ID: 1103867714

View in Genome Browser
Species Human (GRCh38)
Location 12:124066311-124066333
Sequence CCTGATCAGCAGAAATTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103867714_1103867717 -6 Left 1103867714 12:124066311-124066333 CCTCACAATTTCTGCTGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1103867717 12:124066328-124066350 ATCAGGAGCCCAGATCCATAGGG 0: 1
1: 0
2: 0
3: 6
4: 108
1103867714_1103867723 26 Left 1103867714 12:124066311-124066333 CCTCACAATTTCTGCTGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1103867723 12:124066360-124066382 CTGCAGTCAAGTTGTTGACTGGG 0: 1
1: 3
2: 30
3: 120
4: 504
1103867714_1103867716 -7 Left 1103867714 12:124066311-124066333 CCTCACAATTTCTGCTGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1103867716 12:124066327-124066349 GATCAGGAGCCCAGATCCATAGG 0: 1
1: 0
2: 0
3: 21
4: 255
1103867714_1103867720 3 Left 1103867714 12:124066311-124066333 CCTCACAATTTCTGCTGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1103867720 12:124066337-124066359 CCAGATCCATAGGGCTTATGTGG 0: 1
1: 0
2: 0
3: 9
4: 86
1103867714_1103867722 25 Left 1103867714 12:124066311-124066333 CCTCACAATTTCTGCTGATCAGG 0: 1
1: 0
2: 1
3: 14
4: 155
Right 1103867722 12:124066359-124066381 GCTGCAGTCAAGTTGTTGACTGG 0: 1
1: 4
2: 22
3: 114
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103867714 Original CRISPR CCTGATCAGCAGAAATTGTG AGG (reversed) Intronic
906037765 1:42763131-42763153 CCTGAGCTGAAGAAATTCTGTGG + Intronic
907444243 1:54497845-54497867 CCTAATCCACAGAAATTATGAGG + Intergenic
911195146 1:94987028-94987050 CCAGAACAGTAGAAAATGTGCGG - Intronic
912059516 1:105648595-105648617 CCTGACCCACAGAAAATGTGAGG + Intergenic
912080790 1:105933201-105933223 ACTGATCTACAGCAATTGTGAGG - Intergenic
912126823 1:106549771-106549793 CCTGACCAGCATGAATTGAGGGG - Intergenic
914464753 1:147917020-147917042 CCTGACCTACAGAAACTGTGAGG - Intergenic
916595231 1:166236479-166236501 CCTGAGCAGCTGATGTTGTGTGG + Intergenic
919457991 1:197842757-197842779 CCTGATTAGGAGTCATTGTGAGG - Intergenic
921215412 1:212932871-212932893 CATGATCAGAAAAAATTATGGGG - Intergenic
921596981 1:217065139-217065161 TCTGAGCAGCAGAATTTATGGGG - Intronic
924752254 1:246905029-246905051 AGTTATCAGAAGAAATTGTGCGG - Intronic
1064016076 10:11773291-11773313 CCTGAACAGCAGACATTGGATGG - Intergenic
1073232968 10:101988066-101988088 CCTGAACCACAGAAACTGTGAGG + Intronic
1074123134 10:110508139-110508161 CCTGGGGAGCAGAAATTGTGTGG - Intronic
1075670155 10:124258946-124258968 CCTGACCTGCAGAAACTGTGTGG - Intergenic
1079394575 11:20050739-20050761 CCTGGGCCGCAGAAATTGAGAGG + Intronic
1079562814 11:21843922-21843944 CCTGATCCATAGAAACTGTGAGG + Intergenic
1080261596 11:30355220-30355242 CCTGACCAATAGAAATTGTGAGG - Intergenic
1082020062 11:47525033-47525055 CCAGATCAGCAGTAGTGGTGAGG + Intronic
1084479512 11:69410599-69410621 CCAGCTCAGCAGACACTGTGTGG - Intergenic
1084590899 11:70089631-70089653 CCTGATCATCAAAACTTGTAAGG - Intronic
1087261944 11:96021806-96021828 CCTGATTAACAGAGGTTGTGAGG + Intronic
1089628880 11:119771061-119771083 CCTGACCCACAGAAACTGTGAGG - Intergenic
1091321176 11:134653052-134653074 CCAGACCAGCAGAAGTTGAGTGG - Intergenic
1092144204 12:6203412-6203434 CTTGAAAAGCAGGAATTGTGAGG + Intronic
1097336338 12:58387962-58387984 CCTGATCCACAGAAATTGTAAGG - Intergenic
1100419563 12:94418410-94418432 GCTCATCAGCAGAAATAGAGAGG + Intronic
1102532521 12:113557314-113557336 CCTGACCCACAGAAACTGTGAGG - Intergenic
1103867714 12:124066311-124066333 CCTGATCAGCAGAAATTGTGAGG - Intronic
1105252800 13:18715767-18715789 TCTGATCAGAAGTATTTGTGAGG - Intergenic
1108011853 13:46023371-46023393 CCCAATCAGTAGAAATTGTAGGG - Intronic
1112382895 13:98909810-98909832 CATGCTCAGCAGAACTTGTCAGG - Intronic
1112676523 13:101708416-101708438 CCTGACCAGCAGAGGTTTTGAGG - Intronic
1113433943 13:110274515-110274537 CCTGACCAGGAGGAATTGAGAGG - Intronic
1114838832 14:26237992-26238014 CCTAATCTGCAGGAATTCTGAGG - Intergenic
1117043184 14:51786561-51786583 CATGATCAGCTTACATTGTGCGG - Intergenic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1119971252 14:78973008-78973030 CTTGGACAGCAGCAATTGTGGGG + Intronic
1120302847 14:82730244-82730266 CCTGATCCGCAAAAATCGTTTGG - Intergenic
1120631717 14:86899814-86899836 CCTAATCAGAAGAACTAGTGGGG + Intergenic
1124145289 15:27119536-27119558 CCTGACCTGCAGAAATCATGAGG - Intronic
1124171015 15:27373835-27373857 CCTGATCAGGAGAACTGATGAGG - Intronic
1125990800 15:44105827-44105849 CTTAATAAGAAGAAATTGTGTGG - Intronic
1126371420 15:47951077-47951099 CCTTATCTTCAGAAATTCTGGGG + Intergenic
1128717873 15:69921892-69921914 GCTGATCAGCTGAGGTTGTGGGG + Intergenic
1129883312 15:79021182-79021204 CCTGACCCACAGAAATTGTGAGG + Intronic
1129919082 15:79303409-79303431 ACTGATCATCAGAAAGTGAGTGG - Intergenic
1129941249 15:79498573-79498595 CCTGTTCAGGAGAATGTGTGAGG - Intergenic
1131192056 15:90324708-90324730 CCTGATTAGCAGCAGTTGTGAGG - Intergenic
1131230541 15:90655759-90655781 CCTCATTATCAGAAGTTGTGAGG + Intergenic
1131874456 15:96790022-96790044 CCTGCTCAACAGTAATGGTGAGG - Intergenic
1134192617 16:12134327-12134349 CCTAATTCACAGAAATTGTGGGG - Intronic
1135652878 16:24222279-24222301 CCTGATCCACAGACATTGAGAGG - Intergenic
1137348122 16:47684036-47684058 CCTGACCAGCTGAAATTTTCTGG - Intronic
1137667549 16:50260567-50260589 CCTGACCTACAGAAATTATGAGG - Intronic
1143925129 17:10362881-10362903 CCTCATGAGCAGAGATTTTGAGG - Intronic
1144394113 17:14826918-14826940 TCTGCTCATCAGAAATTCTGGGG + Intergenic
1148456710 17:47815062-47815084 CCAGATCAGCTGAGTTTGTGTGG - Intronic
1150329644 17:64284582-64284604 CAGGATCAGCAGGAATGGTGTGG - Intergenic
1151138929 17:71973308-71973330 CCTTATTTGCAGAAAGTGTGTGG + Intergenic
1152321049 17:79609052-79609074 CCAGGTGAGCAAAAATTGTGAGG - Intergenic
1155521366 18:26672206-26672228 ACTGTTCAACAGAAAGTGTGTGG - Intergenic
1157040891 18:44037555-44037577 TAGGATCAGCAGAAATTGAGTGG + Intergenic
1157479795 18:48046109-48046131 CCTGATCCACAGAAACTATGAGG + Intronic
1159874762 18:73798293-73798315 TCTGATCAGCAGAAAATTTTCGG - Intergenic
1159994917 18:74955169-74955191 GCTGAGCTGCAGAAGTTGTGGGG + Intronic
1160148323 18:76381755-76381777 GCTGATCAGCAGAACTGGTGCGG + Intronic
1162545471 19:11326546-11326568 TCTGTGCAGCAGAAATTGGGTGG - Intronic
1163998236 19:21072592-21072614 CATGATCTTCAGAATTTGTGGGG + Intergenic
1165122351 19:33568371-33568393 CATGGTCAGTAGAAATGGTGGGG - Intergenic
1165367521 19:35377650-35377672 CCTGGTAAGCAGAGGTTGTGAGG + Intergenic
1166427229 19:42689618-42689640 CCTGACCATCAGGTATTGTGAGG - Intronic
1167442292 19:49515305-49515327 CCTGGGCAACAGAGATTGTGCGG - Intronic
927882462 2:26698290-26698312 GCTGCCCTGCAGAAATTGTGGGG - Intronic
931556954 2:63516739-63516761 CCTGATGCACAGAAACTGTGAGG + Intronic
933155311 2:78966501-78966523 CCTGATCTGTGGAAACTGTGAGG + Intergenic
934550558 2:95258787-95258809 CCTCATCACCAGAAACTGTAGGG + Intronic
935683900 2:105666873-105666895 TCTGATCTGTAGAAACTGTGAGG - Intergenic
937324742 2:120983709-120983731 CCTGAGCGACAGTAATTGTGTGG - Intronic
937843791 2:126554997-126555019 CTAGATCAGCAGTAACTGTGGGG + Intergenic
937889913 2:126930958-126930980 CCTGAGCAGCAGGAATAGTGTGG + Intergenic
938210055 2:129459652-129459674 CCAGATCAGCACAAAATGAGAGG + Intergenic
939685077 2:145189119-145189141 CCTGACCTGCAGAAATTGTGAGG + Intergenic
940689449 2:156897013-156897035 CTTGATAAGCAGAATTTGTAAGG + Intergenic
941869057 2:170364736-170364758 CCTGGTCAGCAGAGATTTAGTGG - Intronic
942900976 2:181117948-181117970 TCAGACCAGCAGGAATTGTGAGG + Intergenic
943323911 2:186475452-186475474 CCTGACCAACAGAAACTTTGAGG - Intergenic
943884893 2:193204068-193204090 ACTGACCAGCTGAAAATGTGGGG - Intergenic
947764118 2:232624874-232624896 CATGACCAGCAGAAAGTGAGGGG - Intronic
1170081661 20:12483502-12483524 CCTGAACAGAAGAAAATCTGTGG + Intergenic
1175617635 20:60414795-60414817 CCTAAGAAGCAGAAACTGTGTGG - Intergenic
1176838315 21:13815654-13815676 TCTGATCAGAAGTATTTGTGAGG - Intergenic
1181181012 22:21068363-21068385 CTTGGACAGCAGAATTTGTGTGG + Intergenic
1182018841 22:27063884-27063906 CCAGGTCAGGAGAAATTGAGTGG + Intergenic
1185135698 22:49070909-49070931 CCTCATCAGCAGGCAGTGTGAGG - Intergenic
951922654 3:27873189-27873211 TCAGGTCAGCAGAAATTGGGTGG + Intergenic
952396238 3:32922873-32922895 CCTGATTAGGAGGAATTGTTGGG + Intergenic
952656478 3:35792509-35792531 CCTGATAAGAAGACATTGTTGGG - Exonic
954794590 3:53155071-53155093 CCTGGGCAGCAGTAATGGTGAGG - Intergenic
954839694 3:53499501-53499523 CCTTATCAGAAGGAATTGTTAGG + Intronic
955340376 3:58120786-58120808 TCTGGTCAGCAAAGATTGTGGGG + Intronic
956296847 3:67724227-67724249 GCTGAAGAGCAGAATTTGTGGGG + Intergenic
956837018 3:73103831-73103853 CCTCATCAGCATATCTTGTGTGG - Intergenic
959002199 3:100977333-100977355 CCTGATCCACAGAAACTGTATGG - Intronic
961528115 3:127520823-127520845 CCTGAGCAGCTGGAATTATGTGG - Intergenic
964405485 3:156344121-156344143 CCTGATAAAAAGACATTGTGGGG - Intronic
967647867 3:191948504-191948526 CCTGATCAGAGAAAATTCTGAGG - Intergenic
969230231 4:5825446-5825468 CCTGAACTGCTGCAATTGTGGGG + Intronic
969549010 4:7851932-7851954 CCTGGTCAGAAGCAATGGTGTGG - Intronic
972071549 4:35025242-35025264 TCTGATCAACAGAAACTATGAGG - Intergenic
973843693 4:54889275-54889297 CCTGACCCACAAAAATTGTGAGG + Intergenic
974232575 4:59136011-59136033 TCTGATCAGCAGAAAATGTTAGG - Intergenic
974466621 4:62265245-62265267 CCTGATCCACATAAATTGTGAGG + Intergenic
975285561 4:72614582-72614604 TCTGACCCACAGAAATTGTGAGG + Intergenic
975566005 4:75754885-75754907 CCTGATCCACAGAAACTATGAGG - Intronic
976864664 4:89709535-89709557 GGTGATCAGTAGAAATTGGGGGG - Intergenic
977017812 4:91715451-91715473 CCTGCTCCACAGAAAGTGTGAGG + Intergenic
977442611 4:97088521-97088543 CCTGATCCACAGAAATTATGAGG - Intergenic
977996311 4:103500660-103500682 CCTGATCCACAGAAACTGTGAGG + Intergenic
978283510 4:107045783-107045805 CCTGGTGAGGAGAAATTGTTTGG + Intronic
978476504 4:109137058-109137080 CCTGACCCACAGAAACTGTGAGG + Intronic
981265441 4:142777576-142777598 CCTGACCCACAGAAACTGTGAGG + Intronic
984283293 4:177698427-177698449 CCTGAGAAGCAGGAATTTTGGGG - Intergenic
984831369 4:183977837-183977859 ACTGATCAACAGATGTTGTGAGG - Intronic
985155780 4:186986061-186986083 ACAGATCAGCAGAAATTCTTTGG - Intergenic
985234052 4:187853144-187853166 ACTGCTCAGCAGGAATAGTGAGG + Intergenic
987809383 5:22813916-22813938 CCTGACCCACAGAAACTGTGAGG + Intronic
990299081 5:54432697-54432719 GCTAATCAACAGAAATTGAGAGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991722375 5:69505828-69505850 TCTGATCACCAGAATTTGTGGGG + Intronic
992232244 5:74674939-74674961 GCTGATCCACAGATATTGTGAGG + Intronic
997878712 5:137571217-137571239 TCTTATCAGCAGGATTTGTGGGG - Intronic
999561745 5:152810936-152810958 ACTGTTCAGCAGAATCTGTGTGG - Intergenic
1000173706 5:158729044-158729066 CCTGCTCTGCAGAGATTGGGTGG + Intronic
1000366945 5:160500551-160500573 CCGGACCTACAGAAATTGTGGGG + Intergenic
1001768619 5:174275481-174275503 CCTGATCAACATAATCTGTGAGG + Intergenic
1008630243 6:53357557-53357579 CCTCATCTGCAGAAACTTTGAGG + Intergenic
1010163968 6:72893675-72893697 CCTGGGCAGCAAAAATGGTGTGG - Intronic
1010329567 6:74607319-74607341 CCAGGTCAGCAGAAAATTTGAGG - Intergenic
1011185918 6:84675731-84675753 GCTGATGAGCAGAACTTGAGAGG + Intergenic
1013830750 6:114269715-114269737 GCTGATAACCAGAAATTGTATGG - Intronic
1020941574 7:14545645-14545667 CCTGCTGAGCAGCTATTGTGAGG - Intronic
1023100254 7:36710574-36710596 TCTGATGTGCAGAAACTGTGAGG + Intronic
1023628364 7:42138872-42138894 CCTAATCAGTGGACATTGTGAGG - Intronic
1026811425 7:73469532-73469554 CCTCATCACCAGAGACTGTGTGG + Exonic
1028215047 7:88121457-88121479 CCTGATTCTCAGAAATTATGAGG - Intronic
1028661543 7:93283053-93283075 CTGGATCATCAAAAATTGTGAGG + Intronic
1033660777 7:143400370-143400392 TCTGAATAGCAGAAATTGTATGG - Intronic
1037057254 8:14457661-14457683 CCTGATATGCAGAAATAATGGGG + Intronic
1041202764 8:55466978-55467000 CCTGACCCACAGAAACTGTGAGG - Intronic
1041628382 8:60057181-60057203 GCTGCTCAGCAGAATATGTGAGG + Intergenic
1042424830 8:68635378-68635400 ACTGATATGAAGAAATTGTGTGG - Intronic
1047821113 8:128521859-128521881 CCTGACCCGCAGAATCTGTGAGG + Intergenic
1048359642 8:133686855-133686877 CAGGATCAGTAGAAATTGGGTGG + Intergenic
1048819135 8:138363713-138363735 CCTGATCAGGACAAATTATCAGG + Intronic
1051478210 9:17531960-17531982 CCTGACCAGCAGACACTGTTGGG - Intergenic
1051683716 9:19634929-19634951 CTTCATCAGCAAAAATTGAGTGG - Intronic
1055723255 9:79199295-79199317 CCTGTTCAGATGAAAGTGTGAGG + Intergenic
1057644933 9:96865154-96865176 CCTGGTCAGAAGAGAATGTGGGG - Intronic
1059530886 9:115034399-115034421 CATGATCAACAGACATTGGGTGG + Intronic
1185988753 X:4868535-4868557 CATGATCATCAGAGATTGTTGGG - Intergenic
1186941269 X:14510302-14510324 CCAGCTCAGCAGAAATTTGGTGG - Intergenic
1189744973 X:44159658-44159680 CTTTATCAGCAGAAATGATGAGG + Intronic
1190145166 X:47884367-47884389 CCTGACCTACAGAAACTGTGAGG - Intronic
1192670961 X:73140717-73140739 CCTGTTCAGGTGAAACTGTGGGG + Intergenic
1193700268 X:84751622-84751644 CATGATCCACAGAAATTATGAGG - Intergenic
1198791525 X:140352127-140352149 TCTGATGAGGAGAAATTGGGAGG + Intergenic
1198974097 X:142315718-142315740 CCTGACCAACAGAAACTGTGAGG + Intergenic
1199162625 X:144631763-144631785 GCTGATAAGCAGAAATTATAAGG + Intergenic
1199466957 X:148148766-148148788 CCTGATGCACAGAAACTGTGAGG + Intergenic