ID: 1103866990

View in Genome Browser
Species Human (GRCh38)
Location 12:124060616-124060638
Sequence GGGAAGACCTAGAAGAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103866989_1103866990 -10 Left 1103866989 12:124060603-124060625 CCAGGAAAGCAATGGGAAGACCT 0: 1
1: 0
2: 0
3: 18
4: 213
Right 1103866990 12:124060616-124060638 GGGAAGACCTAGAAGAATAATGG 0: 1
1: 0
2: 0
3: 22
4: 257
1103866984_1103866990 29 Left 1103866984 12:124060564-124060586 CCAACTGATAAGTTCACCAGGAG 0: 1
1: 0
2: 0
3: 3
4: 79
Right 1103866990 12:124060616-124060638 GGGAAGACCTAGAAGAATAATGG 0: 1
1: 0
2: 0
3: 22
4: 257
1103866985_1103866990 13 Left 1103866985 12:124060580-124060602 CCAGGAGAAAAATCAATTATTTA 0: 1
1: 0
2: 1
3: 65
4: 528
Right 1103866990 12:124060616-124060638 GGGAAGACCTAGAAGAATAATGG 0: 1
1: 0
2: 0
3: 22
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103866990 Original CRISPR GGGAAGACCTAGAAGAATAA TGG Intronic
902151530 1:14447164-14447186 AGGGAGAACTAGAAGAATTATGG - Intergenic
903539367 1:24088192-24088214 GTTAAGACCTAGAAGCACAAGGG + Intronic
904406759 1:30295978-30296000 GGGAAGCCCTAAAGGAAAAAGGG + Intergenic
905766078 1:40602223-40602245 GGTGACACCTAGAAGAAGAATGG - Intergenic
906113751 1:43341698-43341720 GTAAAGACCTAGAAGCAGAAGGG - Intronic
906114546 1:43348020-43348042 GGGAAGAGCAAGAAGAGTCAAGG - Intronic
907928382 1:58975826-58975848 GGGAAGAGGCAGAAGAATATTGG - Intergenic
909184451 1:72468673-72468695 GGCAAGACCAATAATAATAAAGG + Intergenic
909991483 1:82227844-82227866 AGGAAGACAGAGAAGAACAAAGG - Intergenic
910601335 1:89035502-89035524 GGGAAGACCTAAAGTAGTAAGGG - Intergenic
911999381 1:104811624-104811646 AGGAAAACCTATCAGAATAACGG - Intergenic
915521627 1:156448575-156448597 GGGAAGAGCTAGGAGAGTGATGG + Intergenic
916181228 1:162085455-162085477 GGGAAGACCAAGAAGAACTGGGG + Intronic
916261573 1:162847545-162847567 GGGAATACCTGTAAGAAAAATGG + Intronic
917666922 1:177234086-177234108 GGTAAGAGCTAGAAGAACAGAGG + Intronic
918363006 1:183778389-183778411 GGGAAGACATAAAAGAGTAGGGG + Intronic
919188532 1:194185671-194185693 GGTAAGAGCTAGAACAAGAAGGG - Intergenic
919438252 1:197591545-197591567 GAGAAGAATTAGAAGACTAAAGG + Intronic
920332449 1:205219797-205219819 GTGTAGAGCTAGAAGAATTAGGG - Intergenic
920487480 1:206384455-206384477 TGAAAAACCTAGAACAATAAAGG - Intronic
921903304 1:220470472-220470494 GGGAAGAACAAGAATAATGATGG + Intergenic
923329459 1:232909265-232909287 GAGAAGACCGGGAAGAATGAAGG - Intergenic
924511078 1:244729777-244729799 GGCTAGACTTAGAAGAACAAAGG - Intergenic
1063516036 10:6696445-6696467 TGGAAGAAATAGAAGAAGAAAGG + Intergenic
1065586863 10:27227252-27227274 GGACAGACCTAGAAAAATTATGG - Intronic
1065728619 10:28690896-28690918 GGGAAGACCAAAAAAAAAAATGG - Intergenic
1071991180 10:91102127-91102149 GGGAAAACCTATAAGAAGGAGGG - Intergenic
1072001095 10:91196491-91196513 GGAAAGATCTGGGAGAATAAAGG - Intronic
1072324501 10:94284371-94284393 GGGATGACCAAGAAGATAAACGG + Intronic
1073021866 10:100451875-100451897 GGGAAGAAGAAGAAGAAGAAAGG - Intergenic
1074737012 10:116445957-116445979 GGGAAGAAGGAGAAGAATGAAGG + Intronic
1077978080 11:7271008-7271030 GGGAAGACTTATATAAATAAAGG + Intronic
1078127929 11:8586319-8586341 GTTGAGATCTAGAAGAATAATGG - Intronic
1078289288 11:9990905-9990927 GGAAAGACCTACAAAAATAGAGG + Intronic
1078835813 11:15028262-15028284 GGGAAGTCATAGAATCATAATGG - Intronic
1079223106 11:18581791-18581813 GTGAAGAGCTAGAACAATGAGGG - Intronic
1079671709 11:23179027-23179049 TTGAAGACATAGAAGAGTAATGG + Intergenic
1080046592 11:27815078-27815100 GGGAAGACCCAGAGGAGGAAAGG + Intergenic
1080281442 11:30562070-30562092 GAAAAGACCTAGAAGCATATAGG + Intronic
1080350563 11:31380792-31380814 GGGAAGAATGAGAAGCATAAAGG - Intronic
1081054942 11:38397908-38397930 TGGAAGACCTAGAAGAAGATAGG + Intergenic
1081924148 11:46809851-46809873 TGAAAGAACTAGAAGAAGAATGG - Exonic
1082608107 11:55266875-55266897 GGGATGACTTAGAAAAAGAATGG + Intronic
1083591323 11:63896921-63896943 GAGAAAACCAAGAAGAATTAGGG - Intronic
1084894358 11:72254637-72254659 GGGATGAGCTAGAGGAATCAGGG + Intergenic
1084897282 11:72282583-72282605 GGGAGGAGGTATAAGAATAATGG + Intergenic
1085862179 11:80247112-80247134 AGGATGAACTAGAAGACTAATGG + Intergenic
1085973911 11:81628516-81628538 GGGAAGACCTAGATGACTTGAGG - Intergenic
1088925375 11:114296125-114296147 GGCAAGAACGAGAAGAATGATGG + Intronic
1089950166 11:122518359-122518381 AGGTACACCTATAAGAATAAGGG + Intergenic
1090479255 11:127053667-127053689 GGGAAGATCTGGGAGAAAAAGGG + Intergenic
1091998616 12:5015345-5015367 GGGAAGAAATAGAGGAATGAAGG + Intergenic
1093898458 12:24603123-24603145 GGGAGGACCTAGAAAAAAGACGG + Intergenic
1096247035 12:49996811-49996833 GGGAAGAGCAAGAAGGAAAAAGG + Intronic
1096904834 12:54925915-54925937 TGGAAGACCCAGAAGAATACAGG + Intergenic
1098375704 12:69811254-69811276 GAGAAGATCAGGAAGAATAATGG + Intronic
1101922874 12:108947113-108947135 GGGAAGACCTCAAGGAATGATGG - Intronic
1103245280 12:119451416-119451438 AGGCAGACCTAGGACAATAATGG - Intronic
1103866990 12:124060616-124060638 GGGAAGACCTAGAAGAATAATGG + Intronic
1104022621 12:125003483-125003505 GGGAAGACCTGGGTGAACAAGGG - Intronic
1104223665 12:126810648-126810670 GGGGAGACCTGGAAGACTGAAGG + Intergenic
1105479591 13:20762091-20762113 TGGAAGACCCCGAAAAATAAAGG - Intronic
1106876172 13:34076264-34076286 GAAAAGACCAAGAAAAATAATGG - Intergenic
1107365352 13:39667002-39667024 TGCAAGACGTAGAAGGATAATGG + Intronic
1107840080 13:44448921-44448943 TGTTAGACCTGGAAGAATAAAGG + Intronic
1107850260 13:44564526-44564548 GCAAAGGCCTAGAAGAAGAATGG + Intronic
1108825205 13:54405453-54405475 GGGAAGAGGTAGAAGCAAAAAGG - Intergenic
1109731128 13:66415595-66415617 AGGAAGACAGAGAAGGATAAGGG - Intronic
1110149901 13:72238854-72238876 GAGAAGAATGAGAAGAATAAAGG + Intergenic
1110727841 13:78846373-78846395 TGCATGAGCTAGAAGAATAAGGG - Intergenic
1111106892 13:83657091-83657113 CGGAAGACCTAGAAGATTGTTGG - Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1115484025 14:33892203-33892225 TGGATAACCTAGAAAAATAATGG + Intergenic
1119052060 14:71378985-71379007 GAGAAGAACTAGATCAATAAGGG - Intronic
1120807807 14:88772296-88772318 GGGAAGCAATAGAGGAATAATGG - Intronic
1121897480 14:97661933-97661955 GGGAAGACCTAGAAGATGTTTGG + Intergenic
1125794889 15:42396893-42396915 AGGAAGACCCAGAAGGGTAAGGG + Intronic
1126643313 15:50850422-50850444 GGGAAACCCTAGCAGAATATTGG - Intergenic
1126932300 15:53668586-53668608 GGAAACACCTAGTAGAAGAAAGG + Intronic
1128393354 15:67198318-67198340 GGGTCGAGCTAGAAGGATAAAGG - Intergenic
1129153924 15:73705775-73705797 GAGAAGGCCTTGAAGGATAAGGG + Intronic
1129927063 15:79374070-79374092 GGAAAGACCTGGAAAAAGAAGGG + Intronic
1132072571 15:98791878-98791900 GGGAAGAAATAGAAGAAGGAAGG + Intronic
1133598468 16:7316038-7316060 AGGAAGAACTATCAGAATAAAGG - Intronic
1133636207 16:7668179-7668201 GGAAAGACCTTGAAGAACAAAGG - Intronic
1133956192 16:10446059-10446081 GGGAAGCCCTTGAAGAAGTAGGG - Intronic
1134030508 16:10988736-10988758 GGGAACACCTAGTAAAATCAGGG - Intronic
1134514394 16:14875021-14875043 TGGAAGACCTAGAAGAAAGACGG - Exonic
1135202533 16:20450949-20450971 TGGAAGAACTAGAGGAATAGGGG + Intergenic
1135216571 16:20576917-20576939 TGGAAGAACTAGAGGAATAGGGG - Intergenic
1137515769 16:49142728-49142750 GGGAAGACTCAGAAGAGAAAAGG + Intergenic
1139967567 16:70754240-70754262 GGGAACATCTGGAAGAATGAGGG + Intronic
1140230272 16:73112208-73112230 GGGAAGACAGAGAAGAAGAGAGG + Intergenic
1140867683 16:79078216-79078238 AGCAAGACCTAGAAAAATACTGG - Intronic
1141105683 16:81231776-81231798 GGGAAGAGCTAGGAGAGCAAAGG - Intergenic
1142213943 16:88821814-88821836 GGGAAGACCCAGGAGCATCAGGG - Intronic
1142701095 17:1661373-1661395 TAGAAGACCTAGAAGATTCATGG - Exonic
1142857679 17:2741109-2741131 GGTAGGACTTAGAAGAATGAAGG + Intergenic
1143600111 17:7939640-7939662 GGGCTGCCCTAGAAGAAGAACGG + Exonic
1144089187 17:11838565-11838587 GTGAAGACCCAGATGAATGAAGG + Intronic
1146291726 17:31612614-31612636 GGTAAGACCTGGAAGATAAATGG - Intergenic
1149426670 17:56561427-56561449 GGGAAGACCTTGATGAACATGGG + Intergenic
1149726802 17:58903273-58903295 GGCAAGACCTCAAAGAAGAATGG - Intronic
1151459496 17:74246090-74246112 GGGAAGCCCTGGAAGAAGGAAGG + Intronic
1152170654 17:78745182-78745204 GGGAAGACCTCGAAGAACTCTGG + Intronic
1155275584 18:24184459-24184481 GGTAGGACATAGAGGAATAAAGG - Intronic
1155596020 18:27488497-27488519 AGAAAGCCCTAGAAGATTAAGGG + Intergenic
1155663860 18:28283250-28283272 GAGAAAACCTAGAAGATCAAGGG - Intergenic
1156575171 18:38306310-38306332 GTGAAAACCAAGAAGAAGAAAGG - Intergenic
1157031336 18:43912118-43912140 GGGAAGAAGCAGAAGAAGAAAGG - Intergenic
1158799411 18:60889089-60889111 GGGAAAAGCTAGAAGCAGAAGGG - Intergenic
1163717334 19:18879849-18879871 GGGAAGACCTGGCAGAGAAAGGG - Intronic
1164250319 19:23469908-23469930 GAGAAGAACTAGAAGAGAAAAGG - Intergenic
1164570724 19:29372467-29372489 GGGAAGACCCAGGAGAAAGAAGG + Intergenic
1165035825 19:33032952-33032974 GGCAAGAGAAAGAAGAATAAAGG - Intronic
1166439548 19:42800126-42800148 GGGAGGAACTAGAAGAATTCAGG + Intronic
1166457586 19:42955667-42955689 GGGAGGAACTAGAAGAATTCAGG + Intronic
1166467910 19:43050104-43050126 GGGAGGAACTAGAAGAATTCAGG + Intronic
1166474530 19:43110893-43110915 GGGAGGAACTAGAAGAATTCAGG + Intronic
1166495179 19:43296445-43296467 GGGAGGAACTAGAAGAATTCAGG + Intergenic
1166722178 19:45002849-45002871 GGGAAGGGCTAGAAGAGGAAGGG + Intronic
925690994 2:6523145-6523167 TGGAAGACCTACAAGAATTGAGG - Intergenic
926823825 2:16882432-16882454 GGGAAGACATTGGGGAATAAAGG - Intergenic
929909546 2:46077610-46077632 GTGAAGGCCTAGTAGAATAAGGG + Intronic
929954825 2:46448967-46448989 AGCAAGATCTAGAAGAATCAGGG - Intronic
930369363 2:50483985-50484007 GGGAAGACCCAGTGGTATAAAGG + Intronic
931407449 2:61993568-61993590 TGGAAGAGAGAGAAGAATAAAGG + Intronic
932320381 2:70817920-70817942 GGAAAGACCTTGCAGATTAAAGG - Intronic
933399915 2:81782712-81782734 AAGAAGACCTATAAGAATTATGG - Intergenic
933465751 2:82648978-82649000 GGGAAGACAGATAAGAATAATGG + Intergenic
934561865 2:95317693-95317715 GGGGAGTCCTAGAAAAAGAAAGG + Intronic
937494511 2:122403439-122403461 GGGATGAAGTAGAAGCATAAGGG - Intergenic
937845839 2:126577890-126577912 CAGAAGACCAAGAATAATAAAGG + Intergenic
939622353 2:144435796-144435818 GGGAAGACAAGGAGGAATAAAGG - Intronic
939817930 2:146919646-146919668 GTCAAGACCCAGAAGAAGAAAGG + Intergenic
940506747 2:154565293-154565315 GTGAAGGCCTACAAGAATTATGG - Intergenic
941436827 2:165482906-165482928 GGCAAAACCTAGAACAAGAATGG - Intronic
942228419 2:173837103-173837125 GGGAAGACTTAGAGGAAGAATGG + Intergenic
945372176 2:209032706-209032728 AGGAAGATCTAGAAGATAAAAGG - Intergenic
945632746 2:212302958-212302980 GGGAGGAGAAAGAAGAATAAAGG + Intronic
946291413 2:218748255-218748277 GTGAAGGCCTAGAGGAATACAGG + Intronic
946995508 2:225386482-225386504 GAGAAGACCTGGAAGAACAGAGG - Intergenic
947983577 2:234429800-234429822 GGGAAGACCAAGAGGACTCAGGG - Intergenic
1168787205 20:550223-550245 GGCTAGTCCTAGAAGAATAAAGG + Intergenic
1169569943 20:6895216-6895238 GGGGAGAGGTAGAAGAAAAAAGG - Intergenic
1170103879 20:12732629-12732651 GGGAAGAACTATAAGGAAAATGG + Intergenic
1171494044 20:25542416-25542438 GAGGAGACCAAGAAGAAGAATGG + Intronic
1173151662 20:40571506-40571528 GGGAAGACCAAGACTAAGAAAGG + Intergenic
1173343009 20:42170392-42170414 GAGAAAAGATAGAAGAATAAAGG + Intronic
1173393524 20:42656479-42656501 AGGAAAACAGAGAAGAATAAAGG + Intronic
1173979707 20:47214293-47214315 GGGAAGACTGAGAAGACTGACGG + Intronic
1175003916 20:55662104-55662126 AGAAAGACCTAGATGAATAATGG - Intergenic
1178668402 21:34568767-34568789 AGGAAGACATTGAAGAAAAAAGG - Intronic
1179963781 21:44788235-44788257 GTGAATACCTAGTACAATAACGG + Intronic
1180017242 21:45095440-45095462 GGGAAGAGCTAACAGAAAAAGGG - Intronic
1183194051 22:36341048-36341070 GGGAAGAACAGGAAGAAGAAGGG + Intronic
1185214888 22:49593081-49593103 AGGAAGTCCCAGAAGAACAATGG - Intronic
1185427051 22:50777906-50777928 GGGAAGACCCACAGGAACAAGGG + Intronic
950681185 3:14586130-14586152 GGGAAGACCTGGAAGAAAAGTGG - Intergenic
951644670 3:24875902-24875924 GTGAAGACCTTGAAGGACAAGGG - Intergenic
951916959 3:27811319-27811341 TGGAAGACCTAGAACACAAAGGG - Intergenic
952961514 3:38594035-38594057 GAGAAGACATAGAAGAAAGAAGG - Intronic
955200547 3:56848201-56848223 GGGAATAGGTAAAAGAATAATGG + Intronic
955500907 3:59581814-59581836 GCACAGAGCTAGAAGAATAATGG + Intergenic
957170610 3:76732236-76732258 GGGAAGTCTTAGAAGACTGAAGG + Intronic
957202847 3:77159286-77159308 GGGAATAACTAAAAGAAAAAGGG - Intronic
959991624 3:112638143-112638165 GAGAAGAGCAAGAAGAAAAAAGG - Exonic
960069887 3:113417943-113417965 GACAAGACCTAGAAGGGTAAAGG - Intronic
961472496 3:127124928-127124950 GGAAAGCCCTAGAAGGAGAATGG + Intergenic
963418261 3:145026899-145026921 TGGAAGACCCAGAAGAATACAGG + Intergenic
963539781 3:146570918-146570940 GGAGAGACCTAGTAGAAAAATGG - Intergenic
964069384 3:152613190-152613212 TGTAAGACCTAGAAGGATAAGGG + Intergenic
964735809 3:159915679-159915701 GGGAAGCACTAGAAGAATCCAGG - Intergenic
965117593 3:164512225-164512247 GGGAAGACATGGAATTATAATGG - Intergenic
965508176 3:169539313-169539335 GGGAAGGCCTAAAGGAATCAGGG - Intronic
967223480 3:187269148-187269170 GTTAAGACCTAGAAGATTTAAGG + Intronic
967859171 3:194138889-194138911 AGGAGGAGCTAGAAGAACAAGGG - Intergenic
968276149 3:197441908-197441930 GGGAAGACCTAGAGGACTCTGGG + Intergenic
968411311 4:393082-393104 GGGAAGGCAGAGGAGAATAAAGG - Intergenic
968451615 4:678664-678686 AGGAAGACCAAGAAGAAGGAAGG + Exonic
969916713 4:10498562-10498584 GAGAAGATATAGAAGGATAAAGG + Intronic
971480290 4:27108870-27108892 AGGAAGCCCCAGAAGAAAAAAGG - Intergenic
971676198 4:29632520-29632542 GAGAACACCCTGAAGAATAAAGG + Intergenic
971983187 4:33781862-33781884 GAATAGACCTAGAAGAATAAAGG + Intergenic
971985062 4:33811366-33811388 TGGAAAACCTAGAAGGATAGAGG - Intergenic
972078111 4:35112093-35112115 TGGAAGATCTAGAAAAGTAAAGG - Intergenic
972729946 4:41784509-41784531 GGGAAGAACAAAAAGAATTAAGG - Intergenic
974715020 4:65658112-65658134 GGCAACACCTAGAATAAAAATGG + Intronic
974753194 4:66168413-66168435 GTGAAGAACAAGAAGAATGAAGG - Intergenic
975340293 4:73232232-73232254 TGGAAGAGCTAGAAGAAGGAAGG - Intronic
976635121 4:87279619-87279641 GGGAAGAAATGGAAGAAGAAAGG + Intergenic
977331317 4:95641086-95641108 GGGAAGAGCTAGGAGTGTAAAGG - Intergenic
977344383 4:95799099-95799121 GGGAACACCCACAAGAAAAAAGG - Intergenic
978057091 4:104283484-104283506 AGCAAGACCTAGAAAAATGAAGG + Intergenic
978333998 4:107646576-107646598 GGGAAGTGCTCAAAGAATAATGG + Intronic
980850565 4:138375855-138375877 TGGAAAATCTAGAAGAAAAATGG + Intergenic
981422345 4:144565547-144565569 GGGAAGAACCAGAAAAACAAAGG - Intergenic
981533660 4:145777132-145777154 GGGACCACCTATAACAATAATGG - Intronic
981680347 4:147390330-147390352 GGGAATAACAATAAGAATAAAGG + Intergenic
983574279 4:169243193-169243215 GGCAAGGCATATAAGAATAAGGG + Intronic
984035429 4:174661814-174661836 GGGAAGAACAAGAAAAAGAATGG + Intronic
985300208 4:188480553-188480575 AGAAAGAGCTAGAAGAAGAAGGG - Intergenic
986773039 5:10990511-10990533 GGGAAGACCCAGAGGCAAAAGGG - Intronic
987683693 5:21169255-21169277 GGGAAGACCAAGAAGAGGAATGG + Intergenic
989704605 5:44313834-44313856 AGGAAGACCTAGGAGGAGAAGGG + Intronic
992553954 5:77885298-77885320 GGGAAGACAAAGATGAAAAAGGG + Intergenic
992731965 5:79680631-79680653 GGAAAGACCTAGAAAAAGTACGG - Intronic
993046929 5:82877715-82877737 TGGAAAACCTAGAAAAATATGGG - Intergenic
993159020 5:84264385-84264407 GGGAAAACATAGAAAAATGATGG + Intronic
995153526 5:108881232-108881254 GGGAAGACAAAGAAGTTTAATGG + Intronic
997436540 5:133879825-133879847 TGGCAGACATAGAAGAATGAGGG + Intergenic
998734062 5:145114713-145114735 AGGAAGTGCTAGAAGAAGAAAGG + Intergenic
1002392905 5:178929697-178929719 TGGAAGACCCAGAAGAAGATAGG - Intronic
1003179803 6:3781831-3781853 AGGAAGATGTAGAAGAAAAATGG + Intergenic
1004478909 6:16000389-16000411 GGGAAGAGCTGGAAGAACTAGGG + Intergenic
1004999050 6:21222610-21222632 GGGAATGTCTAGAAGAATAAAGG + Intronic
1005339831 6:24833073-24833095 GAGAAGACCTAAGAGAAGAAAGG + Intronic
1006174344 6:32112905-32112927 GAGAAGACCAAGAAAAACAAAGG + Intronic
1008592709 6:53010055-53010077 GGGAAGAAGGAGAAGGATAAAGG - Intronic
1010669023 6:78664446-78664468 GGGATCACCAAGAAGAAAAATGG + Intergenic
1011201007 6:84836038-84836060 GGAAAGATCTAGAAGAGCAATGG - Intergenic
1011845739 6:91561273-91561295 TGGAAGACTTAGAAGAAGACAGG - Intergenic
1013679175 6:112503898-112503920 GGGAAGGGATAGAGGAATAATGG + Intergenic
1014475696 6:121870205-121870227 AGGAAGACGGAGAAGAAAAAAGG - Intergenic
1014533119 6:122583974-122583996 GGGAAGTCATAGAAGAATGAGGG + Intronic
1014750237 6:125246830-125246852 GAAAAGACCAAGCAGAATAAGGG - Intronic
1015178527 6:130337570-130337592 TGGAGGGCCTAGAAGAAGAAAGG + Intronic
1016393250 6:143596240-143596262 ATGAAGACCTAGAGGAATAAAGG - Intronic
1018294132 6:162327856-162327878 GGGAACACGAAGAAGCATAATGG + Intronic
1020393704 7:7688705-7688727 GGCAAGACATACAAAAATAAAGG - Intronic
1021062132 7:16126316-16126338 GGGAAATCCTAGAAGGAAAAAGG + Intronic
1021087777 7:16443756-16443778 GAGAAAACCTAGGAGAATTAGGG + Intergenic
1021222755 7:17992330-17992352 TGCAAGACCTAGAAGAAGAAAGG - Intergenic
1021782751 7:24122097-24122119 AGGAAGAACTCAAAGAATAATGG - Intergenic
1021928259 7:25553960-25553982 GGGAAGCCCTAGAGGAAAGAAGG - Intergenic
1022192731 7:28032884-28032906 GGGAGGACCAAGAGGTATAAGGG - Intronic
1022608345 7:31839693-31839715 GTGAATACCTAGAAGCAGAATGG + Intronic
1023357547 7:39382418-39382440 GGGAAGACCTAGAGGAACCGAGG + Intronic
1023638906 7:42238318-42238340 GAGAAGCCTTAAAAGAATAAAGG - Intergenic
1024871282 7:53964181-53964203 TGGAGAACCTAGAAGGATAAAGG - Intergenic
1029906736 7:104100478-104100500 GGGAAGGCCTAGAAGAAAGATGG - Intergenic
1031438987 7:121769612-121769634 GGGAAGGCCTAGAAGAAGCTGGG - Intergenic
1033090739 7:138383828-138383850 GGGAAGAACTGTAAGAGTAAAGG + Intergenic
1036476385 8:9097052-9097074 CGGGAGAGCTAGAAGAGTAAAGG - Intronic
1039743605 8:40404230-40404252 GGGGAGACCAAATAGAATAAGGG + Intergenic
1041096827 8:54358734-54358756 GGGAAAAACTAGAATATTAATGG - Intergenic
1043283309 8:78496929-78496951 AGGAAGACAAAGAAGAATAGGGG - Intergenic
1043670119 8:82874106-82874128 TGAAAGACCTAGAAGAATTGAGG + Intergenic
1044469267 8:92547409-92547431 GGGAAGACCCAGAGGAAGACAGG - Intergenic
1045395564 8:101757507-101757529 GAGAAGAGCAAGAAGAAAAATGG + Intronic
1046262515 8:111787672-111787694 GTGAAAACCTAGAAGAGTAATGG - Intergenic
1047362969 8:124185672-124185694 AGGAAGTCCTTGAAGAATGATGG + Intergenic
1048065723 8:130966449-130966471 GGGAAGTCCCAGAAAAATGAAGG + Intronic
1054730984 9:68702874-68702896 GGAAAGACCTTGGAGAAAAAAGG + Intergenic
1055373766 9:75626702-75626724 GGGATGACCTCGAAGAAAACTGG + Intergenic
1055940895 9:81648365-81648387 GGGAAAAACTGTAAGAATAATGG + Intronic
1056569029 9:87799688-87799710 GGGCAGACCTAGAAGAAGCAGGG + Intergenic
1056702567 9:88923359-88923381 GGGAACACCTGGAGGAAAAATGG - Intergenic
1058197413 9:101995215-101995237 AGCAAGACCTAGATTAATAATGG + Intergenic
1058420894 9:104832294-104832316 AGGAAAACCTAGAAGAAAATGGG + Intronic
1058738456 9:107918875-107918897 GGGAATGCCCAGAACAATAAAGG - Intergenic
1059754755 9:117282126-117282148 GGAGAGACATAGAAAAATAAAGG - Intronic
1059920862 9:119158346-119158368 GGGAAGGCCAAGGAGCATAAAGG + Intronic
1187414385 X:19080345-19080367 GGGCAGACCCTGAAGAATGAGGG - Intronic
1187878927 X:23828371-23828393 GAGAACACATAGAAGAACAAGGG - Intergenic
1187953163 X:24490961-24490983 GGGAAGAAGTAGAAGAATTCTGG - Intronic
1189599305 X:42605585-42605607 AGGAAGACCCAGAAGAAGAAAGG - Intergenic
1192365585 X:70470057-70470079 GGGAAGACATGGCTGAATAATGG - Intronic
1194318476 X:92411969-92411991 GGGAAGAAGAAGAAGAAGAAGGG + Intronic
1194918367 X:99732447-99732469 AGGTAGAGCTAAAAGAATAAGGG - Intergenic
1195247022 X:103004079-103004101 TGGGAGGCCTAGAAGATTAAAGG - Intergenic
1195345262 X:103944029-103944051 GGCAAGAGCTAGAAGAATCCAGG + Intronic
1196137226 X:112223066-112223088 GGGAAGACAAAGAGGAAGAAGGG + Intergenic
1197589952 X:128396326-128396348 GGGAAGAATGATAAGAATAAGGG - Intergenic
1197893665 X:131288969-131288991 GGGAAGACTGAGAAGGAAAAGGG + Intronic
1198029068 X:132737493-132737515 GGGAGGAACTAGAAGATAAAGGG - Intronic
1199546716 X:149013898-149013920 AGGAAGCCCTATAAGAAGAATGG + Intergenic
1199834731 X:151577834-151577856 GGAAACAACTTGAAGAATAAAGG - Intronic
1200384820 X:155880154-155880176 GGAAAGAGCTAACAGAATAAAGG + Intergenic
1202076022 Y:21038724-21038746 GGAGAGACCTAATAGAATAAAGG + Intergenic