ID: 1103865992

View in Genome Browser
Species Human (GRCh38)
Location 12:124052569-124052591
Sequence GACACGTTCATCTGGGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 1, 2: 0, 3: 4, 4: 67}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103865992_1103866004 19 Left 1103865992 12:124052569-124052591 CCAACACCCCAGATGAACGTGTC 0: 1
1: 1
2: 0
3: 4
4: 67
Right 1103866004 12:124052611-124052633 GGCGCTACCATGATGGATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1103865992_1103866005 20 Left 1103865992 12:124052569-124052591 CCAACACCCCAGATGAACGTGTC 0: 1
1: 1
2: 0
3: 4
4: 67
Right 1103866005 12:124052612-124052634 GCGCTACCATGATGGATTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1103865992_1103865998 -2 Left 1103865992 12:124052569-124052591 CCAACACCCCAGATGAACGTGTC 0: 1
1: 1
2: 0
3: 4
4: 67
Right 1103865998 12:124052590-124052612 TCAAAGGACGGCTCCCAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 108
1103865992_1103866001 12 Left 1103865992 12:124052569-124052591 CCAACACCCCAGATGAACGTGTC 0: 1
1: 1
2: 0
3: 4
4: 67
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103865992 Original CRISPR GACACGTTCATCTGGGGTGT TGG (reversed) Intronic
900393780 1:2444826-2444848 GACACGTTGGTCTGGGGAGGCGG + Intronic
903935523 1:26892418-26892440 CACGCTTGCATCTGGGGTGTTGG + Exonic
908023966 1:59928443-59928465 GTCACGTTGATCTGGGGACTAGG - Intergenic
911523952 1:98961931-98961953 GAGACCTGCATCTGGGGTTTAGG - Intronic
920296069 1:204957665-204957687 GACACGTTTGTCTTGGGTGATGG - Exonic
923008627 1:230071243-230071265 GACTGGTTCATTTGGGGTTTGGG + Intronic
1067662355 10:48246041-48246063 TGCACGTTCATCTGAGGGGTGGG - Intronic
1077010159 11:376062-376084 GACAGGTACACCTGGGGGGTGGG - Exonic
1090956143 11:131514458-131514480 GATTCATTCATCTTGGGTGTGGG - Intronic
1103865992 12:124052569-124052591 GACACGTTCATCTGGGGTGTTGG - Intronic
1103979800 12:124729420-124729442 GACACGTCCATATTGGGGGTAGG + Intergenic
1121040675 14:90744118-90744140 GACCTGTTCATCTGGGGCTTGGG - Intronic
1125470741 15:40001069-40001091 GACTCCTCCATCTGGGGTGGGGG - Exonic
1128886258 15:71290985-71291007 GACACTTGCCTCTGGGGAGTGGG - Intronic
1130748824 15:86687333-86687355 GACACCTTCTTCTTGGTTGTTGG - Intronic
1132614730 16:834906-834928 GACAAGTGCAGCTGTGGTGTCGG - Intergenic
1137613090 16:49832112-49832134 GGCTGGGTCATCTGGGGTGTGGG + Intronic
1141726041 16:85789173-85789195 TACCCTTTCTTCTGGGGTGTAGG - Intronic
1145738037 17:27247344-27247366 TCCACCTTCATCTGGGGAGTGGG + Intergenic
1150617952 17:66786441-66786463 AACACTTTCATTTGGGGTGAAGG - Intronic
1158832791 18:61298441-61298463 GACAACTTCTGCTGGGGTGTTGG + Intergenic
1160297750 18:77653882-77653904 GACACGCTTGGCTGGGGTGTGGG + Intergenic
1163586990 19:18169539-18169561 GACACGTAGATATGGGGTGGGGG - Exonic
1164832113 19:31330770-31330792 GACACCTCCGTCTGGGGTCTGGG - Intronic
925101551 2:1250816-1250838 GACAGTTTCATCTTTGGTGTGGG + Intronic
926304774 2:11629936-11629958 GACTCATACAGCTGGGGTGTGGG - Exonic
929255072 2:39801926-39801948 GACATGTTTATTTGAGGTGTGGG - Intergenic
933031720 2:77336432-77336454 TCTATGTTCATCTGGGGTGTTGG - Intronic
938242532 2:129754496-129754518 GAAACGTCCAACTGGGGTATTGG - Intergenic
940042219 2:149372488-149372510 GACACCTTCATCTGGGGTGTTGG + Intronic
945165427 2:206938072-206938094 GAGGAGTTCATCTAGGGTGTGGG - Intergenic
946171489 2:217898511-217898533 GACACGTTCACCTGGGTTCCAGG + Intronic
1173601207 20:44296703-44296725 GGCATGTGCATCTGGGGTGTGGG - Intergenic
1183479323 22:38054412-38054434 GACATGTTCCTCTGCTGTGTGGG + Intergenic
1183603290 22:38852539-38852561 GACAAGGACATCTGGGTTGTGGG + Intergenic
1184020914 22:41820914-41820936 GACACAGTCATCTGGGGCATCGG + Intronic
951372144 3:21862679-21862701 GACATCTTCATCTGGGCTGCAGG - Intronic
953455475 3:43037272-43037294 GTCCCGTTCATCTGGGGAGTTGG - Intronic
954712361 3:52511525-52511547 GAGAAGTTCCTCTGGGGTCTGGG + Intronic
955651248 3:61196624-61196646 GACATCTTCACCTGGGGTGAAGG + Intronic
957200696 3:77131692-77131714 GACACTTTCATATGTGGTATAGG - Intronic
961810555 3:129519325-129519347 GACCCCTTCCTGTGGGGTGTGGG + Intronic
968447500 4:659114-659136 CACACGGTCATCAGGGATGTTGG + Intronic
969542506 4:7802222-7802244 AAAACTTTCATCTGGGGTGTGGG + Intronic
971805646 4:31355252-31355274 AACACGTGCCTCTAGGGTGTTGG - Intergenic
973653036 4:53016071-53016093 TACACGGTCACCTGGGGTGGAGG + Intronic
982214268 4:153066873-153066895 GACAAGTTGATCTGGGTTTTAGG - Intergenic
993869220 5:93231661-93231683 TTCATGTTCATCTGGGGTGCAGG - Intergenic
1006579302 6:35067398-35067420 AGCACGTTCGTCTGGGGTGCAGG - Intronic
1008087345 6:47258905-47258927 GCCACATTCATTTGTGGTGTTGG - Intronic
1010627626 6:78157847-78157869 AACACACTCATCTGGGGTGGAGG + Intergenic
1011349958 6:86411896-86411918 GATACGTGCATCCAGGGTGTAGG + Intergenic
1011497660 6:87952432-87952454 GACACATTGATCTGGGCTGCTGG - Intergenic
1012390083 6:98728544-98728566 GAGAGGTTCATCTGGGGTACTGG + Intergenic
1013016511 6:106164827-106164849 GACACGATCATTTGGGGAGATGG + Intergenic
1016004302 6:139074158-139074180 GACAGTTCCATCTGGGGTGATGG + Intergenic
1016331654 6:142959020-142959042 GACACCTTCATCTGTGTTATTGG - Intergenic
1021343830 7:19498003-19498025 GACACCTTTATGTGTGGTGTCGG + Intergenic
1021571007 7:22065249-22065271 GACATGTTCATCTGAGGTAGGGG + Intergenic
1023499146 7:40829732-40829754 GACATGGTCATCTGTGGAGTAGG - Intronic
1026849491 7:73716132-73716154 TACATTTTCATCTGGGGTGCAGG - Intronic
1034351161 7:150415711-150415733 GACAGGGGCCTCTGGGGTGTGGG + Intergenic
1038870298 8:31486526-31486548 CAAATGTTCATCTGGGATGTTGG + Intergenic
1045911562 8:107416437-107416459 GAGCCTTTCCTCTGGGGTGTTGG + Intronic
1047805847 8:128358721-128358743 GAAACGTGCATCTGGGTTGTTGG + Intergenic
1050202621 9:3161804-3161826 GACACCTTCATTTGGGGATTTGG - Intergenic
1050983535 9:12052282-12052304 TATATGTTCATCTGGGGTATTGG + Intergenic
1185745479 X:2569341-2569363 GACACAAGCATCTGGGGTGCTGG + Intergenic
1186716378 X:12256202-12256224 GACAAGTTCCATTGGGGTGTTGG + Intronic
1195418027 X:104641606-104641628 GACTCCTGCATCTGGGGTGGGGG - Intronic
1202245929 Y:22820230-22820252 CACAATTTCATCTGTGGTGTGGG - Intergenic
1202398917 Y:24453978-24454000 CACAATTTCATCTGTGGTGTGGG - Intergenic
1202471863 Y:25216108-25216130 CACAATTTCATCTGTGGTGTGGG + Intergenic