ID: 1103865990

View in Genome Browser
Species Human (GRCh38)
Location 12:124052567-124052589
Sequence CACGTTCATCTGGGGTGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103865990_1103866001 14 Left 1103865990 12:124052567-124052589 CCCCAACACCCCAGATGAACGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865990_1103866004 21 Left 1103865990 12:124052567-124052589 CCCCAACACCCCAGATGAACGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1103866004 12:124052611-124052633 GGCGCTACCATGATGGATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1103865990_1103865998 0 Left 1103865990 12:124052567-124052589 CCCCAACACCCCAGATGAACGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1103865998 12:124052590-124052612 TCAAAGGACGGCTCCCAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 108
1103865990_1103866005 22 Left 1103865990 12:124052567-124052589 CCCCAACACCCCAGATGAACGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1103866005 12:124052612-124052634 GCGCTACCATGATGGATTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103865990 Original CRISPR CACGTTCATCTGGGGTGTTG GGG (reversed) Intronic
900359959 1:2283682-2283704 CAAGTGCATGTGGGGTGCTGGGG + Intronic
900491498 1:2951526-2951548 CAGGTTCTTCTTGGATGTTGAGG - Intergenic
903818579 1:26083347-26083369 CAGGTTCACCTGGGGTTTGGAGG - Intergenic
907324960 1:53631700-53631722 CACTTTTATATGGGGTGTTCAGG + Intronic
910229874 1:84974688-84974710 CAGGTTCATCTCGGCTATTGGGG + Intronic
919564963 1:199173031-199173053 CTCCTTCATTTGGTGTGTTGGGG - Intergenic
922248192 1:223820975-223820997 AAAGGTCATCTGGGCTGTTGTGG - Intronic
922404934 1:225302834-225302856 CTCTTTCCTCTGGGGTGGTGTGG - Intronic
1062948263 10:1476828-1476850 CACGGCCCTCTGGGGTGTGGAGG + Intronic
1063145834 10:3294464-3294486 CACGCCCGTGTGGGGTGTTGAGG + Intergenic
1076745744 10:132512680-132512702 CAGGTGGATCTGGGTTGTTGGGG - Intergenic
1077867245 11:6233399-6233421 CACGTGCATTTGGGTTGGTGGGG + Intronic
1080135661 11:28851251-28851273 CACTGTGATCTGGGGGGTTGGGG + Intergenic
1082963188 11:58938767-58938789 CACGTGCATATGGGGTGCAGAGG - Intronic
1083587906 11:63873727-63873749 CGCTTTAATCTGGGGTGTGGAGG - Intronic
1088113359 11:106287334-106287356 CAAGTTCAGCAGGGGTGCTGGGG + Intergenic
1089821383 11:121230327-121230349 CACTTTCCTCTGGCATGTTGAGG + Intergenic
1090650459 11:128801608-128801630 GATTTCCATCTGGGGTGTTGAGG - Intronic
1092985861 12:13845710-13845732 CATGTTCATCTGGATTTTTGTGG + Intronic
1097431698 12:59516526-59516548 AATGTTCACCTGGGGGGTTGGGG - Intergenic
1098002883 12:65963391-65963413 CACTTTCATCTGGGGTGGGGTGG + Exonic
1100979818 12:100155247-100155269 CATGTCCAGCTGGGGTATTGGGG - Intergenic
1103865990 12:124052567-124052589 CACGTTCATCTGGGGTGTTGGGG - Intronic
1114152521 14:20060271-20060293 TATGATCATCTTGGGTGTTGTGG - Exonic
1119788678 14:77330545-77330567 CAGGTTCATCTGGGCTGTGGTGG - Intronic
1120178521 14:81320121-81320143 CACTGTCACCTGGGGTGATGGGG + Intronic
1122082227 14:99273953-99273975 CACGTGGAGGTGGGGTGTTGGGG - Intergenic
1124689543 15:31810584-31810606 CACCTTCATCTGGGATTTTCGGG + Intronic
1129727895 15:77910870-77910892 CATGTCCAGCTGGGCTGTTGGGG - Intergenic
1129839985 15:78737990-78738012 CATGTCCAGCTGGGCTGTTGGGG + Intergenic
1129974777 15:79813034-79813056 CAGCTTCATGTGGAGTGTTGGGG + Intergenic
1130269785 15:82440179-82440201 CATGTCCAGCTGGGCTGTTGGGG + Intergenic
1130282419 15:82530630-82530652 CATGTCCAGCTGGGCTGTTGGGG + Intergenic
1130462124 15:84167480-84167502 CATGTCCAGCTGGGCTGTTGGGG + Intergenic
1130490553 15:84427293-84427315 CATGTCCAGCTGGGCTGTTGGGG - Intergenic
1130502141 15:84506063-84506085 CATGTCCAGCTGGGCTGTTGGGG - Intergenic
1130867296 15:87943771-87943793 CAGGCTCTTCTGGGATGTTGAGG - Intronic
1134452341 16:14371187-14371209 CAAGTTCAGCTGGGCTGGTGTGG + Intergenic
1137023343 16:35451644-35451666 CACCTTCAGCTGGGGTGGCGAGG - Intergenic
1138417885 16:56881610-56881632 AAAGTTTATCTGGGGTGCTGGGG + Intronic
1143691898 17:8574930-8574952 CACGTTCCTCAGTTGTGTTGGGG + Intronic
1144029284 17:11305030-11305052 CACATTGACCTGTGGTGTTGGGG + Intronic
1145738040 17:27247346-27247368 CACCTTCATCTGGGGAGTGGGGG + Intergenic
1147900057 17:43778284-43778306 CTCGCTCATTTGGGGTGTTTAGG + Intronic
1148804183 17:50256042-50256064 CACGTCCATGTGGGGAGGTGAGG - Intergenic
1150223189 17:63508611-63508633 CACTACCATCTGGGGTGATGCGG + Intronic
1150617950 17:66786439-66786461 CACTTTCATTTGGGGTGAAGGGG - Intronic
1152117421 17:78397151-78397173 CAGGTTTATATGAGGTGTTGGGG + Intronic
1153427407 18:4981478-4981500 CACCTTCAACTGAGGTGCTGAGG + Intergenic
1155024661 18:21930395-21930417 CAGGGTCATCTGTGGAGTTGCGG - Intergenic
1160873390 19:1286777-1286799 CAAGTTCATCTGGGGACCTGCGG - Intronic
1161943369 19:7419434-7419456 CAGGTGCACCTGGGGTGTGGGGG - Intronic
1163054293 19:14706605-14706627 CACGTTCATTTGGGGTGAGCAGG + Intronic
1164247435 19:23444579-23444601 TACGTTCACCTGAGGTTTTGGGG - Intergenic
1167285331 19:48596043-48596065 CAGGGTCAGCTGGGGTGTGGGGG + Intronic
943786206 2:191881260-191881282 CACGTTTCTCTGGCGTTTTGGGG + Intergenic
947333657 2:229057113-229057135 TACGTTCTTCTAGGTTGTTGTGG - Intronic
948164499 2:235850874-235850896 CAAGTCCATCTGGGGGATTGTGG + Intronic
948384748 2:237574597-237574619 CACCTGCTTCTGGGGGGTTGGGG - Exonic
1172026567 20:31952748-31952770 CACCTGCATCTGGGGAGTCGAGG + Intergenic
1173840731 20:46155098-46155120 CACTTTCAACTGGGTGGTTGGGG - Intergenic
1175085247 20:56452832-56452854 CAAGGTCATCTGGGCTGTTCTGG - Exonic
1180672432 22:17563667-17563689 GACGTTCATCTCAGTTGTTGAGG - Exonic
1181628925 22:24140274-24140296 CACGTCCATCTGTGCTGCTGTGG - Intronic
950084254 3:10246441-10246463 CACGTTCATCAGGGATGTATGGG + Intergenic
951387881 3:22064631-22064653 CAGGTTCATCTGTGGTGTTGTGG - Intronic
953295004 3:41706185-41706207 CTCATTCATCTGGGGAGCTGAGG - Intronic
957370781 3:79291578-79291600 CACGCTCCACTGGGGTGTTTTGG - Intronic
970502885 4:16696195-16696217 CACCATCATCTGGGCTGTAGCGG + Intronic
971805644 4:31355250-31355272 CACGTGCCTCTAGGGTGTTGGGG - Intergenic
975573734 4:75842861-75842883 AAAATTTATCTGGGGTGTTGTGG - Intergenic
979906318 4:126298485-126298507 CACATTTATCTGGGGTGGCGGGG + Intergenic
994665276 5:102697294-102697316 CAGGTGTATCTGGGGTGCTGTGG - Intergenic
997701510 5:135904076-135904098 CATCTTCATCTGGTGTGTAGGGG + Intergenic
998613533 5:143715071-143715093 TTCATTCCTCTGGGGTGTTGGGG + Intergenic
1000925649 5:167190738-167190760 CACTCTCATCTGCAGTGTTGAGG + Intergenic
1014198820 6:118586613-118586635 GACGTTCCTCTGGGCTGTTGGGG - Intronic
1015710177 6:136130648-136130670 CACCTTCCTCTGGGTAGTTGAGG + Intronic
1019854988 7:3596549-3596571 GACGTTCATCTGGAGTGAGGAGG - Intronic
1022969499 7:35504454-35504476 CAATTTCCTCTGGGCTGTTGAGG - Intergenic
1027878859 7:83806091-83806113 CAAATTCATTTGTGGTGTTGTGG + Intergenic
1029510794 7:100993710-100993732 CACTTGCATCTGGGCTGCTGTGG - Exonic
1029511288 7:100996959-100996981 CACTTGCATCTGGGCTGCTGTGG - Exonic
1029511514 7:100998381-100998403 CACTTGCATCTGGGCTGCTGTGG - Exonic
1029512012 7:101001630-101001652 CACTTGCATCTGGGCTGCTGTGG - Exonic
1032809878 7:135402191-135402213 CACTTGCATCTGGGATGTGGAGG - Intronic
1033423843 7:141225736-141225758 AACGTTCATCATGGGAGTTGAGG - Intronic
1034433947 7:151054251-151054273 GACGTTCACCAGGGATGTTGTGG + Exonic
1037809703 8:22080284-22080306 AACGTGCATGTGGGGTGCTGAGG + Intronic
1046488574 8:114917774-114917796 CATGTTCCTCTGGGCTGTTAGGG + Intergenic
1050202619 9:3161802-3161824 CACCTTCATTTGGGGATTTGGGG - Intergenic
1051252135 9:15170780-15170802 CACATACATGTGGGGAGTTGGGG + Exonic
1055435828 9:76291197-76291219 CACGTTCATCTTGGGTCCTAGGG - Intronic
1057037250 9:91820402-91820424 CACATTCATCTGGGGTGTCCTGG + Intronic
1061299204 9:129695099-129695121 CACTTGCCTGTGGGGTGTTGGGG - Intronic
1203783500 EBV:114484-114506 GACTTTCATCTGGGGCGTAGAGG + Intergenic
1185815079 X:3147006-3147028 CACGTTTCTGTGGGGTGGTGAGG + Intergenic
1190731762 X:53231277-53231299 AACCTTCATCAGGGATGTTGGGG + Intergenic
1191792083 X:64981775-64981797 GCCCTTCAGCTGGGGTGTTGAGG + Intronic
1192186246 X:68948582-68948604 GAGGCTCAGCTGGGGTGTTGAGG - Intergenic
1194478287 X:94388272-94388294 CGCATTCCACTGGGGTGTTGGGG - Intergenic
1195438212 X:104870023-104870045 CACATGCCTCTGGGATGTTGTGG + Intronic
1202193135 Y:22265628-22265650 CAAGTTCTCCTGGGATGTTGTGG + Intergenic