ID: 1103865994

View in Genome Browser
Species Human (GRCh38)
Location 12:124052575-124052597
Sequence TCCTTTGACACGTTCATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 87}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103865994_1103866005 14 Left 1103865994 12:124052575-124052597 CCCCAGATGAACGTGTCAAAGGA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1103866005 12:124052612-124052634 GCGCTACCATGATGGATTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1103865994_1103865998 -8 Left 1103865994 12:124052575-124052597 CCCCAGATGAACGTGTCAAAGGA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1103865998 12:124052590-124052612 TCAAAGGACGGCTCCCAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 108
1103865994_1103866001 6 Left 1103865994 12:124052575-124052597 CCCCAGATGAACGTGTCAAAGGA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865994_1103866004 13 Left 1103865994 12:124052575-124052597 CCCCAGATGAACGTGTCAAAGGA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1103866004 12:124052611-124052633 GGCGCTACCATGATGGATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 29

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103865994 Original CRISPR TCCTTTGACACGTTCATCTG GGG (reversed) Intronic
900393775 1:2444820-2444842 TCCCCTGACACGTTGGTCTGGGG + Intronic
904920107 1:34000713-34000735 TCCTTTGACAATTCCCTCTGAGG - Intronic
908285077 1:62588538-62588560 TCATTTGAGATGTTCTTCTGTGG + Intronic
908620108 1:65969162-65969184 TCATATGACACATTCATCTTGGG + Intronic
911142745 1:94523851-94523873 TCCTTTGAAATATCCATCTGTGG + Intergenic
916145468 1:161735255-161735277 TCCCTGGACACATCCATCTGAGG - Intergenic
917615289 1:176737606-176737628 TCCTTTGTAAGCTTCATCTGAGG + Intronic
918318271 1:183341145-183341167 TTCCTTGGCACTTTCATCTGCGG + Intronic
918970260 1:191405805-191405827 TCCTTTGACAGCTTCATTAGTGG - Intergenic
921784714 1:219216420-219216442 TCCTTTCAGACTTTCTTCTGTGG + Intergenic
1063911916 10:10838701-10838723 TCCTTTGACACATTCTCATGTGG + Intergenic
1064057009 10:12106372-12106394 ATCTTTGACACATTCATCTCTGG + Exonic
1075875539 10:125803008-125803030 TCCTTTGACTTCTTCACCTGAGG + Intronic
1079861972 11:25684230-25684252 TCCTTTTATAGTTTCATCTGAGG + Intergenic
1083021740 11:59514879-59514901 TCCTTTATCAGGTTCATCTCTGG - Intergenic
1088516098 11:110635802-110635824 TCCTTTCTCAAGTTCTTCTGGGG + Intronic
1089769333 11:120791874-120791896 TACTTTGACCCGTGCATTTGTGG - Intronic
1095307903 12:40660024-40660046 TCCTTAGAACCGTTCTTCTGGGG - Intergenic
1102166590 12:110811705-110811727 TCCTTAGTCATTTTCATCTGGGG - Intergenic
1102656088 12:114483535-114483557 TCCTTTGGCTCCTGCATCTGAGG - Intergenic
1103744070 12:123110404-123110426 TCCTTTGACAGGGACATCAGTGG - Exonic
1103865994 12:124052575-124052597 TCCTTTGACACGTTCATCTGGGG - Intronic
1107569222 13:41638885-41638907 TCCTTTGACACCTTTTTCTCTGG - Intronic
1108106875 13:47020313-47020335 TCCTTTTAAACATTCATGTGAGG - Intergenic
1114183882 14:20385879-20385901 TCCTTTGAGAAGTGCCTCTGGGG - Intronic
1115821106 14:37212845-37212867 TTCTATGACACGTAAATCTGGGG - Intronic
1117226008 14:53659704-53659726 TCCCTTCCCATGTTCATCTGGGG + Intergenic
1118227850 14:63919691-63919713 TCCTGAAACACGTTCATCTAGGG - Intronic
1118505689 14:66408873-66408895 TCCTTGGAGGCGTTCATGTGGGG + Intergenic
1124073338 15:26416037-26416059 AACTTTGACAGGCTCATCTGTGG + Intergenic
1126396692 15:48225924-48225946 TCCTCTGACACATCCATTTGTGG - Intronic
1129030224 15:72612349-72612371 TCCTTTGCCACCTTCCTCTGTGG + Intergenic
1130276259 15:82477792-82477814 TACTTTGCCACCTTCCTCTGTGG - Intergenic
1130468620 15:84205185-84205207 TACTTTGCCACCTTCCTCTGTGG - Intergenic
1130485129 15:84394577-84394599 TACTTTGCCACCTTCCTCTGTGG + Intergenic
1130495655 15:84468394-84468416 TACTTTGCCACCTTCCTCTGTGG + Intergenic
1130590913 15:85209784-85209806 TACTTTGCCACCTTCCTCTGTGG - Intergenic
1131060586 15:89401452-89401474 TCCCTTGACACCTTCAGCAGAGG + Intergenic
1137244478 16:46690866-46690888 TCCTGTGGCTCGTTTATCTGGGG - Intronic
1139277597 16:65742244-65742266 TTCTTTGAGATGTTCATCTGTGG - Intergenic
1140638064 16:76940088-76940110 TCCTCTGATACGTTGATCTGAGG - Intergenic
1142204175 16:88774908-88774930 TCCTTTGACTGGTTCCTCTGGGG - Intronic
1143263362 17:5616872-5616894 TCCTTTTACTAGTTCATCTTGGG + Intronic
1150986043 17:70198096-70198118 TCCTTTGACACTTTCATTTTTGG + Intergenic
1156420965 18:36952526-36952548 TTCTCTGACATCTTCATCTGGGG - Intronic
1168477519 19:56687615-56687637 TCCTTCGACACCTTGATCTTGGG - Intergenic
927304125 2:21550795-21550817 TCCTTTGCCCAGTTCATCTCAGG - Intergenic
928399396 2:30966895-30966917 TCCTATGACAATTACATCTGGGG + Intronic
941986460 2:171516125-171516147 TCCTTTGTCTTGGTCATCTGGGG + Intergenic
943979223 2:194525576-194525598 TCTTTTGAGAAGTTCATATGAGG + Intergenic
947790341 2:232863030-232863052 TTCTTTTTCACGTTCATCTAGGG - Intronic
948126080 2:235565404-235565426 TACTTTAACAAGTTCATCTTAGG + Intronic
1171939377 20:31310758-31310780 TCCTTTTACATCTTCATCAGAGG + Intergenic
1173068345 20:39736662-39736684 TCCTTTCCCAAGTTCCTCTGTGG - Intergenic
1176934206 21:14847233-14847255 TCTTTTGTCAGGTTAATCTGGGG + Intergenic
1177197254 21:17916249-17916271 TCCCTTGCCACTTTCCTCTGAGG - Intronic
1181107150 22:20582231-20582253 TCCTGTGACATGCTCCTCTGTGG - Intronic
952581632 3:34839989-34840011 TCCTTTGACTCCTTCATTTTGGG - Intergenic
953347046 3:42184945-42184967 TCTTCTGAAACGTTCACCTGGGG + Intronic
953704759 3:45222638-45222660 GGCCTTGACAAGTTCATCTGTGG - Intergenic
954183261 3:48898247-48898269 TCCTTTGATACATTCCCCTGGGG - Intronic
958824974 3:99019195-99019217 TCCTTTGACAAGTGAAACTGAGG - Intergenic
961135190 3:124503525-124503547 TCCTTTGTTACTTTTATCTGTGG + Intronic
964707834 3:159639305-159639327 TCCTTTTTCACGTGCATGTGAGG + Intronic
965401358 3:168216654-168216676 TCTTTTGCCAATTTCATCTGAGG - Intergenic
965661313 3:171045029-171045051 TCCTTTGACACGTGTATCTATGG + Intergenic
967547212 3:190745390-190745412 TCCTTTGACTGGTTCATCATTGG - Intergenic
982044526 4:151429954-151429976 TCCTTTGAAATTTTCAACTGTGG - Intronic
982069366 4:151682086-151682108 GCCTTTGAGAAGTTCATCTAAGG + Intronic
983304703 4:165971438-165971460 TCCTTTAACATGATCATCAGAGG - Intronic
987236665 5:15949664-15949686 GCCTTTCACACTTTAATCTGAGG - Intergenic
987793714 5:22601754-22601776 CCCTTTGAAAGGTTCATCTAGGG - Intronic
990493415 5:56323159-56323181 TCCTTTGCCATGTTTTTCTGAGG - Intergenic
992200133 5:74375039-74375061 TTCTTTGACACTTTGAACTGAGG - Intergenic
996577105 5:124987740-124987762 TCCATGGACACTTCCATCTGAGG - Intergenic
1004005276 6:11632408-11632430 TCCTTGTACACGTTCCTCTGTGG + Intergenic
1004718664 6:18244823-18244845 TCCTCTCACACGTTGATCAGAGG - Intronic
1007329357 6:41092709-41092731 TCCTATGACACAGTCATCTGGGG + Intronic
1007337883 6:41167754-41167776 TCCTCTGACACTTTCAGCTCAGG + Intergenic
1010361256 6:74997149-74997171 ACCTTTGGCAAGTTCTTCTGAGG - Intergenic
1010627623 6:78157841-78157863 TCCTTTAACACACTCATCTGGGG + Intergenic
1013324525 6:109031598-109031620 TCCTTTGAAAATTTCCTCTGTGG + Intronic
1019024334 6:168944676-168944698 TCCCTTTACTCTTTCATCTGTGG - Intergenic
1019237902 6:170636235-170636257 ACCTTTAACACACTCATCTGGGG - Intergenic
1020341990 7:7121567-7121589 TTCTTTGACACTTTAATTTGTGG - Intergenic
1022258879 7:28685212-28685234 TCCTTTGGAAGGTTCACCTGAGG + Intronic
1028192680 7:87870898-87870920 GCCTTTTACACGTTCATGTGTGG - Intronic
1030190742 7:106807820-106807842 TCCTTCCACACGTTCTTCAGGGG + Intergenic
1031264218 7:119564194-119564216 TCCTTTCACACCAACATCTGAGG - Intergenic
1032751003 7:134841662-134841684 TTCTTTGGCACTTTCATCTCTGG + Intronic
1042510363 8:69604862-69604884 TTCTTTGACCCGTTCATATTTGG - Exonic
1045826002 8:106398912-106398934 TCCTTTCACATGCACATCTGGGG + Intronic
1051078255 9:13265808-13265830 TCCTTTAACACTTTCCCCTGAGG - Intronic
1057851486 9:98570148-98570170 TCCTTGGAGAAGTTCATGTGAGG - Intronic
1061298963 9:129693871-129693893 TCCCTTGACACGCTCATTTTGGG - Intronic
1189375709 X:40464965-40464987 TCCTTAGACAGGTTGTTCTGAGG - Intergenic
1189879181 X:45471367-45471389 TCCTTTGACAGGTCTTTCTGTGG + Intergenic
1192215858 X:69157597-69157619 TCCTTTAAAAAGTTCATCTGTGG - Intergenic
1195220208 X:102739184-102739206 TCCTTTCACACTTTTATCAGTGG + Intronic