGGGAAATGAAGGAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 589}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103862737 Original CRISPR AGGGAAATGAAGGAGGCTGC TGG (reversed) Intronic
900134233 1:1107697-1107719 AGGGAATAAAAGCAGGCTGCCGG + Intronic
900247368 1:1643152-1643174 AGAGAAATGAAGGGGGCAACGGG - Intronic
900258592 1:1710284-1710306 AGAGAAATGAAGGGGGCAACGGG - Intronic
900552338 1:3263155-3263177 ACAGAAATGGAAGAGGCTGCTGG - Intronic
900851948 1:5150705-5150727 ACAGAAATGAAGGAGGTAGCTGG - Intergenic
900912641 1:5612465-5612487 AGGGAGATGAAAGAGGCTGTGGG + Intergenic
901013809 1:6216217-6216239 GGGGACATGAAGGGGGCTTCTGG + Intronic
901969947 1:12899830-12899852 AGGGAAGTGAAGGTGGAGGCTGG + Intronic
901972731 1:12920539-12920561 TGGGAAAGGAATGAGGATGCAGG + Intronic
901990567 1:13109708-13109730 AGGGAAGTGAAGGTGGAGGCTGG + Intergenic
902012449 1:13281223-13281245 TGGGAAAGGAATGAGGATGCAGG - Exonic
902015225 1:13301950-13301972 AGGGAAGTGAAGGTGGAGGCTGG - Intergenic
902148014 1:14419984-14420006 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
902312050 1:15588528-15588550 AGGGAATAAAAGCAGGCTGCCGG - Intronic
902786182 1:18734175-18734197 AGGGTAAGAAAGCAGGCTGCGGG - Intronic
903027316 1:20438571-20438593 AAGGAAATGAAGGCGGCTTTTGG + Intergenic
903907418 1:26696545-26696567 GGGGAAATGAAGGCAGCCGCCGG + Exonic
905025232 1:34845138-34845160 AGGGAGATGTAGGATGCTGGGGG + Intronic
905475176 1:38221294-38221316 AGTGGAATGAAGGAAGGTGCTGG - Intergenic
906052749 1:42888256-42888278 CGGGAAGTGGAGGAGCCTGCGGG - Intergenic
906055855 1:42916432-42916454 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
906400340 1:45499790-45499812 AGGGAAAGGAAGGACGCTCTTGG + Exonic
906593297 1:47048532-47048554 AGGGAAATAAAAGAGACTGCAGG - Intronic
906664878 1:47614129-47614151 AGGGAAAGGAATGAGGTTGAGGG + Intergenic
907257457 1:53190687-53190709 TGGGAAATGAAGGGGACTGATGG + Intergenic
907287655 1:53392278-53392300 AGGGAAAGGAAGGTGCCTCCAGG + Intergenic
907637670 1:56152543-56152565 AGGAGAATGGAGGAGGATGCTGG + Intergenic
908007712 1:59743825-59743847 ATGGACAGAAAGGAGGCTGCAGG - Intronic
908581229 1:65519451-65519473 ACGGACATGAAAGTGGCTGCTGG - Intronic
908787164 1:67746581-67746603 AGAGGAATGAGGGAGGCTCCTGG - Intronic
909398062 1:75193113-75193135 AGAGAGATGAAGGAGCCTGCAGG - Intergenic
909485236 1:76165311-76165333 AGGGACATGAATGAAGCTGAAGG - Intronic
909839076 1:80295196-80295218 AGGTAAATGGAGGAGTCTGGAGG + Intergenic
910371670 1:86523511-86523533 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
910430838 1:87158316-87158338 AGGGAAAGGAAGGAAGATGGAGG - Intronic
910617659 1:89217524-89217546 AGAGAGATGAAGCAGGCTGGGGG + Intergenic
911102516 1:94105670-94105692 AGGAGAATGTAGGAGGCTCCCGG + Intronic
911336034 1:96581511-96581533 AGGCAAATGTAGGAGGCTTATGG - Intergenic
911631523 1:100189038-100189060 TGTAAAATAAAGGAGGCTGCAGG + Exonic
912300517 1:108511355-108511377 AGGGAAATAAAAGAGGCATCAGG - Intergenic
912528507 1:110303132-110303154 AGGGGGATGGAGGAGGCTGTGGG + Intergenic
912700564 1:111875397-111875419 AGGGAAATTAAGGAGGGTCTTGG - Intronic
912753576 1:112305747-112305769 AGGAACATAAAAGAGGCTGCAGG + Intergenic
912957690 1:114167017-114167039 AAGAACATGAAGGAGGCAGCAGG - Intergenic
916170636 1:161999123-161999145 AAAGAAATGGGGGAGGCTGCAGG + Intronic
916807018 1:168269197-168269219 AGGGAGAAGAACGATGCTGCTGG - Intergenic
917930100 1:179817083-179817105 GGGGAAGTGAAGGGGGCTGTTGG + Intergenic
918960583 1:191271521-191271543 AGGGAAATTAAGGAGCCTCCTGG + Intergenic
919419601 1:197354782-197354804 AGGGAATAAAAGCAGGCTGCTGG - Intronic
919669490 1:200326093-200326115 GGGGACATGAAGGAAGCTGATGG - Intergenic
919850489 1:201668867-201668889 AGGAAAAGGAAGCAAGCTGCAGG - Intronic
919938718 1:202271882-202271904 AGGGGAGTGGAGGAGGCAGCAGG - Intronic
920044626 1:203125413-203125435 AGGACAATGAGGGAGGCTGTAGG - Intronic
920106537 1:203557221-203557243 AGGGAAATCAGGCAGGGTGCAGG + Intergenic
920223215 1:204419625-204419647 AGGGAAATGATGGTGGCTTGGGG - Intergenic
920284670 1:204870910-204870932 AGGGAAAAGAAGGATCTTGCTGG + Intronic
920291203 1:204924274-204924296 ATGTAAATGCAGAAGGCTGCAGG + Intronic
920380190 1:205530624-205530646 AGGGAGAAGATGGAGGCAGCTGG - Exonic
920864218 1:209738084-209738106 AGGGAGAAGAAGGAGGCTAGAGG - Intergenic
920962082 1:210672319-210672341 AGGAATAGGAAGGAGGCTGCGGG - Intronic
921404126 1:214760306-214760328 AGGGAAATGGATGGAGCTGCAGG - Intergenic
922235198 1:223717492-223717514 AGCACAATGAAGGAGGCTCCAGG + Intronic
923036420 1:230287942-230287964 AAGGAAAGGAAGGAAGGTGCGGG + Intergenic
923065082 1:230510133-230510155 AGGGAGAAGAAGGTGGCTGGAGG - Intergenic
923336714 1:232977254-232977276 AGGACAATGAAGGAGTCTGGGGG - Intronic
924380760 1:243462122-243462144 GAGGGAATGAAGGGGGCTGCAGG + Intronic
924758257 1:246961742-246961764 ATGGGAATGAGGCAGGCTGCAGG - Intronic
1063674996 10:8133083-8133105 AGGGAAGAGAAGAAGGCTGGAGG - Intergenic
1064361649 10:14671183-14671205 AGGGAAATGCAGCAGACTGATGG - Intronic
1064783144 10:18864714-18864736 ACGGAAATGATGAAGCCTGCTGG + Intergenic
1065169192 10:23010455-23010477 AGGGAAAGGAAGGAGGGAGGAGG - Intronic
1065169199 10:23010475-23010497 AGGGAAAGGAAGGAGGGAGGAGG - Intronic
1065169261 10:23010696-23010718 AGGGAAAGGAAGGAGGGGGAAGG - Intronic
1065193534 10:23237804-23237826 AGGGACATGAGGGAGCTTGCAGG + Intronic
1065433251 10:25681178-25681200 AGGAATATGAAAGAGGCTTCAGG - Intergenic
1065555059 10:26906811-26906833 AGGGAATAAAAGCAGGCTGCTGG + Intergenic
1066093240 10:32047284-32047306 AAGGATATGAGGGAGGCTGAAGG - Intronic
1066613490 10:37274879-37274901 AGGGAATAAAAGCAGGCTGCTGG - Intronic
1066780841 10:38943070-38943092 AGAGAAAAGAAGGAGGGTGGTGG + Intergenic
1067904567 10:50277322-50277344 AGGGAAAAGTAGCAGGATGCAGG + Intergenic
1068082561 10:52337947-52337969 AGTGCAAGGAAGGAGGCTGGAGG + Intergenic
1068100864 10:52551152-52551174 TGGGAAATAAAGAAGGCTCCAGG - Intergenic
1068559953 10:58503197-58503219 AAGGAATTGAAGGAGGCTTTCGG + Intergenic
1069516366 10:69080732-69080754 AGAGCAATGAAGGAAGCTGAGGG + Intergenic
1069755900 10:70774390-70774412 AGGGACAGGAAGGGGGCTGGGGG - Intronic
1070172868 10:73945622-73945644 AGGGAATAAAAGCAGGCTGCTGG + Intergenic
1070442504 10:76460729-76460751 AGGGAAATGAAGAGTGCTGGTGG - Intronic
1070596643 10:77837462-77837484 AGGGAAAGGAAGGGAGCTGTGGG - Intronic
1070778965 10:79126600-79126622 AGGGAAAGAAATGAGGCTGGAGG + Intronic
1070799197 10:79235189-79235211 TGGGGAATGAAGGAAGCCGCTGG + Intronic
1070826639 10:79394110-79394132 AGGGAAGGGAAGGAGGATGATGG - Intronic
1070971134 10:80568271-80568293 AGGGAGCTGGAGGAGGCTGAGGG + Intronic
1071414866 10:85431976-85431998 AGGCAAATGAAGAATGATGCAGG + Intergenic
1071617798 10:87092922-87092944 AGGCAAATGTAGGAGACTGACGG + Intronic
1073891820 10:108111345-108111367 AGGGGAATGAAGTAGGAGGCAGG - Intergenic
1074098282 10:110332449-110332471 AGGGAATAAAAGCAGGCTGCCGG + Intergenic
1074110495 10:110419356-110419378 AGGGCACTGGAGGAGGCTGCAGG + Intergenic
1075104037 10:119525375-119525397 ATGTGAATGAAGGAGGCTCCTGG - Intronic
1075596752 10:123737103-123737125 AGGGACATGGATGAGGCTGCAGG - Intronic
1076238127 10:128881622-128881644 AGGGCTATGAAGGAGGGTGACGG + Intergenic
1077991953 11:7420048-7420070 AGGTAAGTGAAGGAGGCTTATGG - Intronic
1078788576 11:14520736-14520758 ACTGAAAGGAACGAGGCTGCAGG + Intronic
1078848712 11:15144520-15144542 AGGAACAGGGAGGAGGCTGCTGG - Intronic
1079803331 11:24897281-24897303 AGGGAATAAAAGCAGGCTGCAGG + Intronic
1080820654 11:35802952-35802974 AGGGAAAGGCAGGAGGAGGCAGG + Intronic
1082079445 11:48000741-48000763 GAGGAAATGAAGGAGGATGATGG - Intronic
1082106865 11:48229970-48229992 AGGGAATAAAAGCAGGCTGCGGG + Intergenic
1082797037 11:57385653-57385675 AGGGGCACGAAGGAAGCTGCAGG - Intergenic
1083273311 11:61582906-61582928 AGGGTAATGAGAGAGGCAGCTGG - Intergenic
1083401227 11:62424798-62424820 AGGGCACGGAAGGAGGCGGCGGG + Intergenic
1083701153 11:64478431-64478453 AGGGAAGTGGAGGAGGCAGGAGG + Intergenic
1084321312 11:68374964-68374986 GGGGACATGGAAGAGGCTGCAGG - Intronic
1085622585 11:78048623-78048645 AGGGAAATTAAGGGGGCAGATGG + Intronic
1085643580 11:78208623-78208645 AGAGAAATGAACGAGGCTCTAGG - Intronic
1086017765 11:82187595-82187617 AGGGATATGAATGAAGCTGAAGG - Intergenic
1088649944 11:111948691-111948713 GGGAGAATGAAGGAGGCTTCAGG - Intronic
1088675370 11:112187530-112187552 GGGAGAATGAAGGAGGCTTCAGG - Intronic
1089116808 11:116101903-116101925 AAGGAAATGCAGGAGCCTGAGGG + Intergenic
1089262148 11:117230819-117230841 AGTGAAAGGAGGGAGGCGGCGGG + Intronic
1089313230 11:117573772-117573794 AGAGCATTGAAGGAGGATGCAGG + Intronic
1089556704 11:119319212-119319234 AGGGGAGAGAAGGTGGCTGCGGG + Intronic
1089630588 11:119781789-119781811 AAGGGAATGAAGGAGGCAGGAGG - Intergenic
1089637325 11:119823579-119823601 AAGGAAATTAAGAAGGCTCCAGG - Intergenic
1089647015 11:119886987-119887009 AGGGCATGGACGGAGGCTGCAGG - Intergenic
1090268842 11:125371545-125371567 AGGGGAACGAAGGAGACTGGAGG - Intronic
1090580514 11:128153841-128153863 AGGGAAAGAAGGCAGGCTGCAGG + Intergenic
1090712946 11:129404245-129404267 AGGGCAGCGAGGGAGGCTGCAGG + Intronic
1090955713 11:131511451-131511473 AGGGAAATGAGGGGGTGTGCTGG - Intronic
1091365492 11:135016312-135016334 AAGGAGATGGAGGAGGCTGTGGG - Intergenic
1091969054 12:4770972-4770994 AGGGAACAGAGGGGGGCTGCTGG + Intronic
1092205971 12:6614259-6614281 AGGGCAAGGGAGGAGGCTGGAGG - Intergenic
1092456702 12:8650271-8650293 AGGGAAATGAAGGTGGGCGCTGG - Intronic
1092999111 12:13979270-13979292 CTGGAATTGAAGGATGCTGCAGG - Intronic
1093249512 12:16784248-16784270 AGAGAACTGGAGGGGGCTGCTGG + Intergenic
1094266191 12:28563238-28563260 AGGAAAATGAAGCAGGTTCCTGG + Intronic
1094449315 12:30567455-30567477 AGGTAAATAAAGCAGGCTGTGGG - Intergenic
1094487374 12:30935766-30935788 AGGGGAGCGGAGGAGGCTGCCGG - Intronic
1096492551 12:52020698-52020720 TGGGAAGTGAGGGAGGCTGTGGG + Intergenic
1096707418 12:53431038-53431060 AGGGAGAGGAGGGAGGCTCCAGG + Intronic
1096708878 12:53441144-53441166 AGGGAGGTGAAGGAGGCAGAGGG + Intergenic
1097179062 12:57160562-57160584 AGGGAAATAAAGCAGGGTGATGG - Intronic
1097499242 12:60381272-60381294 AGGGACATGAATGAAGCTGGAGG - Intergenic
1097923760 12:65105583-65105605 AGGGAAATGAAGGATTTTGTGGG + Intronic
1098894048 12:76037430-76037452 AGAGAACTGAATTAGGCTGCTGG - Exonic
1099205191 12:79718926-79718948 AGAGAAATGAAGCAGGGTGAAGG + Intergenic
1099257704 12:80334625-80334647 GAGAAAATGTAGGAGGCTGCAGG + Intronic
1101652972 12:106694430-106694452 AGGGGCCTGAAGGATGCTGCAGG + Intronic
1102002471 12:109566021-109566043 AGGGAAATGCAGGAGCCTGAAGG + Intronic
1102181823 12:110918423-110918445 GGGGAAAGGCACGAGGCTGCTGG + Intronic
1102705704 12:114878458-114878480 AGGGAAGAGAAGGAGGGTGGAGG - Intergenic
1102741446 12:115211098-115211120 AGAGCCAAGAAGGAGGCTGCAGG + Intergenic
1102765469 12:115429223-115429245 AGGGAAAGGTAGGAGGGTGGAGG - Intergenic
1103238811 12:119397292-119397314 AGGGAATAAAAGCAGGCTGCTGG - Intronic
1103263334 12:119608472-119608494 AGGAAAATGAAGGAGGCTGAGGG + Intronic
1103862737 12:124027377-124027399 AGGGAAATGAAGGAGGCTGCTGG - Intronic
1104348981 12:128028628-128028650 AGAGAAAGAAAGGAGGCTGGTGG + Intergenic
1104448559 12:128852514-128852536 AGGGAACTGAAGGAGGCCTCTGG - Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105763246 13:23532407-23532429 AGGGAATGAAAGCAGGCTGCTGG + Intergenic
1106133351 13:26957375-26957397 AGGGCAATGAATGTTGCTGCTGG + Intergenic
1106577880 13:30992726-30992748 AGAGAAATGAGGGAGACTGGTGG + Intergenic
1108261269 13:48659069-48659091 AGGAAGTTGATGGAGGCTGCTGG + Intronic
1109588187 13:64438137-64438159 CTGGTAATGAAGGAGGCTGTTGG - Intergenic
1109699791 13:66010130-66010152 AGGGAATAAAAGCAGGCTGCCGG + Intergenic
1109829821 13:67772295-67772317 AGGGAATAAAAGAAGGCTGCTGG - Intergenic
1110189578 13:72715249-72715271 AGCCAAATGAAAGAGGCTACAGG - Intronic
1111011935 13:82325237-82325259 AAGGAAATGAAGGAGACTAAAGG + Intergenic
1112135795 13:96576285-96576307 AGGGAAACGTGGCAGGCTGCGGG - Intronic
1112184943 13:97118638-97118660 ACAGAATTGAAGGAGGCTTCTGG - Intergenic
1113275318 13:108722126-108722148 AGGTAAATGAAGGTGACAGCAGG + Intronic
1113474623 13:110571730-110571752 CTGGAAATAAATGAGGCTGCGGG + Intergenic
1113552066 13:111200211-111200233 AGGAAAATGAAGGATGCAGCAGG - Intronic
1113830777 13:113294008-113294030 AGGACAATGAAGGAGGCGGCTGG - Intergenic
1114810748 14:25896027-25896049 AGGGAAATGAAGCTTGCTGAGGG + Intergenic
1115268492 14:31526543-31526565 AGGGAATGAAAGCAGGCTGCTGG - Intronic
1115758719 14:36556569-36556591 AGGGACGTGAAGGAGGCAGGTGG + Intergenic
1115957153 14:38794155-38794177 GGGGAACTGGAGGAGGCTGGGGG - Intergenic
1116508580 14:45715684-45715706 AGGGAACTGAAGAGGTCTGCAGG - Intergenic
1116635328 14:47387349-47387371 AGGGAAAGGATGGAAGCTGGAGG + Intronic
1117190788 14:53289112-53289134 AGGGAGAGGAAAGGGGCTGCAGG + Intergenic
1118249661 14:64147295-64147317 AAGGAAATGAGGGAGGAGGCTGG - Intronic
1119365172 14:74085019-74085041 AGAGCAAAGAAGGAGGCTGCAGG - Intronic
1119382548 14:74238541-74238563 AGGGAGAGGAAGGAGGAAGCGGG - Intergenic
1119440212 14:74623178-74623200 ATGGAAAGGGAGGAGGCTGGAGG + Intergenic
1119489261 14:75016597-75016619 AGGGAAGTGAAGAAGACTGAAGG + Exonic
1121062864 14:90932483-90932505 AGGGAAATGAATGTGTTTGCTGG - Intronic
1121710029 14:96030801-96030823 GAGGATATGGAGGAGGCTGCCGG + Intergenic
1122026942 14:98885128-98885150 AAGGAAAAGAAGGAGGTTGAAGG - Intergenic
1122309470 14:100785410-100785432 AGGGACAGCAAGGAGACTGCTGG - Intergenic
1122950674 14:105042795-105042817 AGGTGAAAGAAAGAGGCTGCAGG - Intergenic
1124105046 15:26729722-26729744 GAGGAAGTGAAGGAGCCTGCTGG - Intronic
1124418001 15:29490425-29490447 AGGGAATAAAAGCAGGCTGCCGG - Intronic
1125107264 15:35986823-35986845 AGGGACAGAAAGCAGGCTGCAGG - Intergenic
1125137289 15:36358266-36358288 AGAGAAAAGAAGGAGGCTCCCGG - Intergenic
1125898024 15:43318917-43318939 TGGGAGATGAAGGAAGCAGCAGG + Intergenic
1126467783 15:48976334-48976356 AGGCTAAAGAAGGAGCCTGCAGG + Intergenic
1126644025 15:50856979-50857001 AGGGAAATGAGAGAGGAAGCTGG + Intergenic
1128089690 15:64911387-64911409 AGGGACATGTAGGAGGATGTTGG - Intronic
1129184068 15:73894966-73894988 CCAGAAATGAAGGAGGCTGGTGG + Intergenic
1129193446 15:73951111-73951133 CAGGAAACAAAGGAGGCTGCTGG + Intronic
1129381608 15:75171271-75171293 AGAGAAATGAAGCAGATTGCTGG + Intergenic
1129409044 15:75338770-75338792 AGGTAAGTTAAGGATGCTGCTGG - Intronic
1129539354 15:76338194-76338216 AGGGAGATGAGGGCGGCCGCAGG + Intronic
1129565166 15:76614095-76614117 AGGGACATGAATGGTGCTGCGGG + Intronic
1129808346 15:78483552-78483574 AAGGAAAATAAGGGGGCTGCTGG - Intronic
1129864838 15:78898688-78898710 AGCCGAATGAAGGAGGCGGCAGG - Intergenic
1130028892 15:80294376-80294398 AGGGAAAAGAAGGAGGAAGGAGG - Intergenic
1130179901 15:81615115-81615137 AGGGATATGAAGGAGTTTTCTGG - Intergenic
1130331230 15:82923809-82923831 GGGAAAATGAAGGAGGTTGATGG - Intronic
1130350678 15:83088996-83089018 AAGGAATTGAAAGAGGCTCCAGG - Intergenic
1130817504 15:87453479-87453501 AGGGATATGGATGAGGCTGGAGG - Intergenic
1131193990 15:90340516-90340538 CGGGAGGTGGAGGAGGCTGCAGG - Intergenic
1132333570 15:101028977-101028999 CGGGAAATGGAGCAGGGTGCCGG - Exonic
1132911375 16:2314423-2314445 AGGGACAGGAAGTAGGGTGCTGG + Intronic
1133178058 16:4030831-4030853 AGGGACACGAGGGAGGCTTCTGG + Intronic
1133371518 16:5249028-5249050 AGGGAAGAGAAGGGGGCTGTGGG + Intergenic
1133451271 16:5905860-5905882 AGGGAAATTAGGAAGGCTTCCGG - Intergenic
1134001058 16:10783098-10783120 AGGGATATGAGGGAGACTTCTGG + Intronic
1134029779 16:10982536-10982558 ATGGAAAGGAAGGAGTGTGCTGG + Intronic
1134054994 16:11164469-11164491 GGTGAAAGGAAGGAGGCTGAGGG + Intronic
1134558637 16:15188158-15188180 AGGGAAATTAAGGAGTATACAGG + Intergenic
1134919168 16:18099760-18099782 AGGGAAATTAAGGAGTATACAGG + Intergenic
1135053479 16:19211495-19211517 TGGGAAATGATGGAGGCAGAGGG + Intronic
1135459033 16:22625201-22625223 AAGGAAATGAAAGGGGCTGGGGG - Intergenic
1135597756 16:23756313-23756335 GGGGGAAGGAAGGTGGCTGCTGG + Intronic
1135872081 16:26160526-26160548 AGGGAGATGGCGGAGGCTGGTGG + Intergenic
1136542383 16:30935359-30935381 AGGGGACAGCAGGAGGCTGCAGG + Intronic
1137708708 16:50551936-50551958 AGGGAAATGAACTAGCCTGAGGG - Intronic
1137864268 16:51877067-51877089 AGGGAGATTAAGGAGGCAGGTGG + Intergenic
1140476926 16:75243746-75243768 AGGGACTTGGAGGAGGCTGTGGG + Intronic
1140519599 16:75569682-75569704 AAGGAAATGAAGCAGGCTTCTGG + Intronic
1141549993 16:84800450-84800472 AGTGAACTGAAGGAAGTTGCTGG + Intergenic
1141635436 16:85311699-85311721 TGGGAAATGAAGCAGGCAGGAGG - Intergenic
1141893719 16:86945109-86945131 AGGGAAGTGAAGGAGTTTGCCGG + Intergenic
1142004327 16:87682142-87682164 CAGGAAATGAAGCAAGCTGCTGG - Intronic
1142357839 16:89611850-89611872 AGGGAGGTGAAGGGGGCTGCAGG + Intergenic
1143361404 17:6374628-6374650 AGAGAAAAGGAGGAGGCTGCTGG + Intergenic
1143543332 17:7582329-7582351 AGGGTCAGGAAGAAGGCTGCGGG - Intergenic
1143616813 17:8056466-8056488 AGGGTACTGCAGGAGGCTGCTGG + Intergenic
1144051090 17:11497720-11497742 ATGGAAATAAAGGTGGCTGCTGG - Intronic
1144080268 17:11757945-11757967 ATGTATGTGAAGGAGGCTGCGGG + Intronic
1144307060 17:13978309-13978331 AGGGCTAGGAAGGAGGCTGTTGG - Intergenic
1144645929 17:16973341-16973363 AGAGGAAGGAGGGAGGCTGCAGG + Intergenic
1145016484 17:19401933-19401955 AGGGAAATGTGGGAGCCTGGAGG - Intergenic
1146213186 17:30957807-30957829 AGGGAAATGAAGAGGGCTGAGGG - Intronic
1146233932 17:31139732-31139754 AGATAAAGGAAAGAGGCTGCTGG + Intronic
1146379714 17:32319675-32319697 AGGGAAATGAAGGTCCCTGGAGG + Intronic
1146582496 17:34051408-34051430 AGGGAATTGAGGCAGGCTGAGGG - Intronic
1147228931 17:39003088-39003110 TGGGAAAGGAAGGAGGCAGAGGG - Intergenic
1147757401 17:42778112-42778134 AGGGAGATGTGGGAGGCAGCAGG - Intronic
1147767587 17:42846948-42846970 AGGGAAACTAAGGAGGGTGGCGG + Intronic
1147938709 17:44029727-44029749 AGCGGAAGCAAGGAGGCTGCTGG - Intergenic
1147987224 17:44313581-44313603 CAGGAACTGAAGGATGCTGCAGG - Intronic
1148630799 17:49106841-49106863 AGGGATAGGAAGGTGGCTTCTGG - Intergenic
1149424933 17:56545935-56545957 AGGGAAGGGAAGGAGGCAGGAGG + Intergenic
1150728143 17:67668109-67668131 AGGGACATGAAGGAAACTTCTGG - Intronic
1151706976 17:75774344-75774366 TGGGGAATGAGGGAGGCTGCAGG - Intergenic
1151920094 17:77148171-77148193 GGGAAAATGAAGGAGGCGGGAGG + Intronic
1151974274 17:77475651-77475673 AGGCAAAGTAAGGAGACTGCTGG + Intronic
1151994263 17:77598560-77598582 AGGGAAATTGAGGACCCTGCTGG + Intergenic
1152209365 17:78994939-78994961 AGGCAAATGCAGGAGGAAGCAGG + Intronic
1152299432 17:79486448-79486470 AGGGGAGTTGAGGAGGCTGCAGG - Intronic
1152642752 17:81456039-81456061 GGGGACATGGAGGAGGCTGAGGG - Intronic
1152700438 17:81815763-81815785 AGGGAACTGGAGCAGGCTGGTGG + Intergenic
1152800787 17:82329812-82329834 AGGGAGATGAGGGAAGCAGCTGG - Intronic
1153818300 18:8809893-8809915 AGGGCCATGGAGGACGCTGCAGG + Intronic
1154379834 18:13838978-13839000 AAGGATGTGAAGGACGCTGCCGG + Intergenic
1155343765 18:24838607-24838629 GGGGCAATCAAGGAGGCTTCAGG + Intergenic
1155517193 18:26635977-26635999 AGGGAACTGCAGGAGGGTGTGGG + Intronic
1155585427 18:27358802-27358824 AAGGAGATGAAAGAGTCTGCAGG - Intergenic
1155687315 18:28571176-28571198 AGGGAAATGAAGGAGTCCTGTGG + Intergenic
1155851104 18:30775013-30775035 ATGGAAAAGAATGAGGCAGCAGG - Intergenic
1156105149 18:33650501-33650523 AGAGAAAATATGGAGGCTGCAGG + Intronic
1156931260 18:42646803-42646825 AGGGAGATGTAAGAGGCTGTTGG + Intergenic
1157116142 18:44864381-44864403 AGGGAGATGAAGGATGCTGTGGG - Intronic
1157417240 18:47513947-47513969 AGGGATATGCAGGAGGCCGATGG - Intergenic
1157721198 18:49925916-49925938 AGGCCAATGTAGGAGACTGCAGG + Intronic
1157859307 18:51126182-51126204 AGCCCAATAAAGGAGGCTGCTGG + Intergenic
1158282196 18:55840325-55840347 AGGGAATAAAAGCAGGCTGCTGG - Intergenic
1158649723 18:59274082-59274104 CGGGGAAGGAGGGAGGCTGCCGG - Intronic
1158942210 18:62415125-62415147 ATGGACATGAAGGAGCCTCCCGG + Intergenic
1159006025 18:63013001-63013023 GGAGACATGAAGGAGGCTTCTGG - Intergenic
1159353403 18:67303344-67303366 AGGGACATGAAGGAAGTTTCTGG + Intergenic
1159469111 18:68826348-68826370 AAGGAAATGAGGAAGGCTTCTGG - Intronic
1160073329 18:75647734-75647756 AGGCAAATGGAGGAGAGTGCAGG - Intergenic
1160699767 19:500267-500289 GTGGAGATTAAGGAGGCTGCTGG + Intronic
1160739196 19:678080-678102 AGGGGTATGTAGGAGGCTGCAGG + Intronic
1161153401 19:2720961-2720983 AGGGCGAAGAAGGCGGCTGCAGG + Intronic
1161986261 19:7656286-7656308 AAGTGAATGAAGGAGGCTGAGGG - Intergenic
1162470504 19:10870029-10870051 AGGGACATGAAGGAGAATGAGGG + Intergenic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1162867306 19:13557971-13557993 AGGGAAATGGGAGAGGTTGCAGG + Intronic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1164846052 19:31433371-31433393 AGGAAGATGCAGGAGGTTGCTGG + Intergenic
1164880294 19:31727278-31727300 AGGGACAAGGAGGAGGGTGCTGG + Intergenic
1165759368 19:38311654-38311676 AGGGAAGGGAGAGAGGCTGCTGG + Intronic
1166071880 19:40392815-40392837 AGAGACATGGAGGAGGCTGGAGG + Intergenic
1166104532 19:40590785-40590807 AGGGAGCTGAAGGAGCCGGCGGG - Exonic
1166203711 19:41255034-41255056 AGAGGCATGAAGGAGCCTGCTGG - Intronic
1166349181 19:42186708-42186730 AGGGACATGAAGGAGGCAACAGG + Intronic
1166350309 19:42194952-42194974 AAGGAAATGAAGGAGGGGGGAGG + Intronic
1166387536 19:42390476-42390498 AGGGAAAAGAAGGTGGCGGGGGG + Intergenic
1167144623 19:47674231-47674253 AGGAACAGGAAGGAGGCTGATGG + Intronic
1167217689 19:48175652-48175674 AGGGATATGAAGGAGGAGGCTGG + Intronic
1167557867 19:50206699-50206721 AGGGAAAGGCAGGAGTCTGTTGG + Intronic
1167831413 19:52025890-52025912 AGGAAGAAGAAGGAGGTTGCTGG - Exonic
1167851389 19:52205112-52205134 TGGGAAATGCAGTCGGCTGCTGG + Intronic
1168077179 19:53987442-53987464 AGGGGAAGGAAGGAGGTAGCGGG + Exonic
1168419241 19:56190392-56190414 TGGGAAATGGAGGAGGCATCTGG + Exonic
1168423696 19:56222140-56222162 TGGGAAATGGAGGAGGCATCTGG + Exonic
1168426816 19:56245660-56245682 AGTGAAATGAGGGAGGCAGTTGG + Intronic
1168651963 19:58097579-58097601 AGGGAAGGGATGGAGGGTGCGGG - Intronic
1168716578 19:58532023-58532045 AGGGAAAGGAAGGAGGGGGGAGG - Intronic
925178075 2:1798745-1798767 AGGGGCATGAAGGCTGCTGCAGG + Intronic
925860451 2:8170437-8170459 AATGAAATGAAAGAGGCTGTGGG - Intergenic
925906645 2:8543787-8543809 TGGGAAAGGACGCAGGCTGCTGG - Intergenic
926020653 2:9492097-9492119 AAGGAAAGGAAGGAGGCAGTAGG + Intronic
926767017 2:16330618-16330640 CGGGAGAGGAAGGTGGCTGCAGG + Intergenic
927596783 2:24403698-24403720 AGGGAATAAAAGCAGGCTGCTGG + Intergenic
927812099 2:26185954-26185976 AGGAACAGGAAGGAGGCTGTGGG + Intronic
927900534 2:26815143-26815165 AGGGAATAAAAGCAGGCTGCGGG + Intergenic
928025888 2:27738269-27738291 AGGGAAAAAAAAGAGGGTGCTGG - Intergenic
928223352 2:29423923-29423945 AGGGGAAGGAGGGAGTCTGCTGG - Intronic
929552994 2:42906101-42906123 AGGGGAAAGAAGGTGGGTGCAGG + Intergenic
929591943 2:43153336-43153358 AGGGAGACCTAGGAGGCTGCAGG - Intergenic
929964008 2:46520167-46520189 TGGGACATGAAGGCAGCTGCAGG + Intronic
930169070 2:48232523-48232545 AAGGAACTGAAGGAGGCCTCTGG + Intergenic
930468742 2:51787076-51787098 AGGGAACAGAAGGAGGTTACAGG - Intergenic
931179695 2:59886917-59886939 GGGGATATGAAGTAGGCGGCTGG - Intergenic
932578916 2:72980845-72980867 AGGGGAATGCAGGAGGGGGCAGG - Intronic
933028977 2:77301664-77301686 AGAGGAATGCAGGAGGCAGCTGG + Intronic
933048006 2:77563496-77563518 AGGGACATGAATGGAGCTGCAGG + Intronic
933238551 2:79893365-79893387 TGGGAAGAGGAGGAGGCTGCTGG + Intronic
933895786 2:86808667-86808689 AGGGCGAAGATGGAGGCTGCTGG - Intergenic
934138477 2:89020603-89020625 AGGGAAATGAGGGAGGATGATGG - Intergenic
934144562 2:89078702-89078724 AGGGAAATGAGGGAGGATGATGG - Intergenic
934224690 2:90121847-90121869 AGGGAAATGAGGGAGGATGATGG + Intergenic
934230767 2:90179950-90179972 AGGGAAATGAGGGAGGATGATGG + Intergenic
934662900 2:96152693-96152715 ATGCAAATGAAGGAGGCTCCAGG + Intergenic
934731457 2:96661271-96661293 GGGAGAAGGAAGGAGGCTGCAGG + Intergenic
935364182 2:102271839-102271861 AGTGAAATGAAAAAGACTGCTGG - Intergenic
935679627 2:105624750-105624772 AGGGACAAGAAGGAGGCAGGGGG - Intergenic
935804528 2:106732727-106732749 AGGGAAATGTAGGGGGTTGGTGG + Intergenic
935870612 2:107444458-107444480 ATGGAAATGAACTGGGCTGCAGG + Intergenic
936623628 2:114125127-114125149 AGGGACATGAATGGGGCTGGAGG + Intergenic
937161472 2:119766406-119766428 AGTGAAATGGGGGAGGCAGCGGG - Intronic
937770311 2:125713144-125713166 AGGTAAGAGAAGGAGGCTGTGGG + Intergenic
937789326 2:125942547-125942569 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
938015423 2:127863290-127863312 AGGGAAACGTAGCAGGCTGCAGG + Exonic
938067601 2:128289760-128289782 AGGGAAAGAGAGGAAGCTGCCGG + Intronic
938571620 2:132566930-132566952 AGGCAAATGGAGAAGGCTCCCGG - Intronic
938992713 2:136645684-136645706 AGTGAAAGGAAGGAGGCAGGAGG + Intergenic
939779632 2:146429701-146429723 AGAGGTATGAAGGAGCCTGCTGG + Intergenic
939818321 2:146923748-146923770 AGAAAAATGAAGGAGGCTTCTGG + Intergenic
940815226 2:158290216-158290238 TGGGGAATAAAGGAGGCTGGCGG + Intronic
940850925 2:158687494-158687516 AGAGACAAGAAGGAGACTGCTGG - Intergenic
941336912 2:164257082-164257104 ATTGTAAAGAAGGAGGCTGCTGG + Intergenic
941543853 2:166820629-166820651 AGGGACTTGAAGAAGGCTTCTGG + Intergenic
941721970 2:168821843-168821865 AGGGAAATCGGAGAGGCTGCCGG + Intronic
942196570 2:173526653-173526675 AGCAAAAAGAAGGAGGCTGGAGG - Intergenic
942620139 2:177836547-177836569 AGGGAATAAAAGCAGGCTGCCGG + Intronic
943363410 2:186947178-186947200 AGGCAGATGCAGAAGGCTGCTGG + Intergenic
943681200 2:190769926-190769948 AGGGAAATGAAGGAGGCAACGGG - Intergenic
944616482 2:201465518-201465540 AGGGAAAGGAAGGAATCTCCTGG + Intronic
945080399 2:206082396-206082418 AGGGAAAAGAGGGAGGCTTAAGG + Intronic
945145221 2:206731225-206731247 AGGGACATGAAGGACTCTTCAGG + Intergenic
945354838 2:208828131-208828153 GGGGAAAGGAATCAGGCTGCTGG - Intronic
945773466 2:214075446-214075468 AAGGGCATGAAGGAGGCTTCTGG + Intronic
946196505 2:218035496-218035518 AGGTAAATGAGGGAGGTGGCTGG - Intronic
946245201 2:218383417-218383439 GGAGAAGTGAAGGAGGCTGCAGG + Intronic
946701912 2:222423577-222423599 AGGGAAATGTAGGAGGGAGGAGG + Intergenic
947096525 2:226573046-226573068 AGGGAAGTGGAGGAGGCTGCAGG - Intergenic
948869007 2:240789055-240789077 AAGGCAGTGATGGAGGCTGCAGG - Intronic
1168908396 20:1425326-1425348 AGGGAACTGAAGGAGGTGGTTGG - Intergenic
1170266629 20:14473300-14473322 TGGGAAAGGCAGGAGGCTACAGG - Intronic
1170358839 20:15522207-15522229 AGAGAGGTGAAGGAGGCTCCTGG - Intronic
1171502381 20:25603800-25603822 AGGGAAATCAAGGTGTCAGCCGG + Intergenic
1172060535 20:32184294-32184316 AGGGGAATGCAGGATGCAGCTGG + Intergenic
1172111124 20:32545603-32545625 AGGGAGATGGAGAAGCCTGCTGG - Intronic
1172214947 20:33228763-33228785 AGGGCATTGAAGGGGGCTTCTGG + Intergenic
1172229726 20:33328581-33328603 GGGGAAGTGAAGGTGGCTTCGGG + Intergenic
1172467437 20:35166600-35166622 AGGGAAATGAAGGAAGCAAGCGG - Intergenic
1172525075 20:35595848-35595870 AGGGCTATGAGGGAGGCTGGGGG - Intergenic
1173373369 20:42460250-42460272 AGGGAAATGAATGTGGATCCAGG + Intronic
1173677574 20:44850485-44850507 AGGGGAATGAGGGAGCCTTCTGG + Intergenic
1173961909 20:47080427-47080449 AGGGAAATGAGGGAGGGGGGAGG + Intronic
1174123821 20:48288081-48288103 AGGGAAAGGAAGGAGGACGGAGG - Intergenic
1175160662 20:57005341-57005363 AGGGAAGGGAAGGAGAGTGCAGG + Intergenic
1175230468 20:57470619-57470641 AGGGAAGGGAAGGAGGTTGTGGG - Intergenic
1175334271 20:58184979-58185001 AATGAAATGAAGGTGGCTGCAGG - Intergenic
1175623770 20:60473367-60473389 GGGAGAGTGAAGGAGGCTGCTGG - Intergenic
1176377442 21:6093589-6093611 TGGGAAATGACGGGGGGTGCGGG - Intergenic
1176929360 21:14789494-14789516 AGGGAACTGAAAGAGGCCTCTGG + Intergenic
1177893745 21:26837501-26837523 AGGGAAAGCAAGAAGGCTGGAGG - Exonic
1179746032 21:43444655-43444677 TGGGAAATGACGGGGGGTGCAGG + Intergenic
1180205395 21:46256316-46256338 AGGGAAATAATGGAGGGTGGAGG + Intronic
1180994788 22:19959999-19960021 AGGCAAAGGAAGGGGGCTTCGGG + Intronic
1181388801 22:22564328-22564350 AGGGAAAGGCAGGAGCCTTCAGG + Exonic
1181497157 22:23293856-23293878 GGGGAAATGGAGGAGGGTGCGGG - Intronic
1182188659 22:28435592-28435614 AGCAAAATGAAGGTGGCTGCTGG + Intronic
1182770365 22:32791310-32791332 AGAGCAATGCAGGAGGCTGGAGG + Intronic
1183080512 22:35452888-35452910 AGTGACATGAAGGAAGCCGCTGG - Intergenic
1183085846 22:35486512-35486534 AGGGGTATCAAGGAGGCAGCTGG - Intergenic
1184948174 22:47818922-47818944 AGAGAAATGAAGGAGTCTATTGG + Intergenic
1185129804 22:49032462-49032484 AGGCAGATGGAGCAGGCTGCCGG + Intergenic
950138247 3:10598191-10598213 AGGTAAATGAAGCTTGCTGCAGG + Intronic
950186496 3:10948696-10948718 AGGGAGAGGAAGGAGGCCCCAGG + Intergenic
950357850 3:12426562-12426584 AGGGAAAAGAAAAAGGCTGAAGG + Intronic
951323093 3:21271326-21271348 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
951827980 3:26889662-26889684 AGGGATTTGAAGGAAGCTCCAGG - Intergenic
952377030 3:32776421-32776443 GGGGATATGAAGGCAGCTGCTGG + Intergenic
953043656 3:39276926-39276948 AGGGACATGAGAGAGGCTTCTGG + Intronic
953493299 3:43367097-43367119 AGGGACTTGCAGGAAGCTGCAGG - Intronic
953844015 3:46412617-46412639 AGGGAGCAGAAGGAGGCTGCTGG + Intronic
954490784 3:50902616-50902638 AGGAAAAAGAACAAGGCTGCAGG - Intronic
954584518 3:51721559-51721581 AGGGAAATGGAGGGGACTGAGGG + Intergenic
954756017 3:52840411-52840433 AGGGTAAGGAACGATGCTGCGGG + Exonic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955219814 3:57013889-57013911 AGGGAATAAAAGCAGGCTGCCGG + Intronic
955633386 3:60999698-60999720 AGGGAAATAGAGGAGGAAGCAGG + Intronic
956074629 3:65491687-65491709 AGGGAAGGGAGGGGGGCTGCGGG - Intronic
956134289 3:66083558-66083580 AGGGATGAGAAGGAGGCTACTGG + Intergenic
956237026 3:67083787-67083809 AGGGAAAAGGAGGAGGCTTCAGG + Intergenic
957151835 3:76496554-76496576 TGGGAAATCAAGTAGGCAGCTGG - Intronic
957319930 3:78617634-78617656 CGGCAAATGCAGGATGCTGCTGG - Exonic
957437846 3:80201731-80201753 AGGGAAATGGATGAAGCTGGAGG + Intergenic
959141494 3:102491894-102491916 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
959795881 3:110427863-110427885 ATGGAGAAGAAGGAGGCTGAGGG - Intergenic
959961455 3:112303130-112303152 AGTGACATGCAGGGGGCTGCAGG + Intergenic
960057499 3:113285586-113285608 AGGGAAATTAAACAGGCTGGGGG + Intronic
960567631 3:119151459-119151481 AGGGAAAGGAAGGGGGCTTCTGG - Intronic
961559487 3:127718777-127718799 AAAGATATGAAGGAGGATGCAGG - Intronic
961863851 3:129939248-129939270 AGGGGCATGAGGGAGCCTGCTGG - Intergenic
962372031 3:134828704-134828726 TGGGGATTGAAGGAGGCTGCAGG + Intronic
963209362 3:142672202-142672224 AGGGGAATGAGGGAGTCTTCAGG - Intronic
964394437 3:156230938-156230960 AGGGAAAAGAGGGAGGCTGAAGG - Intronic
964406461 3:156353685-156353707 AGGGAACTGAGGGAGGCCTCTGG - Intronic
964518746 3:157541514-157541536 AGGGAAAGGAAGAAGGCAACTGG + Intergenic
965658641 3:171017470-171017492 AGGAAAATGAAAGATACTGCAGG - Intronic
965744972 3:171915596-171915618 AGGGAAATATTGGAGGCTGAGGG + Intronic
966182890 3:177203172-177203194 AGGGAATAAAAGTAGGCTGCCGG - Intergenic
966941651 3:184751833-184751855 AGGGCAATGAAGGGGCCTTCTGG - Intergenic
966971200 3:185047080-185047102 TGGGTAATGAAGGAGGTTGGGGG - Intronic
967109929 3:186284234-186284256 TGTGCAAGGAAGGAGGCTGCTGG - Intronic
968144578 3:196287679-196287701 AGGGAAGTTGAGGAGGTTGCGGG + Exonic
969303031 4:6308652-6308674 AGGGAATAAAAGCAGGCTGCTGG - Intergenic
969433405 4:7169313-7169335 TGGGACCTGCAGGAGGCTGCAGG + Intergenic
969999485 4:11350266-11350288 AGGAAACTGAAGGAGACTGTGGG - Intergenic
970140237 4:12974298-12974320 AGGGAAATGAAGGAGACGGGAGG + Intergenic
970684119 4:18545986-18546008 AGGGGAATGAAGGTAGCTGAAGG + Intergenic
972699802 4:41483103-41483125 AGAGAAATGATGGATGCTGTGGG + Intronic
973078407 4:45960251-45960273 AGGGACATGAATGAAGCTGGAGG - Intergenic
973903559 4:55503452-55503474 AGGGGCATGAAGGAGGCTCCTGG + Intronic
974839653 4:67286112-67286134 AGGGAAAAAAAGCAGGCTGCGGG - Intergenic
975251612 4:72186017-72186039 AGAGAAAGCAAGGAGGCTGGGGG - Intergenic
975712942 4:77178679-77178701 AGGGAAAGAAAGGAAGCTGCAGG + Intronic
976202894 4:82597501-82597523 AGGGAAAAAGAGGAAGCTGCTGG - Intergenic
976211487 4:82676098-82676120 AGGGGAATCAGGGAGGCTGAAGG - Intronic
977079208 4:92501652-92501674 AGGGTAAGGCTGGAGGCTGCTGG - Intronic
977286886 4:95118837-95118859 AGAGAAGACAAGGAGGCTGCCGG + Intronic
977927059 4:102713298-102713320 AGGGAAATGAAGGATGAAGATGG - Intronic
978748691 4:112223216-112223238 AGGGAATAAAAGCAGGCTGCGGG + Intergenic
978809219 4:112831629-112831651 AGGGAATAAAAGCAGGCTGCTGG + Intronic
979192747 4:117882883-117882905 TAGGAAATGAAGCAGGATGCGGG + Intergenic
979321690 4:119332309-119332331 ATTGAGATGAAGAAGGCTGCAGG - Intergenic
979609141 4:122670999-122671021 AGGGAATAAAAGCAGGCTGCAGG + Intergenic
980614037 4:135194892-135194914 AGCCAAAAGAAGGAGGCTACAGG - Intergenic
981311792 4:143304791-143304813 AGGGAAAGGAATGAAGCTGGAGG + Intergenic
981546816 4:145902417-145902439 AGGGAAAGGAAGGAGCTGGCCGG + Exonic
982328901 4:154159283-154159305 AGGGGAAGGAAGGAAGATGCAGG + Intergenic
982336965 4:154250909-154250931 GGGGTAATGAAAGAGGCAGCAGG - Intronic
982387650 4:154829161-154829183 AGGGACATGGATGAGGCTGGAGG + Intergenic
982702430 4:158671741-158671763 AGGGAGAAGAGGGAGGCGGCGGG + Exonic
983239668 4:165217912-165217934 ATTGAGATGAAGAAGGCTGCAGG - Intronic
983517477 4:168673262-168673284 AAAGAAATGAAGGTGGCTGATGG + Intronic
984109329 4:175592893-175592915 AGGGAAAGGAAGAAAGCTTCTGG - Intergenic
984168949 4:176338240-176338262 AAAGAAATGAAGGAGGCTTGGGG + Intergenic
984407602 4:179353379-179353401 AGAGAAGACAAGGAGGCTGCAGG - Intergenic
984480671 4:180297377-180297399 AGGGGAAACAAGGAGGCTTCAGG + Intergenic
985327425 4:188787345-188787367 AAGGAAAAGAAGGAGGCAGGAGG - Intergenic
985615007 5:914970-914992 AGAGAAATCAGGAAGGCTGCTGG + Intronic
985702144 5:1380078-1380100 AGGGAATAAAAGCAGGCTGCGGG - Intergenic
985958026 5:3278934-3278956 AGGGAAAGGAAGGAGGAGGGAGG - Intergenic
986165629 5:5269475-5269497 AGGGAGATGGAGGAGATTGCAGG - Intronic
987336750 5:16904072-16904094 AGGGAAAGGAAAGGGGCTGAAGG + Intronic
987398892 5:17454233-17454255 TGGGAAATAAAGGAGGCTGGTGG + Intergenic
990419106 5:55614417-55614439 AGGGAATAAAAGCAGGCTGCCGG + Intergenic
991042131 5:62187242-62187264 AGGGAAATGCTGGATGCTGCAGG + Intergenic
992255756 5:74919459-74919481 GGGGAAATGAAGGAGGGCCCGGG + Intergenic
992791856 5:80220841-80220863 GGGGAGATGGAGGAGCCTGCTGG + Intronic
993404463 5:87494379-87494401 AGGGAAAGGAAGGAGCATCCAGG - Intergenic
993803414 5:92374471-92374493 AGGGAATAAAAGCAGGCTGCAGG - Intergenic
994322939 5:98414284-98414306 ATGGAAGAGCAGGAGGCTGCAGG - Intergenic
994560697 5:101367180-101367202 AAGGAAAAGAAGGAGGTTTCTGG - Intergenic
995347091 5:111133455-111133477 AGGGGAATGAGGGAGGCAGCTGG + Intergenic
997175853 5:131776783-131776805 AGGCAAATGAAGTAGGTTCCAGG + Intronic
997299448 5:132791912-132791934 AGGCAAATGAATGAAGTTGCTGG + Intronic
997441094 5:133909060-133909082 GGGGCAGTGAAGGAGGTTGCAGG + Intergenic
998516886 5:142763951-142763973 AGGGAAATGAAGTAAGCAGAAGG + Intergenic
998534114 5:142913418-142913440 AAGGAAAGGAAGGAGGCAGGGGG - Intronic
998871156 5:146553559-146553581 AGGGAAATGAGGGAAGATTCTGG - Intergenic
999231632 5:150065369-150065391 AGGGAAATGGCTGAGGCAGCAGG - Intronic
999232950 5:150072984-150073006 AGGAAAATGAATGAGGCTGAGGG + Intronic
999242844 5:150137548-150137570 CAGGAAATGGAGGAGGCTGTGGG + Intronic
999386307 5:151156661-151156683 AGGGAAAGGAAGGAGGAGGCAGG + Intronic
999586417 5:153094589-153094611 AGGGGAAAGAAGGAGGCAGCGGG + Intergenic
999633866 5:153599939-153599961 GGGGAAAGGAAGAAGGCTGTCGG + Intronic
999687224 5:154113922-154113944 AGGGTGATGAAGGAGCCAGCTGG + Intronic
999754603 5:154655026-154655048 AGGGGAATGAAGGAATCTTCCGG - Intergenic
999906233 5:156143706-156143728 AAAGAAAAGAATGAGGCTGCAGG - Intronic
1000917085 5:167095443-167095465 ACGGAAATGTAGGAGGCGGCGGG + Intergenic
1001084633 5:168691738-168691760 TGGGAGAAGAAGGAGGCAGCTGG + Intronic
1001230622 5:169984269-169984291 GTGGAAATGAAGAAGGCTCCTGG - Intronic
1001700696 5:173704812-173704834 GAGGCAATGAAGGAGGCTGGAGG + Intergenic
1001967274 5:175919971-175919993 AGGGAAATGAAGGGGTCAGTGGG - Intronic
1001997076 5:176170782-176170804 AGGGAAATGTGGGTGACTGCAGG + Intergenic
1002323302 5:178388527-178388549 TGGGAGAGGAAGGAGGCTGTGGG + Intronic
1002349422 5:178573061-178573083 AGGGAACTGAACGAGGCAGGAGG + Intronic
1002616947 5:180461825-180461847 GTGGAAATGAAGGATGCTCCAGG + Intergenic
1002790621 6:435160-435182 AGGGAATAAAAGCAGGCTGCAGG - Intergenic
1002949875 6:1799240-1799262 GGGGAAAAGAAGGAGGGAGCGGG - Intronic
1003257245 6:4485257-4485279 AGGGAGATGAAAGAGGCTTGAGG - Intergenic
1004015468 6:11728148-11728170 AATGGAATGAAGGAGGCTGAAGG - Intronic
1006451849 6:34109939-34109961 AGGGAAGGGCAGCAGGCTGCTGG - Intronic
1006786670 6:36672366-36672388 CGGGAACTGATGGAGGCTGGAGG - Intergenic
1006871591 6:37256993-37257015 AGGGAAATTAAGGATGTTGGTGG + Intronic
1007111280 6:39314583-39314605 AGGGAGAAGGAGGAAGCTGCTGG + Intergenic
1007249700 6:40487459-40487481 AGTGAGATGAGGAAGGCTGCGGG - Intronic
1007497239 6:42268534-42268556 TGTGATAAGAAGGAGGCTGCAGG + Exonic
1007945869 6:45826653-45826675 AGAGCAATGAAGGACACTGCAGG - Intergenic
1008213289 6:48752711-48752733 ACTGAAATGGAGGAGGCTGTGGG - Intergenic
1008632091 6:53371805-53371827 AGGGAAATGAATGAGGCGTGGGG + Intergenic
1009320346 6:62280340-62280362 AGGGAAATGAAGGATGATGAGGG + Intronic
1011913317 6:92469461-92469483 AGGAAATTGAAGCAGACTGCTGG + Intergenic
1011948116 6:92932999-92933021 AGGGAAATGAGGGAAGCTTCTGG + Intergenic
1012145161 6:95670987-95671009 AGGGAATAAAAGCAGGCTGCAGG + Intergenic
1012466469 6:99521631-99521653 AGAGAAATGAAGGTGGTTACCGG + Intronic
1012734159 6:102917949-102917971 AGGGAAAGGAAGGAGGGAGGAGG - Intergenic
1012883730 6:104821037-104821059 AGGGACATGAATGGAGCTGCAGG + Intronic
1013507608 6:110815390-110815412 AAGGAAATGAAGGAGGGAGGCGG - Intronic
1013811304 6:114047933-114047955 TGGGAAAAGACGGAGGCTCCTGG + Intergenic
1015605065 6:134945785-134945807 AGGGAAATGAAGGAGGGGTGTGG - Intronic
1017184818 6:151589990-151590012 TGGGCAATGTAGGAGGCAGCTGG - Intronic
1017433232 6:154391788-154391810 TGGGAAAGGAAGGAAGCTACAGG - Exonic
1017670680 6:156766746-156766768 AGGGAAGTAAAGGAAGCTGCTGG - Intergenic
1018226702 6:161636012-161636034 AGAGGACTGAAGGAGGTTGCAGG - Intronic
1018443808 6:163836597-163836619 AGGTGAATGGAGGAGGCTGAGGG + Intergenic
1018551216 6:165001130-165001152 AGGGAATAAAAGCAGGCTGCCGG - Intergenic
1018841879 6:167523381-167523403 AGGCAATTGAAGGTGGCTGAAGG + Intergenic
1018864798 6:167737905-167737927 TGGCAAATGAAGGGGGCAGCAGG - Intergenic
1019507006 7:1396502-1396524 AGGGGCATGAGGGAGCCTGCAGG + Intergenic
1020105374 7:5420214-5420236 CGGGAAATGGTGGAGGCCGCGGG + Intronic
1021276994 7:18663784-18663806 AGCCAGGTGAAGGAGGCTGCAGG - Intronic
1022066268 7:26861169-26861191 AAACAAATGAAGGAGGCTGGAGG + Intronic
1022343218 7:29487698-29487720 AGGGAAAGGAAGGAGGGAGGGGG - Intronic
1022980002 7:35595572-35595594 AGAGAAAGGAAGGAGGGAGCTGG + Intergenic
1023113446 7:36837728-36837750 AGGGAGAAGAAGGAAGCTCCTGG - Intergenic
1023228335 7:37996417-37996439 AGGAGAATGAAGGAGACTTCCGG + Intronic
1024787393 7:52923922-52923944 AGAGAAATGAAGAAACCTGCTGG - Intergenic
1024919662 7:54544462-54544484 AGGCAAAGGAAGGGGGCTGGGGG + Intronic
1024941583 7:54768469-54768491 AGAAAAATGAAGGAGCCAGCAGG + Intergenic
1026628572 7:72018093-72018115 AAGAAAATGAAAAAGGCTGCTGG + Intronic
1027390439 7:77697569-77697591 AGGGAAATGAGGTAGCGTGCAGG + Intronic
1028755421 7:94428037-94428059 AGGGAAATGAGGTTGGGTGCTGG - Intronic
1029881813 7:103821168-103821190 AGGAAAATGAAGGAGGTTTATGG + Intronic
1030010264 7:105158643-105158665 TGGGAAATGATGGAGCCTGCGGG + Intronic
1030182307 7:106722696-106722718 AGGGAAAAGAAGCAGGATGAGGG - Intergenic
1030516158 7:110540982-110541004 AGGGAAATTAAGGAGGTAGATGG - Intergenic
1031803885 7:126283669-126283691 AAGGAAATGAAGGGGGAGGCAGG - Intergenic
1032080132 7:128854578-128854600 AGTGAACTGAAAGGGGCTGCCGG - Exonic
1032301621 7:130692547-130692569 AGGGAAATAGATGAGGCTGGAGG - Intergenic
1033361548 7:140641450-140641472 AGGGAAATGCCGTGGGCTGCGGG + Intronic
1033894051 7:146050719-146050741 AGGGAAAAAAGGGAGGGTGCTGG + Intergenic
1034529052 7:151684110-151684132 AGGCAACTGCAGGAGGCTGGGGG + Intronic
1034534589 7:151719075-151719097 AGGGAAATGGAGGGGACTGAAGG + Intronic
1034868094 7:154657814-154657836 AGGGAAAGGAAAGAGACTGGTGG + Intronic
1035548171 8:499718-499740 AGGGAAATGTGGGAGACTTCAGG - Intronic
1035588705 8:796840-796862 AGGGAAAGGAAGGTGGCCCCAGG - Intergenic
1035983317 8:4397427-4397449 ATGGAAATGAAGAAAGCTTCGGG + Intronic
1035995518 8:4541866-4541888 AGGGAAGGGATGGAGGCTGGAGG + Intronic
1037022329 8:13988966-13988988 AGGGTATTGAGGGAGGCTACTGG - Intergenic
1037775928 8:21835697-21835719 AGGGGAATGAGGGATGCTTCAGG - Intergenic
1037882836 8:22581252-22581274 AGGGACATGCAGGAGGGTGCAGG + Intronic
1038099010 8:24351055-24351077 AAGGCAATGAAAGAGGCTGACGG + Intronic
1038259566 8:25981102-25981124 AGGGTGAAGAAGGAGGCTTCGGG - Intronic
1038452619 8:27649632-27649654 AGGTAAATAAAAGGGGCTGCTGG + Intronic
1039460420 8:37738912-37738934 AGAAAAATGAAAGAGCCTGCAGG + Intronic
1039897945 8:41729732-41729754 CGGGAACAGATGGAGGCTGCTGG - Intronic
1041219391 8:55633782-55633804 AGGGCAATGAAGGAGGTGGTGGG - Intergenic
1042317803 8:67442989-67443011 AGGGAAAAGAAGGATGGGGCTGG - Intronic
1044061193 8:87638038-87638060 CAGGATATGAAGGAGGCTACTGG - Intergenic
1044500119 8:92944708-92944730 AGGGAAAAGGAGGAGGGTACAGG + Intronic
1044872454 8:96632659-96632681 ACAGATATGAAGAAGGCTGCAGG + Intergenic
1046497886 8:115037435-115037457 AGGGAATAAAAGCAGGCTGCCGG + Intergenic
1048054393 8:130849514-130849536 AGGGTAATGCAGGAAGCTGCAGG + Intronic
1048133137 8:131719573-131719595 TGTGAAATGAAGTAGGATGCTGG + Intergenic
1048941353 8:139403344-139403366 TGGGAAAAGGAGAAGGCTGCAGG - Intergenic
1048994929 8:139788409-139788431 AGGGCAAGGATGGCGGCTGCTGG + Intronic
1049194413 8:141307818-141307840 GGGGGAATGAGGGAGGCTGCAGG + Intronic
1049307058 8:141909646-141909668 GGGGTGATGAGGGAGGCTGCAGG + Intergenic
1049803128 8:144527310-144527332 AGGGAAAGGCGGGAGGCCGCGGG - Exonic
1050256320 9:3795866-3795888 AGTGAAATCAAGTAGGCTGATGG + Intergenic
1050698169 9:8302780-8302802 AGGGAGATGAAGGAGGTGCCAGG - Intergenic
1051553714 9:18359266-18359288 ATGGAAAAGATGGAGGCTGAAGG - Intergenic
1051612527 9:18975187-18975209 TGGGGAAGCAAGGAGGCTGCAGG + Intronic
1051660995 9:19426954-19426976 AGAGAAATGCTGCAGGCTGCTGG - Intronic
1052431012 9:28366546-28366568 AGGGAAATGAAAAAGAATGCTGG + Intronic
1052820184 9:33132268-33132290 AGGGAAAGCAGGGAGGCAGCTGG + Intronic
1053023906 9:34715109-34715131 AGGGAAATGAAGGAAGCAGTAGG + Intergenic
1053258446 9:36639807-36639829 AGGTACAGGCAGGAGGCTGCGGG + Intronic
1053276660 9:36788331-36788353 AGGGGAATGAACGGGGCTACAGG + Intergenic
1054821910 9:69531317-69531339 AGGGTGATGAAGGAGGGTGATGG - Intronic
1055594615 9:77852381-77852403 AGAGCAATGAAGAAGGGTGCTGG + Intronic
1056065499 9:82929430-82929452 TGGGAAATAAAGTAGGCAGCTGG + Intergenic
1056259362 9:84832716-84832738 AGTGAAATGAAGGAGAAGGCAGG - Intronic
1056710953 9:88991511-88991533 AGGGACCAGAAGGCGGCTGCAGG + Exonic
1058309614 9:103484476-103484498 AGGGAATAAAAGCAGGCTGCTGG + Intergenic
1058560205 9:106220430-106220452 AGGGACATGAGGTTGGCTGCAGG + Intergenic
1058574948 9:106390850-106390872 AGATAAATGAAGGAGGCTTCAGG + Intergenic
1058988153 9:110228653-110228675 AGGGAAGGGAAAGAGGCTACAGG + Intergenic
1059534504 9:115068918-115068940 AGGGATTTGTGGGAGGCTGCAGG - Intronic
1059826707 9:118038015-118038037 AGGGATCTGAAAGAGGATGCAGG + Intergenic
1059970192 9:119659402-119659424 AGAGAAATGTAGGAGGGTTCTGG + Intergenic
1060029484 9:120202043-120202065 GGGAAAAGGAAGGAGGCTTCAGG + Intergenic
1060320448 9:122554103-122554125 AGAGACATGAAGGAGGCTTTGGG + Exonic
1060496068 9:124119384-124119406 AGGGTAATGATGGAGGCAGCAGG - Intergenic
1060519997 9:124288887-124288909 GGGGCAATGAAGGGGGCTGCAGG - Intronic
1060530037 9:124342613-124342635 AGGGAAATGTGGCAAGCTGCAGG - Intronic
1060891274 9:127190107-127190129 AGGGAAATGAGGCAGGATGGGGG - Intronic
1061035758 9:128113602-128113624 GGGGGAATGAAGGAGGCAGATGG + Intergenic
1061617814 9:131791864-131791886 AGGGAGAGGCAGGAGCCTGCGGG + Intergenic
1061859123 9:133459161-133459183 AGGGAAAGGAAGGAACCTGAGGG + Exonic
1062088651 9:134662378-134662400 GTGGAAAAGAAGGAGGCAGCCGG - Intronic
1062439763 9:136564457-136564479 GGGGCAAGGCAGGAGGCTGCGGG - Intergenic
1062442985 9:136579367-136579389 TGGGAACTGAAGGAGGCACCTGG - Intergenic
1185569560 X:1123205-1123227 AAGGAAATCCAGAAGGCTGCCGG - Intergenic
1185755163 X:2647482-2647504 AGGGAAATGAAGGTTGCAGATGG - Intergenic
1186288700 X:8072854-8072876 AATGAAAAGAAGGAGGCTGGGGG + Intergenic
1187250284 X:17591851-17591873 AGGGAAATGAGGGAGCCTGCTGG - Intronic
1187393846 X:18903592-18903614 AATGAAATGAAGGTGGCAGCTGG + Intronic
1187507536 X:19888762-19888784 CTGGAAATGGAGGAGGCTGAGGG + Intergenic
1188017063 X:25117432-25117454 AGGGACATGGATGAGGCTGGAGG - Intergenic
1188080548 X:25834227-25834249 AGGGTAAATAAGGAGGCTTCTGG + Intergenic
1189092897 X:38106023-38106045 AGGGAAATCATGGAAGCTGTGGG + Intronic
1189415167 X:40806344-40806366 TGGCAAATGGAGGAGGCTACGGG + Intergenic
1190232027 X:48589733-48589755 AGGGAAATAAAGCAGGGTGGGGG + Intergenic
1190363879 X:49673611-49673633 AGAGATAAGAAGGAGACTGCTGG - Intergenic
1190892806 X:54586134-54586156 AAGGAAATGAAGCATCCTGCTGG + Intergenic
1191796756 X:65029488-65029510 AGGAAACTGAAGGAGGCTCCAGG + Intronic
1192580005 X:72273171-72273193 ATGTAAATGCAGGTGGCTGCTGG - Intronic
1193350365 X:80456795-80456817 AGGGAAATATAGCAGGCTGCAGG + Intergenic
1193505912 X:82344743-82344765 ACTGAAATGCTGGAGGCTGCTGG - Intergenic
1193852513 X:86557003-86557025 TGAGAACTGAAGGGGGCTGCTGG + Intronic
1194654744 X:96558839-96558861 ACTGAGATGAAGAAGGCTGCAGG - Intergenic
1196688988 X:118538878-118538900 AGGGATATGATGGAGACTGCAGG + Intronic
1197658361 X:129142685-129142707 AGAGGAATGAAGGAGACTACGGG + Intergenic
1197955855 X:131946931-131946953 AGGGACATGAATGAAGCTGGAGG + Intergenic
1198468245 X:136922308-136922330 AGGGAATAAAAGCAGGCTGCCGG + Intergenic
1198493335 X:137165777-137165799 AGAGAAATGAAGGAGTTTGGAGG + Intergenic
1198683237 X:139203815-139203837 GGGGAAGTGGAGGAGGCTGGAGG + Intronic
1198737694 X:139805647-139805669 AGGTAAAGGGAAGAGGCTGCTGG + Intronic
1202024783 Y:20510063-20510085 AAGGAAAAGAAGGAGACTGCAGG + Intergenic