ID: 1103863809

View in Genome Browser
Species Human (GRCh38)
Location 12:124035307-124035329
Sequence TGCTCTCCCTGTTCATGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103863809_1103863811 13 Left 1103863809 12:124035307-124035329 CCTTCTCATGAACAGGGAGAGCA 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1103863811 12:124035343-124035365 ACACCCCTAAGTTCATCACGTGG 0: 1
1: 0
2: 1
3: 1
4: 37
1103863809_1103863812 14 Left 1103863809 12:124035307-124035329 CCTTCTCATGAACAGGGAGAGCA 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1103863812 12:124035344-124035366 CACCCCTAAGTTCATCACGTGGG 0: 1
1: 0
2: 0
3: 0
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103863809 Original CRISPR TGCTCTCCCTGTTCATGAGA AGG (reversed) Intronic
901336328 1:8452182-8452204 TGATCTCCCTGTCCAAGAGCAGG + Intronic
901663819 1:10815323-10815345 GCCTCTGCCTGTTCTTGAGAGGG - Intergenic
907930124 1:58991331-58991353 TACTCTCCCTGCTCCAGAGATGG + Intergenic
909053202 1:70792639-70792661 TGCACTCCATCTTGATGAGATGG - Intergenic
909097563 1:71307139-71307161 TTCTCTTTCTGTTAATGAGAAGG + Intergenic
910837446 1:91530031-91530053 TGATCTCTCTGTCCATTAGATGG + Intergenic
915007926 1:152657312-152657334 AGCTTTACCTGTGCATGAGAAGG - Intergenic
915317616 1:155038117-155038139 TCCTCTCCCTGTTCTTCACATGG - Intronic
915635177 1:157181467-157181489 TGCTTCCCCTTTTCAGGAGAGGG + Intergenic
918258750 1:182774738-182774760 TCCTCTCGCTGTTCATGGGAAGG + Intergenic
922324134 1:224512773-224512795 TGCCCTCCCTGTTCATGTGTGGG + Intronic
924130170 1:240899172-240899194 TGTTGTCTCTGTACATGAGACGG + Intronic
1072058662 10:91787346-91787368 TTCTCTCTCTGTGCAAGAGATGG - Intergenic
1072949101 10:99836803-99836825 TGCTCACCCTGTTCACAAGACGG - Intronic
1073161456 10:101400553-101400575 TCCTCTCCCTATCAATGAGAAGG + Intronic
1074187114 10:111106969-111106991 TGCCCTTTCTGGTCATGAGATGG - Intergenic
1076195044 10:128511755-128511777 TGCTCTGGGTGTTCACGAGAGGG + Intergenic
1076713319 10:132350952-132350974 CCCTCTCCCTGCCCATGAGAGGG - Intronic
1083052951 11:59793203-59793225 TGGCCTCCCTGCTCACGAGAGGG - Intronic
1083675453 11:64322562-64322584 CCCTCTCCCTGTCCATCAGATGG - Intergenic
1085301841 11:75463175-75463197 TGCTCTCCCTATTCTGGGGACGG + Intronic
1085680084 11:78565093-78565115 TTCTCTCCCTGTGGATGGGAGGG - Intronic
1087513325 11:99126468-99126490 TCCTCTACCTATTCAGGAGAAGG - Intronic
1088423356 11:109673136-109673158 TGCTGACCCTGTTCATCAGTTGG - Intergenic
1090372189 11:126264095-126264117 AGCGCTTCCTGTTCCTGAGAGGG - Intronic
1090826336 11:130389296-130389318 TGCTCTCACTGTCCATGGGTTGG + Intergenic
1101239138 12:102820675-102820697 TGGTCTCCCTGTTTATGAATTGG - Intergenic
1103243984 12:119439543-119439565 GGCTCTCTCTGTTCATGACTTGG - Intronic
1103863809 12:124035307-124035329 TGCTCTCCCTGTTCATGAGAAGG - Intronic
1104592860 12:130098643-130098665 TGCCCTTCCTGTTTATGAAATGG - Intergenic
1109813479 13:67547022-67547044 GGCTCTTCCTGTTCCTGAGGAGG + Intergenic
1113168030 13:107465640-107465662 TGCTATGGCTGTTGATGAGATGG + Intronic
1114929794 14:27452513-27452535 TGCTATCCCTGACCTTGAGAGGG + Intergenic
1115723911 14:36192432-36192454 TTCTCTCCCTGTTCAGTAAATGG - Intergenic
1116586912 14:46717660-46717682 TGCTCTGGTTGTTAATGAGAAGG - Intergenic
1120803484 14:88719520-88719542 CTCTCTCACTATTCATGAGAAGG + Intronic
1121229726 14:92348193-92348215 TCATTTCCCTGTTTATGAGATGG + Intronic
1122882080 14:104694757-104694779 TGTTCTCCCTGCTCCTGGGAAGG + Intronic
1126783668 15:52159471-52159493 TCCTCTCCCTGGACATGGGAAGG - Intronic
1128955460 15:71937822-71937844 TTCTCACCCTGGTCATCAGATGG - Intronic
1129072326 15:72961666-72961688 TGCTTTCCCTTTGCAGGAGACGG + Intergenic
1132219675 15:100096035-100096057 TTCTCTGCCTGTGCATCAGAAGG + Intronic
1132539131 16:500090-500112 TTCTGTCCCTGTCCATGAGATGG + Intronic
1132906729 16:2286288-2286310 TGCCGTCCCTGTTCCTCAGATGG - Intronic
1133284828 16:4685847-4685869 TGCTGTCCCTGTAGATGGGAGGG + Intronic
1134074444 16:11280810-11280832 TTCTCTCCTTGTTCTTGAGAGGG - Intronic
1135076232 16:19396132-19396154 TGCACCCCCAGTTCATCAGATGG - Intergenic
1135532898 16:23269798-23269820 GGCTCGCCCTGTTCATGCTAAGG - Intergenic
1135763954 16:25160837-25160859 TGCGCACCATGTGCATGAGAGGG + Intronic
1137570022 16:49559156-49559178 CGCTTTCTCTGTCCATGAGATGG - Intronic
1138591715 16:58002872-58002894 TATTCTCCCTGTTCACGAGGAGG + Intronic
1139007070 16:62586035-62586057 GGCTCTGACTTTTCATGAGAAGG + Intergenic
1139740619 16:69032183-69032205 GGCTTTCCCTGTGAATGAGATGG + Intronic
1140220926 16:73043289-73043311 CCCTCTCCCTGTCCATCAGAGGG - Intronic
1140973838 16:80040426-80040448 TCCTCTTCCTGTTCATCATATGG + Intergenic
1142127113 16:88415649-88415671 CGCTCTCCCTGCTCCTGAGCAGG - Intergenic
1142941112 17:3380413-3380435 TGCTTTCCCTGTCTATGACATGG + Intergenic
1144376778 17:14650721-14650743 ACCTCTCCCTGGTCCTGAGATGG - Intergenic
1145956504 17:28858471-28858493 TGCTCACCTTGTTCATGACCAGG - Exonic
1146058902 17:29594257-29594279 TCCACTCCCTGTTCCTGAGCTGG - Intronic
1149287073 17:55176824-55176846 CTCTCTCCCTCTTCTTGAGATGG + Intergenic
1149515625 17:57278828-57278850 TGCTGTCCCTCCTGATGAGATGG + Intronic
1149681959 17:58513557-58513579 TGCTCTGCCTGCTAATCAGAGGG + Intronic
1150849537 17:68691449-68691471 TGCTCTTCATGGTCATAAGATGG - Intergenic
1152279744 17:79378413-79378435 TCCTCTACCTGTTCTTGGGATGG - Intronic
1152467172 17:80473001-80473023 TGCTCTCCCAGTACAGGTGAGGG + Intronic
1157481423 18:48057071-48057093 TGATCTTCCTGTTCATGGGTTGG - Intronic
1157846436 18:51008016-51008038 TGCTCTCTCTCTTCATGTGCTGG + Intronic
1158260896 18:55604730-55604752 TGCTCTCCCAGGTGATGACATGG - Intronic
1158414922 18:57241888-57241910 TGCTCTCCCTCCTCATAGGAGGG - Intergenic
1161647456 19:5462318-5462340 TTCTCTGCCTGTCCATGAAAAGG - Intergenic
1162441461 19:10694983-10695005 TGGTCTCCCTGAGAATGAGAAGG - Intergenic
1162817191 19:13203117-13203139 TGCTCTCCCTGGTAAGGAGACGG - Intergenic
1163233313 19:16017866-16017888 TGCCCTGACTGTTCATGGGAGGG + Intergenic
1163499387 19:17666813-17666835 TTCTCTCCCTCTCTATGAGAAGG + Intronic
1166074632 19:40406658-40406680 TGCTGTCACTGTTACTGAGATGG - Intronic
1166161550 19:40957388-40957410 TGCACCCCCAGTTCATCAGATGG + Intergenic
925099794 2:1235283-1235305 GGCACACCCTATTCATGAGAGGG + Intronic
925099869 2:1235489-1235511 GGCACACCCTATTCATGAGAGGG + Intronic
925405381 2:3602623-3602645 GGGTCTCCCTGCTCTTGAGACGG - Intronic
925875320 2:8306635-8306657 TTCTCTCCATGTTCCAGAGAAGG + Intergenic
927485137 2:23483666-23483688 TCCTCTCCTGGATCATGAGAGGG + Intronic
927490641 2:23518829-23518851 TGGTCACCCAGTTCATGATATGG - Intronic
928338896 2:30424361-30424383 TGCCATCCCTGTTCATCTGAAGG + Intergenic
928658396 2:33476457-33476479 CGCTCTGCATGCTCATGAGATGG + Exonic
931229808 2:60364769-60364791 AGCTGTCCCTCTACATGAGAGGG + Intergenic
934042303 2:88137869-88137891 CTCTCTCCCTCTTCCTGAGAAGG + Intergenic
937207303 2:120245028-120245050 GGCTCTCCCTCTTCCTGAGTGGG - Intronic
938856340 2:135315599-135315621 TGCTCTTCCTTTTAATGATAAGG + Intronic
939355055 2:141090668-141090690 TGATCTACATGTCCATGAGAAGG + Intronic
1171080222 20:22174113-22174135 TGCTCTACCCGTCCATGAGCAGG + Intergenic
1173307862 20:41867739-41867761 TTCTCTCCCTGTTCAATAAATGG - Intergenic
1176064847 20:63189010-63189032 TGCTCTCCTTGGTGATGACAAGG + Intergenic
1178805443 21:35835569-35835591 TTCTCTCCCTCTTCTTGAGCTGG - Intronic
1178997406 21:37416116-37416138 TGCTTTCCCTGTTGATGAAATGG + Intronic
1179078342 21:38144942-38144964 TGCTCTACATGTCCCTGAGAAGG + Intronic
1180706855 22:17815564-17815586 CACTCTCCCTGTCCCTGAGAAGG + Intronic
1182238690 22:28897261-28897283 TGCTGTCCTTGTTCCTGAGTGGG + Intronic
1182619629 22:31611762-31611784 TGCTCTGCCTGTGCAGGAGCTGG - Exonic
1184654163 22:45932770-45932792 TGTTCTTCCTGTTGCTGAGATGG - Intronic
1184857168 22:47152628-47152650 GGCTCTCCTTGCTTATGAGATGG + Intronic
952879650 3:37975550-37975572 TCCTCTCCGTGTACATAAGATGG - Intronic
956096838 3:65725312-65725334 TACTCTCCCTGTTTTTCAGATGG - Intronic
957291721 3:78285590-78285612 TGCTCTCCCTGAAAAGGAGAAGG + Intergenic
958121458 3:89295152-89295174 TGCTCTCCCAGTGCATATGAAGG + Intronic
959899955 3:111649773-111649795 TGATCTGCCTTATCATGAGATGG + Exonic
960056615 3:113280276-113280298 TGATCTCCCTGGACATGTGAGGG - Intronic
962648453 3:137463860-137463882 TGCTCTCCCTTTAGATGGGAGGG - Intergenic
969585135 4:8087270-8087292 GGCTCTGCCGGATCATGAGATGG - Intronic
969700826 4:8766633-8766655 TGCCCTTCCTGTTTGTGAGAGGG - Intergenic
983468010 4:168119406-168119428 TGCTCCACCTGTATATGAGAAGG - Intronic
990725085 5:58744494-58744516 TGCTGTTCATGCTCATGAGAAGG - Intronic
991621383 5:68548945-68548967 TGCTGTTACTGTTCATGAAAAGG + Intergenic
996621098 5:125504180-125504202 TCCTCTCCCTGTGTATGCGATGG + Intergenic
997720804 5:136077094-136077116 TGCTCTGCCTGGTCCTGAAATGG + Intergenic
999249442 5:150173409-150173431 GTCTTTCCCTGTTCATGACATGG + Intronic
999783910 5:154874138-154874160 TGCTCTGCCTGTTAAAGAGAAGG + Intronic
999799722 5:155021881-155021903 TGCTATCACTGATCATGTGAGGG + Intergenic
1000349880 5:160344939-160344961 TTCTCTCCCTGCTCCAGAGACGG - Intronic
1005733448 6:28721436-28721458 TGCGCCCCCTGTTCATGTGATGG - Intergenic
1006523602 6:34586425-34586447 TTCCCACCCTGTTCCTGAGAAGG - Intergenic
1007786894 6:44285759-44285781 TGCTCTCCCAGTTCACCAGTTGG - Intronic
1008222965 6:48876799-48876821 TGCACCCCCAGTTCATCAGATGG + Intergenic
1011826655 6:91314460-91314482 TTCTTTCCCTTTTCATGAGAAGG - Intergenic
1012385729 6:98679868-98679890 TGTTGTCCCTGTTCTTGAGCAGG - Intergenic
1013324610 6:109032311-109032333 TGCTCCCCCTGTACATGAAAAGG + Intronic
1013746877 6:113356310-113356332 TACTCTCCCTGTTGATGGGGAGG + Intergenic
1016865104 6:148758628-148758650 TGCTCTGACTGTCAATGAGAGGG - Intronic
1017272067 6:152518698-152518720 TGCTTTCTCTGATAATGAGAAGG - Intronic
1017621217 6:156300512-156300534 TTCTTTACCTGTTGATGAGATGG - Intergenic
1021869630 7:24991656-24991678 TGCTCAGCCTGCTCTTGAGAAGG - Intergenic
1022603062 7:31779896-31779918 TGTTCTTCCTGGACATGAGAGGG - Intronic
1023089656 7:36605811-36605833 TCCTTTCCCTGTTCATGAACAGG - Intronic
1028821253 7:95214426-95214448 GCCTCTCCCTGCTCATAAGATGG + Intronic
1030080622 7:105774658-105774680 TGCTCTTCTTATTAATGAGAAGG - Intronic
1032616865 7:133482332-133482354 TGCTCTGCCTGTTCACTAGAAGG - Intronic
1034891184 7:154840490-154840512 TGCTCACTCTGTTGATGAAAAGG + Intronic
1036494970 8:9262030-9262052 TCCTCTCCCTCCACATGAGAAGG + Intergenic
1037947006 8:22995997-22996019 TGCTCTCCCTGTGGCTGTGAAGG - Intronic
1038777486 8:30544139-30544161 TTCTCTCCCTTTTCCTCAGAGGG + Intronic
1039341510 8:36655555-36655577 CTCTCTCCTTGATCATGAGATGG + Intergenic
1039908459 8:41804553-41804575 TTCTCTCCCTGGCTATGAGAGGG + Intronic
1041242041 8:55856456-55856478 TGTTCTCTCTGTTCATGTGGTGG - Intergenic
1041446427 8:57955743-57955765 TTCTCTCCCTGTCCATGAGGTGG - Intergenic
1042402929 8:68370441-68370463 TGCCCTCCCTGGTCTTCAGAAGG + Intronic
1042797775 8:72683606-72683628 TGCTCTCCCTGACCAAGTGATGG - Intronic
1044608630 8:94070189-94070211 TCCTCTCTCTGTCCATGAGATGG - Intergenic
1044773475 8:95662441-95662463 TGCTCTTCCTGCCCCTGAGAAGG - Intergenic
1048678696 8:136814192-136814214 TTCTCTCCCTCTTCTTGAGCTGG - Intergenic
1049022438 8:139966663-139966685 CTCTCTCCCTGCTCTTGAGAAGG - Intronic
1049571101 8:143370691-143370713 TACTCACCCTGTTCATCAGACGG - Intronic
1053099059 9:35354083-35354105 TGCTATACCTGTTCAAAAGAGGG + Intronic
1058589313 9:106545545-106545567 TTCTCTCCAGGTTCATTAGATGG - Intergenic
1059733604 9:117080121-117080143 TACTCTGCCTGTTCCTGAAAGGG - Intronic
1186582203 X:10831924-10831946 TTCTCACCCTGCTGATGAGATGG - Intronic
1187096279 X:16151781-16151803 TGCTCTTTCTGAGCATGAGAGGG + Intronic
1193617008 X:83701384-83701406 TTCTCTCCATGAACATGAGATGG + Intergenic
1200961265 Y:8998202-8998224 TGCACCCCCAGTTCATCAGATGG + Intergenic
1201851682 Y:18489926-18489948 TGCTCATCCTGTTCAAGAGCAGG - Intergenic
1201881638 Y:18830454-18830476 TGCTCATCCTGTTCAAGAGCAGG + Intergenic