ID: 1103865995

View in Genome Browser
Species Human (GRCh38)
Location 12:124052576-124052598
Sequence GTCCTTTGACACGTTCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103865995_1103866004 12 Left 1103865995 12:124052576-124052598 CCCAGATGAACGTGTCAAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1103866004 12:124052611-124052633 GGCGCTACCATGATGGATTGAGG 0: 1
1: 0
2: 0
3: 1
4: 29
1103865995_1103866005 13 Left 1103865995 12:124052576-124052598 CCCAGATGAACGTGTCAAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1103866005 12:124052612-124052634 GCGCTACCATGATGGATTGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1103865995_1103866001 5 Left 1103865995 12:124052576-124052598 CCCAGATGAACGTGTCAAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865995_1103865998 -9 Left 1103865995 12:124052576-124052598 CCCAGATGAACGTGTCAAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1103865998 12:124052590-124052612 TCAAAGGACGGCTCCCAGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103865995 Original CRISPR GTCCTTTGACACGTTCATCT GGG (reversed) Intronic
900393774 1:2444819-2444841 GTCCCCTGACACGTTGGTCTGGG + Intronic
900410116 1:2508658-2508680 GTCCTGGGAGACGTTCATATTGG - Exonic
900968644 1:5976922-5976944 GTCCTTTGAGACGTTACTCTAGG - Intronic
901144434 1:7055652-7055674 GTCCTGTGATACCTTCACCTGGG + Intronic
907821424 1:57973681-57973703 GTCCTTTAACAAGTTCTTCTGGG + Intronic
908620107 1:65969161-65969183 CTCATATGACACATTCATCTTGG + Intronic
909408353 1:75318568-75318590 GTTCTATGACAAGTTCATATAGG + Intronic
920290169 1:204916570-204916592 GTCCCCTGACACTCTCATCTAGG + Intronic
1063660010 10:8028708-8028730 GTGCTTTGAGACTTTCATTTTGG + Intergenic
1067241179 10:44496001-44496023 CTTCTTTGACACATTCATTTAGG - Intergenic
1067835853 10:49641046-49641068 ACCCTGTGACACCTTCATCTTGG - Intronic
1071184972 10:83032437-83032459 TTCCGTTGACACCTTGATCTTGG - Intergenic
1073504598 10:103974309-103974331 TTCCTTTAAAAAGTTCATCTTGG + Intronic
1076655768 10:132022392-132022414 ATCCTCTGACACGTTCTTCCTGG - Intergenic
1077379258 11:2221155-2221177 GCCCTGTGACACCTTGATCTTGG + Intergenic
1078222738 11:9364981-9365003 TTCCTTTGACGAATTCATCTCGG - Intergenic
1084510814 11:69602456-69602478 GCCCTGTGACACCTTAATCTGGG + Intergenic
1084521220 11:69664220-69664242 GCCCTGTGACACCTTGATCTCGG + Intronic
1085699273 11:78731925-78731947 ATCCTTTGGCACATTCCTCTTGG + Intronic
1087019103 11:93584715-93584737 ATCCTCTGACACCTTGATCTTGG + Intergenic
1093626874 12:21360323-21360345 GTCGTTTTACACCTTCATTTAGG - Intronic
1100668868 12:96787545-96787567 GTCTTTTAACACATTCATTTTGG - Intronic
1103594800 12:122018144-122018166 GTCCTTTCCCACGATAATCTGGG + Intergenic
1103865995 12:124052576-124052598 GTCCTTTGACACGTTCATCTGGG - Intronic
1109837629 13:67879331-67879353 ATCTTTTGTCACCTTCATCTTGG - Intergenic
1112106592 13:96247202-96247224 GTCCTTGGACCCTTTCCTCTTGG + Intronic
1112453005 13:99529239-99529261 TTCCTTTGATACGTTCTTTTTGG - Intronic
1114183883 14:20385880-20385902 GTCCTTTGAGAAGTGCCTCTGGG - Intronic
1115821107 14:37212846-37212868 GTTCTATGACACGTAAATCTGGG - Intronic
1116019719 14:39445364-39445386 TTCCTTTGTCAATTTCATCTTGG + Intergenic
1116760085 14:49002310-49002332 GGCTTTTGAAAAGTTCATCTGGG - Intergenic
1118227851 14:63919692-63919714 TTCCTGAAACACGTTCATCTAGG - Intronic
1123838965 15:24226521-24226543 GTCCTCTGGCACGTTCAGCATGG + Intergenic
1123848524 15:24328898-24328920 GTCCTCTGGCACGTTCAGCATGG + Intergenic
1123867584 15:24536419-24536441 GTCCTCTGGCACGTTCAGCATGG + Intergenic
1132472480 16:113438-113460 GTCCTTTGACCCAGTCATCATGG - Intronic
1132624362 16:883372-883394 GTCCTGTGACAGGTTCTGCTGGG - Intronic
1138941380 16:61794607-61794629 GTCCTTAAAGAAGTTCATCTGGG + Intronic
1142204176 16:88774909-88774931 TTCCTTTGACTGGTTCCTCTGGG - Intronic
1143263361 17:5616871-5616893 GTCCTTTTACTAGTTCATCTTGG + Intronic
1149483925 17:57026901-57026923 ATCCTTTAACACTTTAATCTAGG + Intergenic
1152690011 17:81713713-81713735 GGCCTCTCCCACGTTCATCTGGG + Intronic
1153265830 18:3268445-3268467 TTCCTTTGAAACTTTGATCTAGG - Intronic
1167342900 19:48926527-48926549 GTTCTTTGAAAGGTTCATATAGG + Intergenic
1168477520 19:56687616-56687638 CTCCTTCGACACCTTGATCTTGG - Intergenic
928474232 2:31609098-31609120 GTCCACTGACACCTTCATCTTGG + Intergenic
938956837 2:136306918-136306940 TCCCTTTGACACATCCATCTAGG + Intergenic
941180012 2:162248211-162248233 ATCCTTTGGGATGTTCATCTGGG + Intergenic
941502198 2:166293290-166293312 GAGCTTTGACACTTTCAGCTGGG - Exonic
947790342 2:232863031-232863053 TTTCTTTTTCACGTTCATCTAGG - Intronic
1176411113 21:6450110-6450132 GTCCTTGGACCCGTTCAGCCAGG + Intergenic
1176934205 21:14847232-14847254 GTCTTTTGTCAGGTTAATCTGGG + Intergenic
1179686606 21:43058432-43058454 GTCCTTGGACCCGTTCAGCCAGG + Intronic
1182693244 22:32178011-32178033 GTCCACTGACACCTACATCTGGG + Intergenic
1182916182 22:34034329-34034351 GTCATTTGAGATTTTCATCTAGG - Intergenic
1183166811 22:36154342-36154364 GGCCTTTCACAGATTCATCTTGG - Intronic
1183188974 22:36309297-36309319 GTCCTCTGACAAGTTTGTCTCGG - Exonic
1185032505 22:48451884-48451906 GCCCTGTGACACCTTCACCTTGG - Intergenic
950129151 3:10529995-10530017 GCCCTCTGACACCTTGATCTTGG + Intronic
952581633 3:34839990-34840012 ATCCTTTGACTCCTTCATTTTGG - Intergenic
953163758 3:40445700-40445722 CACCTTTGACCCATTCATCTCGG - Intergenic
954183262 3:48898248-48898270 GTCCTTTGATACATTCCCCTGGG - Intronic
955454467 3:59104374-59104396 ATCCTTTAACACTTTAATCTAGG - Intergenic
965619295 3:170626295-170626317 ATCCTGTGACACCTTGATCTTGG + Intronic
969880068 4:10165643-10165665 GTTCTTAGTCACGTTCATCAGGG + Intergenic
970462178 4:16285378-16285400 GTCTTCTGACACCTTGATCTCGG + Intergenic
973865816 4:55111683-55111705 GTATTTTGACAAGTGCATCTTGG + Intronic
975526454 4:75355655-75355677 GTCCTTTTATAGTTTCATCTTGG - Intergenic
976643754 4:87365798-87365820 ATCCTTTAACACTTTAATCTAGG - Intronic
979109159 4:116728644-116728666 GTCCTTTAAAAAGTTCTTCTTGG + Intergenic
981670052 4:147276419-147276441 GTCTGTTGACACCTTGATCTTGG - Intergenic
987166017 5:15199258-15199280 ATCCTTTAACACCTTAATCTAGG + Intergenic
987707744 5:21476864-21476886 CTGCTTTGACACTTTAATCTTGG + Intergenic
987793716 5:22601755-22601777 CCCCTTTGAAAGGTTCATCTAGG - Intronic
989066266 5:37465284-37465306 CTGCTTTGACACTTTAATCTTGG + Intronic
989458320 5:41667807-41667829 ATCTGTTGACACCTTCATCTTGG - Intergenic
994419805 5:99517832-99517854 CTGCTTTGACACTTTAATCTTGG + Intergenic
994487405 5:100397309-100397331 CTGCTTTGACACTTTAATCTTGG - Intergenic
996628079 5:125594460-125594482 TTCCTTTGACATTTTCATCTGGG + Intergenic
1005106915 6:22233607-22233629 CTCCGTTGACACCTTGATCTGGG - Intergenic
1007329356 6:41092708-41092730 CTCCTATGACACAGTCATCTGGG + Intronic
1008289450 6:49695842-49695864 GTCCTTTGTCACAGTCATCAGGG + Exonic
1008847251 6:55982937-55982959 TTCCTTTGGCATTTTCATCTTGG + Intergenic
1009020470 6:57943671-57943693 CTGCTTTGACACTTTAATCTTGG - Intergenic
1009281021 6:61751816-61751838 CACCTTTGACACCTTCATCTTGG - Intronic
1010627622 6:78157840-78157862 TTCCTTTAACACACTCATCTGGG + Intergenic
1016389444 6:143560595-143560617 GACCTTTGACTAGTTCATTTAGG + Intronic
1017531550 6:155297438-155297460 GACCTCTGACAGCTTCATCTAGG - Intronic
1020836102 7:13153591-13153613 GTCCATTTACACTTTCATTTAGG + Intergenic
1022488671 7:30800035-30800057 GTCCTTTGCCAAACTCATCTAGG - Intronic
1024990855 7:55233715-55233737 GGCATCTGACACGTTCACCTGGG + Intronic
1030190741 7:106807819-106807841 GTCCTTCCACACGTTCTTCAGGG + Intergenic
1037167810 8:15852274-15852296 TTCTTTTGAAACCTTCATCTTGG + Intergenic
1037891380 8:22625563-22625585 GTCCTTTGAGAGGCACATCTGGG - Intronic
1038142835 8:24865272-24865294 TTCCTTGGACAGGTTCATATAGG - Intergenic
1041398758 8:57419248-57419270 CTCCTTTGCCAAGTTCAACTGGG - Intergenic
1041547665 8:59064038-59064060 GTCCTTTGACTCATTCCACTGGG + Intronic
1041931369 8:63291188-63291210 ATCCATTGACACCTTGATCTTGG - Intergenic
1050369579 9:4906861-4906883 GTCAACTGACACTTTCATCTTGG + Intergenic
1057870198 9:98710979-98711001 GTCCACTGACACCTACATCTGGG + Intergenic
1060918833 9:127406469-127406491 GTCCTTTGTCACCTCCTTCTTGG - Intronic
1061298964 9:129693872-129693894 GTCCCTTGACACGCTCATTTTGG - Intronic
1187969244 X:24643093-24643115 GACCTTGGACAAGTTCTTCTAGG - Intronic
1195932072 X:110088349-110088371 GTCTTTTGGCACCTTCACCTCGG + Intronic
1198580541 X:138059550-138059572 GTGCTCTGACACTTTCATCAAGG + Intergenic