ID: 1103865991

View in Genome Browser
Species Human (GRCh38)
Location 12:124052568-124052590
Sequence ACACGTTCATCTGGGGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 81}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103865991_1103866001 13 Left 1103865991 12:124052568-124052590 CCCAACACCCCAGATGAACGTGT 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865991_1103865998 -1 Left 1103865991 12:124052568-124052590 CCCAACACCCCAGATGAACGTGT 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1103865998 12:124052590-124052612 TCAAAGGACGGCTCCCAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 108
1103865991_1103866004 20 Left 1103865991 12:124052568-124052590 CCCAACACCCCAGATGAACGTGT 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1103866004 12:124052611-124052633 GGCGCTACCATGATGGATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1103865991_1103866005 21 Left 1103865991 12:124052568-124052590 CCCAACACCCCAGATGAACGTGT 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1103866005 12:124052612-124052634 GCGCTACCATGATGGATTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103865991 Original CRISPR ACACGTTCATCTGGGGTGTT GGG (reversed) Intronic
902181645 1:14693726-14693748 ACCCGTTTTTCTTGGGTGTTTGG + Intronic
902504041 1:16928060-16928082 CCACGCTCATCTCGGGTCTTGGG - Intronic
910676837 1:89822964-89822986 AAAAGTTGATTTGGGGTGTTTGG + Intronic
913010394 1:114677553-114677575 ACAAGTTCCTCTGGGGTTCTAGG + Intronic
920296068 1:204957664-204957686 ACACGTTTGTCTTGGGTGATGGG - Exonic
1063229365 10:4048808-4048830 ACACTGACAGCTGGGGTGTTAGG - Intergenic
1064132455 10:12722084-12722106 ACACCATCACCTTGGGTGTTAGG + Intronic
1067429517 10:46233970-46233992 GCCTGTTCATCTTGGGTGTTTGG + Intergenic
1070799595 10:79237459-79237481 ACACCTTCCTCTGGGCTTTTAGG - Intronic
1071324287 10:84496626-84496648 ACAGGTTTTTCTGTGGTGTTAGG + Intronic
1080759526 11:35235101-35235123 ACAGCTTCATCTGGGATGATTGG + Intergenic
1083617569 11:64034212-64034234 ACACGTCCATCTGGGGGTCTGGG + Intronic
1085235880 11:75015101-75015123 AGACCATCATCTTGGGTGTTAGG - Intronic
1096478717 12:51924090-51924112 ACAAGGTCATCTGTGGTGTAAGG - Intergenic
1097431699 12:59516527-59516549 AAATGTTCACCTGGGGGGTTGGG - Intergenic
1102698425 12:114817899-114817921 ACACCTGCCTCTGGGGTGTGTGG - Intergenic
1103865991 12:124052568-124052590 ACACGTTCATCTGGGGTGTTGGG - Intronic
1106996780 13:35493417-35493439 ACACTTTCATATGGAATGTTAGG - Intronic
1109245549 13:59950329-59950351 ACATGTGCTGCTGGGGTGTTTGG - Intronic
1115675135 14:35664728-35664750 ACAAGTTCTTCTGGGATCTTTGG - Exonic
1119309074 14:73631598-73631620 ACCCGTTCTTCTGGGGTCTTAGG - Intergenic
1124689542 15:31810583-31810605 GCACCTTCATCTGGGATTTTCGG + Intronic
1125790301 15:42360461-42360483 ACAGGTACATCTGGGCTGTCTGG - Intronic
1127321939 15:57855503-57855525 ACACCATCATCTTGGGGGTTAGG - Intergenic
1133387055 16:5378279-5378301 ACACATTCCTTTGGGTTGTTTGG - Intergenic
1136986718 16:35113179-35113201 ACACTGTCAACTGGGGTGTGTGG - Intergenic
1138417884 16:56881609-56881631 AAAAGTTTATCTGGGGTGCTGGG + Intronic
1141726040 16:85789172-85789194 ACCCTTTCTTCTGGGGTGTAGGG - Intronic
1143644461 17:8221364-8221386 ACAGGTTCATGTGGGGTGGGTGG + Intergenic
1145738039 17:27247345-27247367 CCACCTTCATCTGGGGAGTGGGG + Intergenic
1145788991 17:27613135-27613157 ACCATTTCATCTGGGGTGCTGGG + Intronic
1149453337 17:56767116-56767138 GCCCTTTCATCTGGGCTGTTGGG + Intergenic
1150617951 17:66786440-66786462 ACACTTTCATTTGGGGTGAAGGG - Intronic
1156002822 18:32404401-32404423 ACACGCTCATGTTGGGTTTTTGG + Intronic
1156173491 18:34514858-34514880 ACACCATCAACTTGGGTGTTAGG + Intronic
1156228484 18:35131623-35131645 ACACCATCACCTTGGGTGTTAGG + Intronic
1157137908 18:45075278-45075300 ACACCATCATCTTGGGGGTTAGG + Intergenic
1165316134 19:35056479-35056501 ACAGGTTCCTCTGAGGTGTGTGG + Intronic
1167735257 19:51290669-51290691 ACACCATCATCTTGGGGGTTAGG - Intergenic
926788496 2:16544797-16544819 ACAAGTTCATCTTGAGTGGTGGG + Intergenic
928307183 2:30179756-30179778 ATACCATCATCTGGGGTGTTAGG + Intergenic
930985071 2:57575749-57575771 AGGCGTTCATTTGGGGTCTTGGG - Intergenic
940042220 2:149372489-149372511 ACACCTTCATCTGGGGTGTTGGG + Intronic
945063992 2:205932899-205932921 ACACCTTCACCTTGGGGGTTAGG - Intergenic
946331336 2:219010695-219010717 GCACGTCCACCTGGGGAGTTAGG + Exonic
1177476521 21:21631165-21631187 ACAGGTTAATCATGGGTGTTTGG - Intergenic
1178173646 21:30072221-30072243 ACGTGTTCATTTGTGGTGTTTGG - Intergenic
1185105386 22:48866425-48866447 ACACGTTCCTCCCAGGTGTTAGG - Intergenic
950084253 3:10246440-10246462 ACACGTTCATCAGGGATGTATGG + Intergenic
959539560 3:107523796-107523818 GCTCGTTCATCTGGAGAGTTGGG + Intronic
960191605 3:114713196-114713218 ATACATTAATTTGGGGTGTTAGG + Intronic
961786731 3:129352045-129352067 ACACGTCCCTGTGGGGTGTCCGG + Intergenic
967014006 3:185465290-185465312 ACATTATCATCTTGGGTGTTAGG + Intronic
969375838 4:6762648-6762670 ACACCATCATCTTGGGAGTTAGG - Intergenic
971805645 4:31355251-31355273 ACACGTGCCTCTAGGGTGTTGGG - Intergenic
974733774 4:65901586-65901608 CTACGTTCATCAGGGATGTTGGG + Intergenic
977358909 4:95980339-95980361 ACTCGGCCATCTGGAGTGTTAGG - Intergenic
983058661 4:163129580-163129602 ACATTTTCTTCTGTGGTGTTTGG - Intronic
993810265 5:92467505-92467527 ATACCTTCATCTTGGTTGTTAGG - Intergenic
1004005280 6:11632415-11632437 ACACGTTCCTCTGTGGGGTGTGG + Intergenic
1009000541 6:57707631-57707653 CCACCTTCACCTGGGTTGTTTGG + Intergenic
1009189008 6:60607058-60607080 CCACCTTCACCTGGGTTGTTTGG + Intergenic
1009962970 6:70546021-70546043 ACTATTTCATGTGGGGTGTTGGG + Intronic
1009985157 6:70773014-70773036 TCAGGTTCATTTGGGGTTTTTGG - Intronic
1010627627 6:78157848-78157870 ACACACTCATCTGGGGTGGAGGG + Intergenic
1012390084 6:98728545-98728567 AGAGGTTCATCTGGGGTACTGGG + Intergenic
1014198821 6:118586614-118586636 GGACGTTCCTCTGGGCTGTTGGG - Intronic
1014844970 6:126263710-126263732 ACAACTTCATCTAGGGTATTTGG + Intergenic
1016004303 6:139074159-139074181 ACAGTTCCATCTGGGGTGATGGG + Intergenic
1017887763 6:158613074-158613096 GGACGTTCCTCTGGGCTGTTGGG + Intronic
1027965136 7:84994627-84994649 ACACCATCATCTTGGGAGTTAGG - Intergenic
1029271787 7:99381339-99381361 ACACGTGCATGTGGGGAGTATGG + Intronic
1034998803 7:155595128-155595150 ATACTTTCATCTTGGGGGTTAGG - Intergenic
1039489329 8:37935860-37935882 ACTCCTTCATCTGCAGTGTTGGG + Exonic
1039685876 8:39801572-39801594 ACCCATTCATCTGGGCTGCTCGG + Intronic
1045911563 8:107416438-107416460 AGCCTTTCCTCTGGGGTGTTGGG + Intronic
1046488573 8:114917773-114917795 ACATGTTCCTCTGGGCTGTTAGG + Intergenic
1050202620 9:3161803-3161825 ACACCTTCATTTGGGGATTTGGG - Intergenic
1050429926 9:5552009-5552031 ACCATTCCATCTGGGGTGTTAGG - Intronic
1051252134 9:15170779-15170801 ACACATACATGTGGGGAGTTGGG + Exonic
1051983786 9:23057556-23057578 AAGAGTTCAGCTGGGGTGTTTGG + Intergenic
1055435829 9:76291198-76291220 ACACGTTCATCTTGGGTCCTAGG - Intronic
1055490502 9:76800015-76800037 AGATTTTCATCTGGGGTCTTTGG - Intronic
1058493134 9:105523955-105523977 ACAAGTTCTTCTGGGATCTTTGG + Intronic
1058616758 9:106837597-106837619 ACACGTTGGTCTGGTGTTTTAGG + Intergenic
1190731761 X:53231276-53231298 AAACCTTCATCAGGGATGTTGGG + Intergenic
1195268950 X:103212252-103212274 ACATATTCATCTGTGGTTTTTGG - Intergenic
1197668545 X:129249834-129249856 ACACGTTAATCAGCGTTGTTTGG + Intergenic
1200961897 Y:9003545-9003567 ACACCCTCCTCTGGGGTCTTAGG + Intergenic