ID: 1103866001

View in Genome Browser
Species Human (GRCh38)
Location 12:124052604-124052626
Sequence CCAGCCCGGCGCTACCATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 57}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103865994_1103866001 6 Left 1103865994 12:124052575-124052597 CCCCAGATGAACGTGTCAAAGGA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865991_1103866001 13 Left 1103865991 12:124052568-124052590 CCCAACACCCCAGATGAACGTGT 0: 1
1: 1
2: 0
3: 6
4: 81
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865989_1103866001 21 Left 1103865989 12:124052560-124052582 CCTGAGTCCCCAACACCCCAGAT 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865995_1103866001 5 Left 1103865995 12:124052576-124052598 CCCAGATGAACGTGTCAAAGGAC 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865996_1103866001 4 Left 1103865996 12:124052577-124052599 CCAGATGAACGTGTCAAAGGACG 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865990_1103866001 14 Left 1103865990 12:124052567-124052589 CCCCAACACCCCAGATGAACGTG 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57
1103865992_1103866001 12 Left 1103865992 12:124052569-124052591 CCAACACCCCAGATGAACGTGTC 0: 1
1: 1
2: 0
3: 4
4: 67
Right 1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG 0: 1
1: 0
2: 0
3: 7
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103866001 Original CRISPR CCAGCCCGGCGCTACCATGA TGG Intronic
900098053 1:948363-948385 CCAGCCCTGGGAGACCATGAAGG + Intronic
901014138 1:6218064-6218086 CCAGCACGCAGCTTCCATGATGG + Intronic
901104341 1:6743678-6743700 CCAGCCGAGCGCTACCAGGAGGG - Intergenic
904774444 1:32898111-32898133 CCAGCCTGGCCATACCACGATGG + Exonic
909135007 1:71786946-71786968 CCACCTCGGGGCTACCATGCTGG + Intronic
913159637 1:116133360-116133382 CCAGGCCGGGGCAACCATCAGGG - Exonic
915079188 1:153339943-153339965 GCAGCACGGGTCTACCATGAGGG + Intronic
924389910 1:243543153-243543175 ACAGCCAGGAGCTACCATGTGGG - Intronic
1063914771 10:10870453-10870475 CCACACCGGCGTTTCCATGAGGG - Intergenic
1066428141 10:35327848-35327870 CCAGCCAGGAGCCACCATGGAGG - Intronic
1068690190 10:59906418-59906440 CCAGCCCGCCGCGGCCATGGCGG - Exonic
1074790391 10:116880853-116880875 CCAGCCAGACGTTACCACGAGGG + Intronic
1083365632 11:62140097-62140119 CCACCCCGGAGCTGCCAGGAAGG + Intronic
1084329670 11:68423110-68423132 CTAGACTGGCGCTCCCATGAAGG - Intronic
1091490334 12:927129-927151 CCAGCCCCGCGCTCACCTGAGGG + Exonic
1092155442 12:6278939-6278961 CCAGCTCGGCGCTCCGAGGAGGG - Intergenic
1100433155 12:94548248-94548270 CCAGGCCTGCGCTGCCATGGGGG - Intergenic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1111937686 13:94573373-94573395 CCACCCCAGAACTACCATGATGG + Intergenic
1121633715 14:95439722-95439744 CCAGCCCTGCGCTTCCACCAGGG + Exonic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1125730239 15:41888921-41888943 CCAGCCTGGCCCCACCATGCAGG - Intronic
1132764811 16:1528982-1529004 CCTGCCCGGGGCTACCATCTCGG - Intronic
1134254928 16:12602964-12602986 CCAGCCCAGGGCTCCCATGTAGG + Intergenic
1136377862 16:29876240-29876262 CCAGCACGGGGCTTCAATGATGG + Intronic
1138105897 16:54287000-54287022 CCCGCCCGGCGCGAGCAGGAGGG - Intergenic
1141590095 16:85062755-85062777 CCAGCCCGGTGCTACCATTTGGG - Intronic
1142123644 16:88399539-88399561 CCAGCCTGGCCCTCCCATGAAGG - Intergenic
1146937791 17:36823503-36823525 CCAGCCTGGCCCTACCCTGGTGG + Intergenic
1147721667 17:42543373-42543395 CCAGCCCAGCTCAGCCATGAGGG - Exonic
1152388197 17:79987645-79987667 CCAGCCAGGGGCTACCTTCATGG - Intronic
1152516513 17:80827935-80827957 ACAGCCTGGCCCTACCATGCAGG - Intronic
1155163262 18:23212548-23212570 GCAGCCCTGCCCTCCCATGACGG + Intronic
1157166939 18:45366367-45366389 CCAGCCAGGTGCTACCAGGTGGG + Intronic
1165314009 19:35043918-35043940 CCAGCCCGGAGCTGCCAGGGAGG - Intronic
1168713341 19:58513841-58513863 CCAGCCCGGCACCACCTGGAGGG + Exonic
926710135 2:15872699-15872721 CCAGCCCGCCTCCACCAGGATGG - Intergenic
938116149 2:128604084-128604106 CCAGCCCAGCAGGACCATGATGG + Intergenic
1172530176 20:35625639-35625661 CCAGCCCAGCTCTGCCCTGAGGG + Intergenic
1174357965 20:50010614-50010636 CCAGCCCGGAGCTGCCATGGTGG + Intergenic
1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG + Exonic
951262470 3:20526729-20526751 CCAGCCAGGCTCTACCATAAAGG + Intergenic
952267456 3:31800426-31800448 CCAGCCTGGCCCTGGCATGATGG + Intronic
955632984 3:60994863-60994885 CCAGCCAGTCGTTCCCATGAAGG + Intronic
955955075 3:64280444-64280466 CCTGCCAGGCGCTTCAATGAGGG - Intronic
959539863 3:107525222-107525244 CCGGCCCGGCGCTGCCATTCCGG - Intronic
966769892 3:183494375-183494397 CCAGGCCAGCCCTACCCTGAGGG + Intronic
968904663 4:3445725-3445747 CCAGCCCGGGGCTCTCATGTGGG + Intronic
985782306 5:1877791-1877813 CAAGCCCGGCGCTGCCACGCCGG - Exonic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
1002521196 5:179794065-179794087 CCACACCGACGGTACCATGAAGG + Exonic
1015645644 6:135385156-135385178 CCAGCCTCTAGCTACCATGATGG + Intronic
1017491041 6:154945322-154945344 CCAGCCCCGGTCTACCATGCAGG + Intronic
1019660258 7:2220068-2220090 CCACCCCAATGCTACCATGACGG + Intronic
1027269805 7:76513156-76513178 CCTGCCCAGCGCTACCTTGGTGG - Intronic
1029250665 7:99233831-99233853 CCAGCCAGGAGCTGCCCTGAGGG - Intergenic
1031997308 7:128241154-128241176 CCGGCACGTCGCTACCCTGAGGG + Intergenic
1035051929 7:156003979-156004001 CCAGCCCTGCGCTCCCAGCAGGG + Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037814489 8:22104627-22104649 CCACCCCGGAGACACCATGAGGG + Exonic
1045231214 8:100309520-100309542 CCGGCCCGGCGATATTATGACGG - Intronic
1046818034 8:118606956-118606978 CCAGCCAGGTGGTACCATGAGGG - Intronic
1050249894 9:3733728-3733750 CCAGCCCGCCGCTGCACTGACGG + Intergenic
1056752565 9:89363037-89363059 CCAGCCAGGAGCTACCTGGAGGG + Intronic
1061318219 9:129810931-129810953 CCAGCCCGGTGCTGCCACAAAGG - Exonic