ID: 1103868495

View in Genome Browser
Species Human (GRCh38)
Location 12:124073277-124073299
Sequence CCACTCTGCCTGGCAAAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 8, 3: 106, 4: 595}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103868481_1103868495 10 Left 1103868481 12:124073244-124073266 CCCTCCCTGTCTCCATTCTATCC 0: 1
1: 1
2: 7
3: 126
4: 1347
Right 1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG 0: 1
1: 0
2: 8
3: 106
4: 595
1103868483_1103868495 6 Left 1103868483 12:124073248-124073270 CCCTGTCTCCATTCTATCCCCAG 0: 1
1: 0
2: 3
3: 34
4: 349
Right 1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG 0: 1
1: 0
2: 8
3: 106
4: 595
1103868482_1103868495 9 Left 1103868482 12:124073245-124073267 CCTCCCTGTCTCCATTCTATCCC 0: 1
1: 2
2: 5
3: 56
4: 697
Right 1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG 0: 1
1: 0
2: 8
3: 106
4: 595
1103868487_1103868495 -2 Left 1103868487 12:124073256-124073278 CCATTCTATCCCCAGGGCCTCCC 0: 1
1: 0
2: 3
3: 55
4: 539
Right 1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG 0: 1
1: 0
2: 8
3: 106
4: 595
1103868484_1103868495 5 Left 1103868484 12:124073249-124073271 CCTGTCTCCATTCTATCCCCAGG 0: 1
1: 0
2: 4
3: 18
4: 293
Right 1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG 0: 1
1: 0
2: 8
3: 106
4: 595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103868495 Original CRISPR CCACTCTGCCTGGCAAAGAA CGG Intronic
900547147 1:3235534-3235556 CCCCGCTGCCTGGCAGAGAAAGG + Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900961664 1:5925900-5925922 CCACCGTGCCTGGCCAGGAATGG + Intronic
900983125 1:6057861-6057883 CCACTGTGCCTGGCCATGACTGG - Intronic
902360237 1:15938401-15938423 CCACTGTGCCTGGCCAGTAACGG + Intronic
902915494 1:19636610-19636632 CCACTGCGCCTGGCCAAGAGTGG - Intronic
902973382 1:20071309-20071331 GCACTCTGCATGGCACAGATTGG - Intronic
903412498 1:23157387-23157409 CCACTGTGCCTGGCCTAGGACGG - Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
905178528 1:36152935-36152957 CCACTGTGCCTGGCCAGGATAGG + Intronic
905376174 1:37522272-37522294 CCACTGTGCCTGGCCAAGAGCGG - Intergenic
905815890 1:40950574-40950596 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
906089311 1:43164797-43164819 GCACTGGGCCTGGAAAAGAATGG + Exonic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
906308638 1:44737828-44737850 CCACTGTGCCTGGCCAGGAAAGG - Intergenic
906339238 1:44963555-44963577 CCACTGTGCCTGGCCAACCAGGG + Intronic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
907508988 1:54944528-54944550 CCACTGTGCCTGGCCAAGATGGG - Intergenic
907531454 1:55102197-55102219 CCAATCTGGATGGCAAAAAAAGG + Intronic
908244142 1:62214411-62214433 CCACTGTGCCCGGCAGAGCAAGG - Intergenic
908754354 1:67454465-67454487 CCACCACGCCTGGCCAAGAAGGG + Intergenic
909815120 1:79983254-79983276 CCACTGTGCCTGGCCACAAAAGG - Intergenic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910671976 1:89782864-89782886 GGACTGTGCCTGGCAAAGAGTGG - Intronic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
912728265 1:112078177-112078199 CCACACTGCCTGGCTTAGCAAGG + Intergenic
914400056 1:147310663-147310685 CCACTGTGCCTGGCCAACAATGG - Intergenic
914454360 1:147822012-147822034 CCAGGCTACTTGGCAAAGAAAGG - Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
914795898 1:150920149-150920171 CCACAGTGCCCGGCCAAGAAGGG - Intergenic
914914994 1:151814212-151814234 GCACAATGCCTGGCAGAGAAGGG + Intronic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
916926594 1:169527904-169527926 CCCTTCTGCCTGGTAAAGATTGG - Exonic
917379687 1:174391627-174391649 CCACTGTGCCCAGCCAAGAAAGG + Intronic
919648995 1:200126802-200126824 CCACTCTGCCTGGCCTATGAAGG + Intronic
919834667 1:201565566-201565588 CCTCTCTGCCCTCCAAAGAAGGG - Intergenic
920057741 1:203205186-203205208 CCCCTGTGCTTGGCCAAGAAAGG + Intergenic
920082430 1:203385037-203385059 CCACTGCACCTGGCCAAGAATGG - Intergenic
920146802 1:203868340-203868362 CCACTAAGCCTGGCAATGAATGG + Intronic
920321449 1:205126311-205126333 CCATTGTGCCTAGAAAAGAAAGG + Intergenic
920505190 1:206510725-206510747 CCCCTATGCCAGGCAAAGAAGGG - Intronic
920547732 1:206832466-206832488 CCTCTCTGCCTTGCTCAGAAAGG - Intronic
921235005 1:213117733-213117755 CCACCATGCCTGGCCAAGTAAGG - Intronic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
922092461 1:222409974-222409996 CATCTCTGCCTGGGATAGAAAGG - Intergenic
922147418 1:222961718-222961740 CCACTGTGCCTGGCGATGATGGG - Intronic
922355754 1:224773766-224773788 CCAAGCTGCATGGGAAAGAAGGG + Intergenic
922697620 1:227739310-227739332 CCACTGTGCCTGGCCAGGACGGG + Intronic
922886852 1:229027094-229027116 CCACTGCGCCTGGCCAAGACGGG + Intergenic
923292931 1:232564363-232564385 CCACTGCTCCTGGCCAAGAAAGG + Intergenic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
923615004 1:235530169-235530191 TCCCTCTGCCTGAGAAAGAAGGG - Intergenic
923708316 1:236363876-236363898 CCACTAAGCCTGGCCAAGACTGG - Intronic
924001509 1:239558172-239558194 TCATTCTGACTGGCATAGAATGG + Intronic
924505543 1:244680158-244680180 CCACTGTGCCTGGCCATGGATGG - Intronic
924653748 1:245953704-245953726 CCACCGTGCCTGGCCAAGTAGGG + Intronic
1063157807 10:3396269-3396291 CCACTCTGACTGGCTCAGGACGG + Intergenic
1063231688 10:4071816-4071838 CCACTGTGCCCGGCCAAAAATGG - Intergenic
1063356730 10:5407537-5407559 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1063589893 10:7385710-7385732 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064198007 10:13261169-13261191 CCACTGTGCCTGGTCAAGAAAGG - Intergenic
1064294133 10:14062774-14062796 CCACTGTGCCTGGCCAGGACTGG - Intronic
1064585757 10:16837921-16837943 CCACTCAGCGGGGCACAGAATGG - Intronic
1065683806 10:28264007-28264029 CCACTGTACCTGGCCTAGAATGG - Intronic
1066097717 10:32088131-32088153 CCACTGAGCCTGGCCTAGAAAGG - Intergenic
1066266636 10:33782537-33782559 CCACTGTGCCTTGCCAAGAGTGG - Intergenic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066466467 10:35654540-35654562 CCACTGCGCCTGGCCAAGATAGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067537583 10:47125277-47125299 CCACCATGCCCAGCAAAGAAAGG + Intergenic
1067581837 10:47451234-47451256 CCACTGTGCCTGTCAAAGTTGGG + Intergenic
1067765059 10:49079117-49079139 CCACTGTGCCTGGCCAGAAATGG + Intronic
1068448926 10:57162034-57162056 CCACTGTGCCTGGCCAATGAGGG - Intergenic
1069071516 10:63994669-63994691 CCACTCAGGCTGCCCAAGAATGG - Intergenic
1069415992 10:68201477-68201499 CCACTGTGCCTGGTGGAGAAGGG - Intronic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1069970739 10:72166313-72166335 CCACTGTGCCTGGCTAGAAAAGG - Intronic
1070566080 10:77604893-77604915 CCAAGCTGCCTGACAAGGAAGGG - Intronic
1070803080 10:79254893-79254915 CCACTCTTGCTGGGGAAGAAGGG + Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1071671447 10:87612735-87612757 CCACTGTGCCCGGCCAAGACTGG - Intergenic
1071730132 10:88239663-88239685 CCACCCAGCCTGGGAAAGAAAGG - Intergenic
1072107017 10:92284012-92284034 CCACTGTGCCCGGCCCAGAATGG + Intronic
1072191547 10:93080466-93080488 CCTCTGAGCCTGGCATAGAAGGG - Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072415180 10:95241343-95241365 CCACTGTGCCTGGCAACAAGGGG + Intronic
1072890380 10:99318266-99318288 ACTCTCTGCCTTGTAAAGAACGG + Intergenic
1073004416 10:100311718-100311740 ACACTCTCCCTGGGAAGGAATGG + Intronic
1073388581 10:103151174-103151196 CCACTGTGCCTGGCCAGGAGAGG - Intronic
1074369970 10:112892627-112892649 CCACTGTGCCTGGCCAGGTATGG - Intergenic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074625383 10:115178195-115178217 CCACCGTGCCTGGCCAAGGACGG + Intronic
1074686651 10:115968206-115968228 CCACTCTGGCTTGCTAAGTATGG + Intergenic
1077560655 11:3258280-3258302 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1077566551 11:3304108-3304130 CCACCTTGCCTGGCACAGGAGGG - Intergenic
1078090026 11:8259354-8259376 ACACTCTGCCTGGCTAAGTTTGG + Intronic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1080286952 11:30626169-30626191 CCACTCATCCTGACAAAGCAAGG - Intergenic
1080430103 11:32190089-32190111 CAACTCTGCCTGGTAAAATAAGG - Intergenic
1080612200 11:33914463-33914485 CCACTGTGCCTGGCAAGGTTGGG - Intergenic
1081274045 11:41124800-41124822 CCACTCTGGCTCCTAAAGAATGG - Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081647559 11:44800489-44800511 CCCCTCTGTCTGGGTAAGAACGG + Intronic
1081818408 11:45967079-45967101 CCACTGTGCCCGGCCAGGAAAGG - Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082768296 11:57185769-57185791 TCACTCTGCCTGGGAAGTAAAGG - Intronic
1083409221 11:62480372-62480394 TCACTGTGCCTGGCAAAGTCAGG - Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1085295862 11:75431339-75431361 GCTCACTGCCTGGCACAGAAAGG - Intergenic
1085620696 11:78035870-78035892 CCACTGTGCCCGGCCATGAAGGG - Intronic
1086927166 11:92652873-92652895 CCACTGTGCCTGTCTGAGAAGGG - Intronic
1087293590 11:96344237-96344259 CCACTGTGCCTGGCCAGGATTGG - Intergenic
1087476107 11:98637252-98637274 CCACTCTGCCCCGAAAAAAATGG - Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088855946 11:113753691-113753713 CCACTGTGCCTGGCAATTTATGG + Intronic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090059558 11:123452356-123452378 CCACCATGCCTGGCCAAGGAAGG - Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1091054579 11:132406197-132406219 ACACTCAGCCTGGTAAAGAATGG - Intergenic
1091600493 12:1914931-1914953 TCACTCTGCCAGGCAATGAAAGG + Exonic
1092351672 12:7761067-7761089 CCACTGTGCCCGGCTGAGAATGG - Intergenic
1092685125 12:11034625-11034647 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092689816 12:11095541-11095563 CTACCCTGCCTGGCCAATAAAGG - Intronic
1092741214 12:11631895-11631917 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
1093032157 12:14298185-14298207 CCACCGTGCCTGGCCAGGAATGG - Intergenic
1093916560 12:24808721-24808743 CCACTGCGCCTGGCCAAGATTGG + Intergenic
1094090913 12:26648232-26648254 CCACTGAGGCTGGCAAAAAATGG + Intronic
1094203403 12:27816102-27816124 CCACCATACCTGGCTAAGAAAGG + Intergenic
1094450374 12:30577446-30577468 GCACTGTGCCTGGGAAATAAGGG + Intergenic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1095922341 12:47543821-47543843 CTTCTCTGTCTGGCAATGAAGGG + Intergenic
1096417862 12:51429197-51429219 CTACTCTGCCAGGCATAGAGAGG + Intronic
1096940214 12:55336161-55336183 CCACCCTGCCTTGCATATAATGG - Intergenic
1097003298 12:55896656-55896678 CCACTGAGCCTGGCCAATAATGG + Intergenic
1097021858 12:56026400-56026422 CCACTGCGCCTGGCCCAGAATGG - Intronic
1097026774 12:56062230-56062252 CCACTGTGCCCGGCAAGGAGGGG + Intergenic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097260868 12:57719443-57719465 GCACTCTGCCTGGCACACAATGG + Intronic
1097311725 12:58126581-58126603 GCCCTCTGCCTGGCAAATCAAGG - Intergenic
1097583144 12:61482757-61482779 CCACTGTGCCTGGCCACTAATGG - Intergenic
1097764882 12:63514556-63514578 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
1098224008 12:68301964-68301986 CCACTGTGCCTGGCCAGGAGAGG + Intronic
1100375535 12:94013015-94013037 CCACTGCACCTGGCCAAGAAAGG - Intergenic
1101693246 12:107100738-107100760 ACACTGTGCCTGGCTAAAAAGGG + Intergenic
1101877893 12:108607570-108607592 CCACTGTGCCTGGCTAGGAGGGG - Intergenic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103487198 12:121291105-121291127 CCACTGTGCCTGGCCAGCAATGG + Intronic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1103868495 12:124073277-124073299 CCACTCTGCCTGGCAAAGAACGG + Intronic
1104370790 12:128222212-128222234 CCACTGTGCCTGGCAATGCCAGG + Intergenic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1105451952 13:20507951-20507973 CCACTGTGCCTGGCCAGGCATGG - Intronic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106391336 13:29338077-29338099 CCACTGTGCCTGGCCATGACCGG + Intronic
1106677985 13:31981964-31981986 GAACTCTGCCTGGCAAATGATGG - Intergenic
1107145485 13:37056970-37056992 TCACTCTGCCTAGCAAAGGATGG + Intronic
1107184635 13:37504674-37504696 CCACTGTGCCTGGCAAAGGAAGG - Intergenic
1107332288 13:39314148-39314170 CCACTATGCCTGGCCAATAAAGG - Intergenic
1107507800 13:41052561-41052583 CGACTGTGCCTGGCCAAGGAAGG - Intronic
1107528201 13:41255367-41255389 CCACTGTGCCTGGCTTAGTACGG + Intronic
1107589123 13:41883227-41883249 CCTCCATGCCTGGTAAAGAATGG + Intronic
1108182325 13:47853281-47853303 ACACTCTGGCTGACAAAGCATGG + Intergenic
1109420401 13:62104333-62104355 CCACTGCGCCTGGCCAACAAAGG + Intergenic
1110409996 13:75194480-75194502 CCACTCTACCTGGCCAAGATGGG + Intergenic
1112076769 13:95922532-95922554 CCACTGTGCCTGGCCAAAGATGG - Intronic
1113389002 13:109877916-109877938 CCACCCTGCCTGCCAGGGAATGG - Intergenic
1113466924 13:110519597-110519619 CCACTCTGCCTGGCCACAGAAGG + Intergenic
1113787150 13:113008203-113008225 CCACTGTGCCCGGCCAAGTACGG + Intronic
1114970866 14:28026827-28026849 CCACTGTGCCCGGCCAAGGAGGG + Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115246286 14:31299430-31299452 CCACTGTGTCTGGCCACGAAAGG - Intronic
1116133358 14:40889652-40889674 CTACTGTGCCTGACAAAAAAAGG + Intergenic
1116446448 14:45017594-45017616 CCACCACGCCTGGCCAAGAATGG - Intronic
1116492177 14:45517656-45517678 CCACTGCGCCTGGCCCAGAAAGG + Intergenic
1117527511 14:56624592-56624614 GCACACTGCCTGGCATAGAACGG - Intronic
1117533031 14:56677265-56677287 CCACTCTGGCTGGAAAGGGAGGG - Intronic
1118227304 14:63913988-63914010 CCACTGTGCCTGGCCATAAATGG + Intronic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120975172 14:90242032-90242054 CCACTGTGCCCAGCCAAGAAAGG + Intergenic
1121106392 14:91282771-91282793 CCACTACACCTGGCCAAGAAAGG - Intronic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121488578 14:94341436-94341458 CCAGTTTGCCTGGAAATGAAAGG - Intergenic
1121497893 14:94409593-94409615 CCACTGTGCCTGGCCAACAGAGG + Intergenic
1121580348 14:95025315-95025337 CCTCGAAGCCTGGCAAAGAAAGG + Intergenic
1121613032 14:95294130-95294152 TCAGCCTGCCTGCCAAAGAATGG + Intronic
1121976186 14:98406056-98406078 ACACTTTGCCTGGCATATAATGG - Intergenic
1122951383 14:105047074-105047096 CCACTCTGCCTGGCATGGCAGGG - Intergenic
1123432664 15:20231846-20231868 CCACTGTGCCTGGCCAAGAAAGG - Intergenic
1123701808 15:22919733-22919755 CCACTGTGCCTGGCCAAAGAAGG - Intronic
1123818802 15:24005668-24005690 CCACCGTGCCTGGCCAAGGATGG + Intergenic
1124404414 15:29381167-29381189 CCACTGCGCCTGGCCAACAAGGG - Intronic
1124577282 15:30921090-30921112 CCACTGTGCCTGGCCAACGAGGG + Intronic
1124929565 15:34106143-34106165 CCACTGTGCCCGGCCCAGAAAGG - Exonic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1127807686 15:62536126-62536148 CCAAACTACATGGCAAAGAAGGG - Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1128057497 15:64711302-64711324 CCACTGTGCCTGGCCAGGATTGG - Intergenic
1128344641 15:66845657-66845679 CCACGCTGCCTGGGACAGCACGG - Intergenic
1129510033 15:76114981-76115003 CCACTGTGCCTGGCCAACAAGGG - Intronic
1129539989 15:76341357-76341379 CCACTTAGCCTGGCAGAGAGGGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1131166559 15:90145892-90145914 CCACTGTGCCTGGCCTTGAATGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131254111 15:90850425-90850447 CCACTGCGCCTGGCTGAGAAAGG + Intergenic
1131957124 15:97748537-97748559 TCTCTCTGCCTGGGAAAGACTGG + Intergenic
1132057338 15:98662266-98662288 CCACTGTGGCTGGCCAAGGAGGG + Intronic
1132272710 15:100540253-100540275 CCACTGCGCCTGGACAAGAAAGG - Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1132832534 16:1935828-1935850 CCTCTCTGCGTGGCAGAGGATGG - Intergenic
1132832993 16:1938582-1938604 CCACTCTGGCTGGCCTGGAAGGG + Exonic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1135141320 16:19924506-19924528 CCACTATGCCTGGCTCATAATGG + Intergenic
1135295874 16:21278622-21278644 TCACCGTGCCTGGGAAAGAATGG + Intronic
1135415354 16:22264636-22264658 CCCTTCTGCTTGGCAGAGAAGGG + Intronic
1135936709 16:26786635-26786657 CCAATCTTCCTTGCAAATAAGGG + Intergenic
1136396868 16:29997466-29997488 CCACTGCACCTGGCCAAGAATGG - Intronic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136488035 16:30585619-30585641 CCTTTCTGCCTGGCAAAGGGAGG + Exonic
1136851964 16:33619260-33619282 CCACTGCGCCCGGCCAAGAAAGG + Intergenic
1137037487 16:35578763-35578785 GCACTGTGCCTGGCACAGTAGGG + Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137695913 16:50461969-50461991 CCACCGTGCCTGGCCAAGGATGG - Intergenic
1138190949 16:55013797-55013819 CCACTGTACCTGGCCAAAAAAGG - Intergenic
1139258538 16:65568057-65568079 CCACTGTGCCTGGCTAACAATGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1140636241 16:76918001-76918023 TCACTCTGCTTTGCAAGGAATGG - Intergenic
1140949456 16:79802278-79802300 CCATTCTGGCTGGGAAAAAAGGG - Intergenic
1141163610 16:81645606-81645628 CCTCTCTGCTTGTCAAGGAAGGG - Intronic
1141180802 16:81752348-81752370 CCACTCTGCCTGACAGGGAGGGG + Intronic
1141434569 16:83992534-83992556 CCTCTCTGCCTGGAAAATTAAGG - Intronic
1141939904 16:87268633-87268655 CCACTGTGCCTGGCCAGGACAGG - Intronic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1142700252 17:1655409-1655431 CCACTCTGACTGACGAAGAATGG - Exonic
1143202277 17:5121359-5121381 CCACTCTGCCTTCCAGAGAGAGG + Exonic
1143393412 17:6573922-6573944 CCACTGTGCCTGGCGAAGAGCGG + Intergenic
1143429932 17:6873933-6873955 CCACTGTGCCCGGCCATGAAGGG - Intergenic
1144879298 17:18422934-18422956 CCACTCTGCCTTCCAGAGAGAGG + Intergenic
1145124579 17:20289591-20289613 CTACTGTGCCTGGCCAAAAAGGG + Intronic
1145152939 17:20521453-20521475 CCACTCTGCCTTCCAGAGAGAGG - Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145956272 17:28856996-28857018 CCACTGCGCCTGGCCAGGAAAGG + Intronic
1146435366 17:32841177-32841199 CCACTGTGCCTGGCCTACAATGG - Intronic
1146599256 17:34200223-34200245 CCACTCCGCCAGGCAGAAAAGGG + Intergenic
1146794528 17:35772040-35772062 CAACTGTGACTGGCAAAGATGGG + Intronic
1147166037 17:38593933-38593955 CCACTCTGGCTGGTAAAGCCAGG + Intronic
1147172254 17:38628912-38628934 CCACTGTGCCTGGCCATGGAGGG - Intergenic
1147404559 17:40201610-40201632 CCACCATGCCTGGCCAGGAAGGG - Intergenic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147775028 17:42894789-42894811 CCACTGTGCCTGACCTAGAATGG - Intergenic
1148121000 17:45211171-45211193 CCACTGTGCCTGGCCTAGAATGG + Intergenic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148886197 17:50774733-50774755 CCACTGTGCCTGGCAAAGTTAGG - Intergenic
1148963741 17:51416733-51416755 CCACTGTGCCTGGCGGTGAAAGG + Intergenic
1149195348 17:54113048-54113070 TCATTCTGCCTGTCAAACAAGGG + Intergenic
1149341761 17:55693979-55694001 CCAGTGTCCCTGGCAATGAATGG + Intergenic
1149505430 17:57190062-57190084 CCACTGTGCCTGGCCAATTATGG + Intergenic
1149931147 17:60756897-60756919 CCACCGCGCCTGGCCAAGAAGGG - Intronic
1151177426 17:72300330-72300352 CCACTCTGCCTGGCCCAAAATGG - Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151524071 17:74651767-74651789 CCACTGTGCCTGGCCAGTAATGG + Intergenic
1151693045 17:75698903-75698925 CCACTGTGCCTGGCCCACAATGG - Intronic
1151896632 17:76985166-76985188 CCACTGAGCCTGGCCAAGGAAGG + Intergenic
1152303994 17:79510783-79510805 CCACTGTGCCTGGCCAGCAAGGG - Intronic
1152874550 17:82779289-82779311 CCACTGCGCCTGGCCAAGATGGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153302223 18:3601371-3601393 CCACTGCGCCTGGCCCAGAATGG + Intronic
1153484739 18:5585682-5585704 GCACAGTGCCTAGCAAAGAAAGG - Intronic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1155230371 18:23767858-23767880 CCACCGTGCCTGGCAAGGAAAGG + Intronic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156718583 18:40042257-40042279 CCAAGCTGCCTGGCAAAGGGAGG - Intergenic
1157185523 18:45537106-45537128 ACAATGTGCCTGGCAAATAATGG - Intronic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158507485 18:58059496-58059518 CCATGCTGCCTGGCTAAGAAGGG + Intronic
1160137125 18:76281944-76281966 CCACTCAGACTGCCAAAGACTGG + Intergenic
1160360990 18:78278186-78278208 CCACTCTGACTGGTAAGAAATGG + Intergenic
1161147677 19:2688776-2688798 CCACTGTGCCCGGCTAACAATGG - Intronic
1161225608 19:3143831-3143853 CCACTGCGCCTGGCCAAGAGAGG - Intronic
1161259727 19:3330955-3330977 CCACTGTGCCCGGCCAAGATGGG - Intergenic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1162039943 19:7964545-7964567 CCACCATGCCTGGCCCAGAAAGG - Intronic
1162245464 19:9396332-9396354 CCACTGTGCCTGGCGATAAAGGG - Intergenic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1163319410 19:16564591-16564613 CCACTGCGCCTGGCCAAGACAGG + Intronic
1163984359 19:20931060-20931082 CCACTGCGCCTGGCAGAGATGGG + Intronic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164607484 19:29610573-29610595 CCTCTCTGCCAGGCAAAGGAGGG + Exonic
1164884646 19:31768165-31768187 CCTCTCTGCCTCCCAAAGATTGG + Intergenic
1164978496 19:32593895-32593917 CCACTGTGCCTGGCAAAGCTAGG - Intergenic
1165084238 19:33331952-33331974 CCACTGTGCCTGGCCATGAATGG + Intergenic
1165363322 19:35350112-35350134 CCACTCTGCCTGTCAAGGGGTGG - Intergenic
1165653267 19:37510071-37510093 CCACTGTGCCTGGCCAAACAAGG - Intronic
1165761472 19:38323879-38323901 CCACCTTGCCTGGCCAGGAAGGG + Intronic
1165889098 19:39100019-39100041 CCACTGTGCCGGGCCAAGATGGG - Intronic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166118057 19:40667684-40667706 CCACTCTGCTTGGGAAAGCTGGG - Exonic
1166534281 19:43562454-43562476 CCACTGCGCCTGGCCAAGGAGGG - Intronic
1167044547 19:47042018-47042040 CCACTGTGCCTGGCCTAGAAGGG - Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167474974 19:49694851-49694873 CCACCATGCCTGGCCAAGGATGG - Intronic
1167871566 19:52375022-52375044 CCACCATGCCTGGCCTAGAAGGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
924961405 2:37911-37933 CCACTGTGCCCGGCCAAGATGGG - Intergenic
925440850 2:3883863-3883885 CCACTATACCTGGCCAAGAAAGG - Intergenic
925668719 2:6289596-6289618 CCACTGTGCCAGGCCAAGATTGG - Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926314238 2:11697637-11697659 CCACTCACCCTGCCAATGAATGG - Intronic
927497174 2:23558887-23558909 GAACAGTGCCTGGCAAAGAAGGG - Intronic
927556247 2:24034860-24034882 CCACTGTGCCTGGCCAAACATGG + Intronic
927622721 2:24678576-24678598 CCACTCTGACTGGCATGAAATGG + Intronic
927693587 2:25225012-25225034 GCACTCGGCCTGTCACAGAATGG + Intergenic
929735883 2:44548749-44548771 CCTCTCTGGCTGGCAAACAAGGG - Intronic
929772019 2:44900412-44900434 CCAAGCTTCCTGGCAAAGGAAGG - Intergenic
929952692 2:46428608-46428630 CCACTCAGCCTGACAAAGTAAGG + Intergenic
931544273 2:63363886-63363908 ACACTGTGCCTGGCAAAAATTGG - Intronic
931873337 2:66484845-66484867 CCACTGCGCCTGGCCAAAAAGGG + Intronic
931963686 2:67509224-67509246 TGACTCTGACTGGCAGAGAATGG - Intergenic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
933174495 2:79159862-79159884 GGACTCTTCCTGGCAAAGACTGG + Intergenic
933429421 2:82156477-82156499 CCACCACGCCTGGCCAAGAATGG + Intergenic
933739948 2:85525479-85525501 CCACTGTGCCCAGCCAAGAATGG - Intergenic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934088122 2:88527178-88527200 CCACTGTGCCTGGCCTACAAGGG - Intronic
934938247 2:98480712-98480734 ACATTCTGCCTGGCAAGGGATGG - Intronic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
937234775 2:120424119-120424141 CCACACACCCTGGCCAAGAAGGG + Intergenic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
937988048 2:127647476-127647498 CCACTCTGCCTGGCATGGTGGGG - Intronic
938022144 2:127914857-127914879 CCACTCTGCCTGGCCAAAAGTGG - Intergenic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938201919 2:129379241-129379263 CCGCTCTGCCTGTCACAAAATGG - Intergenic
938939164 2:136153987-136154009 CCACTGTGCCCGGCCAGGAATGG - Intergenic
938972569 2:136445946-136445968 CCCCAATGCCTGGCACAGAATGG - Intergenic
940046412 2:149415346-149415368 CCCCTCTGCCTGGCTGAAAAAGG + Intronic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
941922439 2:170864508-170864530 CCACTGTGCCTGACCAAGAAGGG + Intergenic
942078719 2:172380818-172380840 CCCCTCTGCCTGGCCAGGCAGGG + Intergenic
942248476 2:174028020-174028042 CCCCTCTGCCTGGCAAGAAATGG + Intergenic
942280291 2:174356176-174356198 CCACTGCGCCTGGCCAGGAAAGG - Intronic
942323470 2:174755746-174755768 CCACTGTACCTGGCAAAGTCTGG - Intronic
944725098 2:202462998-202463020 CCACTGTGCCTGGCCAACATTGG + Intronic
945261814 2:207850865-207850887 CCACTGTGCCTGGCCAGGAAGGG - Intronic
945495770 2:210505629-210505651 CCCCTTTCCCTGGCTAAGAAAGG - Intronic
945793029 2:214329120-214329142 CAGCTCTGCCTTGCACAGAATGG - Intronic
946677252 2:222173884-222173906 AGACTCTGCCTTACAAAGAAGGG - Intergenic
947361823 2:229353140-229353162 CCAATCTCCCTGGAAAAAAATGG + Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948011714 2:234654100-234654122 CCACCATGACTGGCCAAGAAAGG + Intergenic
948496835 2:238356207-238356229 CCACCATGCCTGGCCAGGAATGG - Intronic
948545625 2:238726698-238726720 CCACTATGCCTGGCCTAGAATGG + Intergenic
948623467 2:239251303-239251325 CCACTGTGCCTGGCTGGGAATGG - Intronic
1168997222 20:2142435-2142457 TGGCTCTGCCTGACAAAGAAAGG + Intronic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1170514125 20:17110341-17110363 CCACTGTGCCTGGCCATGAATGG - Intergenic
1170847296 20:19973499-19973521 CCACTGTGCCTGGCCTGGAATGG - Intronic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172527102 20:35606469-35606491 CCACTGTGCCCAGCCAAGAATGG - Intergenic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173726080 20:45298701-45298723 GCACACTGCCTGGCACAGGAAGG - Intronic
1173738308 20:45377459-45377481 CCACTCAGCCTGGCAACCAGGGG + Intronic
1174007411 20:47421439-47421461 CCACTGTGCCTGGCCACAAATGG + Intergenic
1174010397 20:47444942-47444964 CCACTGTGCCTGGCCTAGGATGG + Intergenic
1174017105 20:47497822-47497844 CCACTGCGCCTGGCAAACATTGG - Intergenic
1174250449 20:49215717-49215739 CCACTGCGCCTGGCAAAGCAGGG - Intergenic
1174433155 20:50485674-50485696 CCACTATGCCTGGCCAGGATTGG - Intergenic
1175559397 20:59907957-59907979 CCACCGTGCCTGGCCAGGAATGG - Intronic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1175986856 20:62768346-62768368 CCCCCCTGGCTGGCACAGAACGG + Intergenic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1177147393 21:17421225-17421247 ACACCCAGCCTTGCAAAGAAAGG - Intergenic
1179148213 21:38787648-38787670 TCACTGTGCCGGGCAAAGACTGG - Intergenic
1179219725 21:39395649-39395671 CCACTGTGCCTGGCCAGGAATGG + Intronic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1181388429 22:22560855-22560877 CCACTGTGCCTGGCCAAGGCTGG + Intronic
1181786413 22:25230441-25230463 CCACTGTGCCTGGCCTGGAACGG + Intronic
1182462024 22:30490028-30490050 CCACCCTGCCTGGGAAGGCAGGG + Exonic
1183293924 22:37019130-37019152 CCCCTCTGCCTTGGAAGGAAAGG - Exonic
1183498466 22:38163801-38163823 CCACTCTGCTTGGTGAAGATGGG + Intronic
1183523122 22:38307975-38307997 CCACTGTGCCTGGCCCAGGAGGG + Intronic
1183837342 22:40465851-40465873 GCACTATGCCTGGCCAAGATAGG + Intronic
1183918751 22:41146452-41146474 CCACTGTGCCTGGCCTATAATGG + Intronic
1183946297 22:41327834-41327856 CCACTGTGTCTGGCCAAGAAAGG - Intronic
1183954524 22:41371391-41371413 CCACACTGCCTTGCCTAGAAAGG - Intronic
1184339507 22:43878636-43878658 ACACGCTGCTTGGCAAAGGAGGG + Intergenic
1184409782 22:44319834-44319856 GCACTGTGCCGGGGAAAGAAAGG + Intergenic
1184459850 22:44630964-44630986 CCCCTCTCCCTGACCAAGAAGGG + Intergenic
949584117 3:5421264-5421286 CCACCGTGCCCGGCCAAGAAAGG - Intergenic
949973733 3:9434955-9434977 CCACTGCGCCTGGCCAAGAGGGG - Intronic
950651464 3:14409898-14409920 CCAGTGTGCCTGGCCAACAATGG - Intronic
951593540 3:24292640-24292662 GCACTGTGCCTGGCAAATAGTGG + Intronic
951768096 3:26223209-26223231 CCACTCTACCTTGGAAAGACTGG + Intergenic
952551808 3:34486969-34486991 CCACCATGCCTGGCCTAGAAAGG - Intergenic
953353290 3:42232015-42232037 CCACTGTGCCTGGCTTTGAAAGG - Intergenic
953576198 3:44114831-44114853 GAACTCTCCCTGGCCAAGAAAGG - Intergenic
954308637 3:49746707-49746729 CCACTGTGCCCGGCCAAGAATGG + Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
955153568 3:56393108-56393130 CCACTGTGCCTGGCCAGGAATGG - Intronic
955370265 3:58345155-58345177 CCCCTCTGCCTGGGAGAGCAGGG + Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955672058 3:61412370-61412392 CCACTGTGACTGGCACAGAATGG - Intergenic
955876620 3:63496891-63496913 GCACTATGCTTGGCAATGAAGGG + Intronic
956127538 3:66025249-66025271 CCACTGTGCCTGGCCAATCATGG - Intronic
956767425 3:72495554-72495576 CCATTCTGGTGGGCAAAGAAAGG + Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
960207955 3:114925811-114925833 CCACTGTGCCTGGCCAATTATGG + Intronic
960559617 3:119069213-119069235 CCACTGTGCCTGGCCAACAATGG + Intronic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
961190670 3:124958548-124958570 CCACTGATCCTGGCAAAAAAAGG - Intergenic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962183186 3:133230164-133230186 CCACTCAGCCTAGGAAAGATAGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962496691 3:135946981-135947003 CCACTGTGCCTGGCCAATGAAGG - Intergenic
962796791 3:138856425-138856447 CCCCACTGCCTTGCAAAAAAAGG + Intergenic
963838651 3:150082241-150082263 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
964155366 3:153578718-153578740 CCACTCTGCATGTCACAGGATGG - Intergenic
964750131 3:160046822-160046844 CCACCATGCCTGGCCAAGTAGGG + Intergenic
965069009 3:163892519-163892541 CCACTGTGCCTGGCCATAAATGG + Intergenic
968035877 3:195547503-195547525 CCACCGCGCCTGGCCAAGAAGGG - Intergenic
968218363 3:196913934-196913956 CCACTGTGCCTGGCCAAGAAAGG + Intronic
968667668 4:1829525-1829547 CCACTGTTCCTGGCCAAGAACGG - Intronic
968913928 4:3489014-3489036 CCACCCTGCCTGGGCAGGAAGGG + Intronic
968933992 4:3600439-3600461 ACACACTGCTTGGCAATGAATGG + Intergenic
969388667 4:6874383-6874405 CCAACATGACTGGCAAAGAAGGG + Intronic
969728360 4:8939110-8939132 GAACTCTGCCAGGCAGAGAAGGG + Intergenic
969728369 4:8939161-8939183 GAACTCTGCCAGGCAGAGAAGGG + Intergenic
969858133 4:10016207-10016229 TAACACTGCCTGGCACAGAAAGG + Intronic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
970462831 4:16292664-16292686 CCAATCTGCCTGAAGAAGAAAGG + Intergenic
970938675 4:21605765-21605787 CCACTGTGCCTGGCGTACAATGG + Intronic
971029279 4:22619601-22619623 CCACTGTGCCTGGCTGAGGAAGG + Intergenic
971397637 4:26243805-26243827 CCACTGTGCCTGGCCAAGGGAGG - Intronic
972431446 4:38986519-38986541 CCACCGTGCCTGGCCATGAATGG - Intronic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
973812111 4:54581571-54581593 CCACCGTGCCTGGCCATGAAAGG - Intergenic
974134985 4:57804004-57804026 CCAGCATGCTTGGCAAAGAAAGG + Intergenic
974435049 4:61846025-61846047 CCACCATACCTGGCCAAGAAAGG - Intronic
974453810 4:62100399-62100421 CCACTGTGCCTGGCCTAGAGTGG + Intergenic
975247272 4:72133975-72133997 CCACTCTGCCTGGCCAAGGATGG - Intronic
975282866 4:72583066-72583088 CAACTGTGCCAGGCAAAGAATGG - Intergenic
976419976 4:84830899-84830921 CCACTGCGCCTGGCCAACAATGG - Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
977301188 4:95269573-95269595 CCACTGTGCCTGGTGAAGACTGG + Intronic
977427789 4:96891145-96891167 CCTCTCACCCAGGCAAAGAAAGG + Intergenic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978600287 4:110420064-110420086 CCACTATGCCTGGCAAACTTTGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
979671682 4:123366271-123366293 CCTCTCTTCCTGCCAAAGACCGG + Intergenic
980135643 4:128856104-128856126 CCACTGTGCCTGGTCAAGCATGG + Intronic
981375275 4:144007923-144007945 CCACCATGCCTGGCTTAGAATGG + Intronic
981703606 4:147635007-147635029 CCACTGCGCCTGGCCAAGAATGG + Exonic
982229564 4:153196095-153196117 CCACTGTGCCTGGCCAGAAAAGG + Intronic
982751322 4:159165878-159165900 CCACTGTGCCTAGCTAACAATGG + Intronic
984165935 4:176303331-176303353 CTATTCTGCCTTGCCAAGAATGG - Intergenic
985773680 5:1828419-1828441 CCATTTTCCCTTGCAAAGAAAGG + Intergenic
985950733 5:3219809-3219831 CGGCTCTGCCTGGCAAAGCCGGG - Intergenic
986054840 5:4126714-4126736 CCACTCTTCCTGACACAGAGTGG - Intergenic
986070941 5:4282042-4282064 CCACTATGCCTGGCTACTAATGG - Intergenic
986240820 5:5958211-5958233 CCACTGTGCCTGGCTATGTAGGG - Intergenic
986363197 5:7002210-7002232 CCACTGTGCCCGGCCAATAAAGG - Intergenic
986815000 5:11399134-11399156 CCATTCTACCTGACAAAGGAGGG + Intronic
987143195 5:14966270-14966292 CCACTCTGGCTGGGAAGGAGAGG + Intergenic
987302646 5:16610117-16610139 CCATTCAGGCTGGCAGAGAAGGG + Intronic
987324435 5:16799779-16799801 CCACTGTGCCCGGCTGAGAAAGG + Intronic
987523906 5:19023301-19023323 CCACCTTTCCAGGCAAAGAATGG - Intergenic
988637812 5:33006055-33006077 CCACCGCGCCTGGCCAAGAATGG - Intergenic
988996564 5:36720971-36720993 CAAATCCGCCTGCCAAAGAAAGG + Intergenic
989577522 5:43002270-43002292 CCACCCTGCCTGGCCTACAAGGG - Intergenic
990200351 5:53365966-53365988 CCACTCAGCCGAGAAAAGAATGG - Intergenic
990729278 5:58790690-58790712 ACACTCTACATGGCAAAGAATGG + Intronic
991200469 5:63986002-63986024 CCTCTCTGCGAGGCAGAGAAAGG + Intergenic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
992060662 5:73043217-73043239 CCACTGTTCCTGGCCAACAAAGG + Intronic
992294526 5:75314442-75314464 CCACTGTGCCTGGCCAAATAAGG - Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992471204 5:77056513-77056535 CCACTGTGCCCGGCCAAGAGTGG + Intronic
992882827 5:81127634-81127656 CCACTGTGCCTGGCCAAATAAGG - Intronic
993388192 5:87285352-87285374 CCACCGCGCCTGGCAATGAATGG + Intronic
993581822 5:89672228-89672250 CCACTCCCCCTGGAAAAGAGAGG + Intergenic
994145144 5:96386675-96386697 CCACCATGCCTGGCAAAGTATGG - Intergenic
994839599 5:104905736-104905758 CCACCGTGCCTGGCCAGGAAAGG + Intergenic
995476236 5:112551299-112551321 CTACTTTGCCTGGGAAAGGAAGG + Intergenic
996758175 5:126957045-126957067 CCACTGTGCCCGGCTAAGAATGG + Intronic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997406178 5:133648659-133648681 ACACTCTGCAGGGCAAAGAAAGG + Intergenic
997443742 5:133926584-133926606 CCACTGTTCCTGGCACAGCAGGG + Intergenic
998153100 5:139768433-139768455 CCACCATGCCTGGCCAAGGAAGG - Intergenic
998584224 5:143409168-143409190 CCAGTCTCCCTGGAAAACAATGG - Intronic
998588533 5:143453498-143453520 CCACTGTGCCTGGCCAGGGAAGG + Intergenic
999301944 5:150496662-150496684 CTACTCCGCCTGCCAAAGAAGGG - Intronic
999633534 5:153596789-153596811 CCCCTCTTCCTGGAAAAGGAAGG - Intronic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1000183668 5:158838156-158838178 CCACTGCGCCTGGCCAGGAATGG - Intronic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002339822 5:178508505-178508527 CCACTCTGGCAGGAAAAGATGGG + Intronic
1002497634 5:179626078-179626100 CCACCATGGCTGGCAATGAAAGG + Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002601884 5:180358467-180358489 CCACTCTGCTTGGCCAGGAAAGG + Intergenic
1003550342 6:7097665-7097687 CCACTGCGCCTGGCCAAGAAAGG - Intergenic
1003696834 6:8415496-8415518 CCACTCTGCCTGGGACAGAAGGG - Intronic
1004136301 6:12970480-12970502 CCACTACGCCGGGCCAAGAATGG - Intronic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004371173 6:15053740-15053762 CCGCCGTGCCTGGCCAAGAATGG - Intergenic
1004601137 6:17150941-17150963 CCACAGTGCCCGGCCAAGAACGG - Intergenic
1005013823 6:21359422-21359444 CAACTCTGCCTGACAATGAGTGG - Intergenic
1005866024 6:29937785-29937807 CCATTCTGACTGGCATAAAATGG - Intergenic
1006537413 6:34710913-34710935 CCAGTGTGCCCGGCCAAGAATGG - Intergenic
1006559131 6:34894362-34894384 CCACTGTGCCTGGCCATGATTGG - Intronic
1006646160 6:35515692-35515714 CCACCGTGCCTGGCCAAGGAAGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007118725 6:39362859-39362881 CCACTGTGCCTGGCCCTGAAGGG - Intronic
1007213717 6:40219491-40219513 GCTCTCTGCTTGGGAAAGAATGG + Intergenic
1007271558 6:40641264-40641286 CCAGTCTGCCTGACACAGCAGGG - Intergenic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007617944 6:43193116-43193138 CCACCCTCCCTGGCAAAGAGCGG - Exonic
1008364794 6:50665325-50665347 CCACTGTGCCTGGCCAACAGAGG - Intergenic
1008545583 6:52580331-52580353 CCACTGTGCCTGGCAAGAAATGG + Intergenic
1008585270 6:52943099-52943121 CCACTGCGCCAGGCCAAGAATGG + Intergenic
1008965165 6:57307523-57307545 CCACTGCGCCTGGCCAAGGATGG + Intergenic
1009651526 6:66482403-66482425 CCAATCTGCCTGGGAACAAAGGG - Intergenic
1009880398 6:69560102-69560124 TCACTCTTCCTGGCTAATAATGG - Intergenic
1010240674 6:73612762-73612784 CCACTGTGCCTGGCCTAGAAAGG - Intronic
1010254357 6:73740876-73740898 CCACTGTGCCTGGCCAAGAAAGG + Intronic
1010422786 6:75693110-75693132 CCACTGTGCCTGGCCTACAATGG - Intronic
1010966079 6:82210536-82210558 CCACTATGCCTGGCCAATAAAGG - Intronic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011496942 6:87946160-87946182 CCACGATGCCTGGCAAAGTGAGG + Intergenic
1011595671 6:89013718-89013740 CCACTGTGCCCGGCTAATAATGG - Intergenic
1012469270 6:99552753-99552775 CCACTGTGCCTGGCCAGAAATGG - Intronic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013467605 6:110430925-110430947 CAACTCTGCCTGCCACAAAAGGG - Intronic
1015234305 6:130953266-130953288 CCTCTCTCCCTGGGATAGAAAGG + Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015830497 6:137363486-137363508 CCAGTCTGCCGAGGAAAGAAAGG + Intergenic
1015984431 6:138871516-138871538 CCACTGCGCCTGGCCAAGGATGG - Intronic
1016372582 6:143390642-143390664 CCACTCTGGGTGGCAGGGAAGGG - Intergenic
1017665966 6:156720372-156720394 GCACTTTGCCTGGAAAGGAAGGG - Intergenic
1017669634 6:156757664-156757686 CCACTGTGCCTGGCCAAGGGAGG - Intergenic
1018198044 6:161371924-161371946 CCACCATGCCTGGCCCAGAAGGG + Intronic
1018835150 6:167477550-167477572 CCACTGTGCCTGGCCAAGAGTGG + Intergenic
1020974418 7:14987679-14987701 CCAGTCTACCTGTGAAAGAATGG + Intergenic
1021108120 7:16662627-16662649 CCACTGTGCCAGGCTAAAAATGG - Intronic
1021314168 7:19125727-19125749 CCACTCTGCCTTGCCAGAAAAGG - Intergenic
1021605587 7:22406196-22406218 CCACTGTGCCTGGCCATGACTGG + Intergenic
1022444668 7:30460391-30460413 CCTCTCTTCCAGGCAAAGAGAGG + Intronic
1024939284 7:54745480-54745502 ACACATTGCCTGCCAAAGAAGGG - Intergenic
1025276638 7:57587792-57587814 TCACTGTGCCTGGCAAATTATGG - Intergenic
1025638081 7:63341296-63341318 CCACTATGCCTGGCCAAGATTGG - Intergenic
1025644615 7:63406803-63406825 CCACTATGCCTGGCCAAGATTGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026262739 7:68769819-68769841 CCACTCATCTTGGAAAAGAAGGG - Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027047720 7:75002211-75002233 CCACCATGCCTGGCCAGGAAAGG + Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027146988 7:75702529-75702551 CCACTGTGCCTGGCAAGGCTGGG + Intronic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1029522702 7:101074100-101074122 CCACTGTGCCTGGCCTAGAATGG - Intergenic
1030057869 7:105599282-105599304 CCACTACGCCTGGCCAAGACTGG - Intronic
1030307083 7:108029830-108029852 CCACCACGCCTGGCCAAGAAAGG - Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1032219115 7:129980593-129980615 CCACCCTGCCTGGCCTACAAGGG + Intergenic
1032354436 7:131196901-131196923 CCCCTCTCCCTGGTCAAGAATGG + Intronic
1032415615 7:131733206-131733228 CCCCTGTGCCTGGCACACAAGGG - Intergenic
1032712546 7:134473369-134473391 CCACTGTGCCTGGCTAATCATGG + Intergenic
1032788475 7:135221151-135221173 CCACTGCACCTGGCCAAGAATGG - Intergenic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033685155 7:143632883-143632905 CAACTCTGCCTGCCAAGGAGTGG + Intronic
1033688328 7:143712102-143712124 CAACTCTGCCTGCCAAGGAGTGG + Intronic
1033699459 7:143824738-143824760 CAACTCTGCCTGCCAAGGAGTGG - Intergenic
1034065682 7:148134728-148134750 CCACTTTCTCTGGCAAAGATTGG - Intronic
1034603040 7:152281442-152281464 CCACTGTGCCTGGCGTAGATGGG - Intronic
1035103898 7:156425729-156425751 GAACAGTGCCTGGCAAAGAATGG - Intergenic
1035147582 7:156835405-156835427 CCACTGCGCCTGGCCAAGACTGG - Intronic
1035386814 7:158478471-158478493 CCGCTCTGCGTCTCAAAGAACGG + Intronic
1035429996 7:158812154-158812176 CCACTCTGCCTTCCAGAGGACGG + Intronic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037699691 8:21263273-21263295 CCACTGTGCCCGGCCAAGAAGGG - Intergenic
1037910213 8:22739735-22739757 CCCCTCTGTCTGGGTAAGAATGG + Intronic
1038164488 8:25072015-25072037 CCACTGTGCCTGGCCAAGGTGGG + Intergenic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1039525050 8:38207238-38207260 CCACTGTGCCTGGCAATGCCTGG + Intronic
1040580495 8:48694988-48695010 CCGCTCTGCCAGGCTAAGGAGGG + Intergenic
1040988200 8:53319316-53319338 CCACTGCACCTGGCCAAGAAAGG - Intergenic
1040996380 8:53407137-53407159 GCACTGTGCATGGCATAGAAAGG + Intergenic
1041181663 8:55255839-55255861 CAACTCTGCCTGGCAGACAACGG - Intronic
1041596460 8:59659679-59659701 CAACTATGCTTGACAAAGAAAGG + Intergenic
1041619010 8:59943409-59943431 CAACTCTGCCTGGCACATAGAGG - Intergenic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042892734 8:73631066-73631088 CCACTGTGCCTGGCCTAGATTGG - Intronic
1043294125 8:78643182-78643204 CCACTGTGTCTGGCTGAGAATGG + Intergenic
1044635957 8:94324327-94324349 CCATTCTGACTGGCAAAAGATGG - Intergenic
1045336639 8:101209960-101209982 CCACTGTGCCAGGCCAAAAAAGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046044860 8:108951888-108951910 ACACTTTGAATGGCAAAGAATGG - Intergenic
1046307406 8:112387147-112387169 CCACTCTTTGTGGCAAAGAGTGG - Intronic
1046834334 8:118782755-118782777 GTACTATGCCTGGAAAAGAATGG - Intergenic
1048145194 8:131834863-131834885 CCTCTCTGCCTGGGGAATAAGGG + Intergenic
1048889832 8:138937057-138937079 CCACACTGCCTGGCCATGATGGG + Intergenic
1049133497 8:140871919-140871941 CCACTGTGCCTGGCCTAGTATGG - Intronic
1049189532 8:141279145-141279167 CCACGCAGCCTGGAAAGGAAGGG + Intronic
1049856638 8:144866256-144866278 CCACCATGCCTGGCCAGGAATGG + Intergenic
1052052742 9:23866592-23866614 CCCCTCTGCATGGCAGTGAAGGG + Intergenic
1052645666 9:31230412-31230434 CCACTTTGCTTGGCTAGGAAAGG + Intergenic
1052696856 9:31889050-31889072 CCACTTTGCTTGGCTAGGAAAGG + Intergenic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1056318763 9:85417209-85417231 CAACTTTCCCTGGCAGAGAAGGG + Intergenic
1056638493 9:88350433-88350455 CCACTGTGCCTGGCCACAAAAGG - Intergenic
1056737997 9:89226090-89226112 CCACTTTGCCTGGCTTAGCAGGG - Intergenic
1056824725 9:89868909-89868931 GCCCTCTGCCTGGTAATGAAAGG - Intergenic
1057009332 9:91587973-91587995 CCACTGTACCTGGCCAAAAATGG - Intronic
1057013720 9:91631958-91631980 CCACTATGCCTGGCATCTAATGG - Intronic
1057171333 9:92965024-92965046 CCACACTGCCAGGCACAGCACGG - Intronic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057439458 9:95072478-95072500 CCACTATGCCTGGATAAGAGTGG - Intronic
1057689239 9:97268595-97268617 CCACTGCACCTGGCCAAGAAAGG + Intergenic
1057741049 9:97711428-97711450 CCACCCAGCCTGACAAAGAAAGG + Intergenic
1058030366 9:100189875-100189897 CCACTGTGCCCAGCAAAGTATGG + Intronic
1058778621 9:108310568-108310590 CCAGAGTGCCTGGCACAGAAGGG + Intergenic
1059255140 9:112923466-112923488 CCACCCTGTCTTGGAAAGAAGGG + Intergenic
1059393704 9:114017366-114017388 CCACTCTGACTGGGAAAGGAAGG + Intronic
1059418259 9:114175277-114175299 CCACTTTGCGTTGCAAACAACGG - Intronic
1059846317 9:118281058-118281080 CCACTCTACCCAGCGAAGAAAGG - Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060294480 9:122333882-122333904 CCACTGTGCCTGGCCAACAATGG - Intergenic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060460332 9:123847127-123847149 CCACTGTGCCTGGCCATAAATGG + Intronic
1060503746 9:124182361-124182383 CCACTGTGCCTGGCCAAGTATGG - Intergenic
1060628007 9:125130768-125130790 CCACTGTGCCCGGCCAAGACTGG + Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1061097863 9:128470341-128470363 CCACCACGCCTGGCCAAGAAGGG - Intronic
1061261705 9:129483831-129483853 CCAGTCTCCCTGGCAAAGCTGGG + Intergenic
1061469427 9:130812075-130812097 CCACTCTGCCTGGCCCTTAATGG - Intronic
1061474756 9:130857370-130857392 TCACTCTGACTGGTAAAGAATGG + Intronic
1062200176 9:135298704-135298726 CCTCTCTTCCTGGCACAGGAAGG + Intergenic
1062247265 9:135575565-135575587 ACACTGTGCCCGGCCAAGAATGG - Intergenic
1062479774 9:136745906-136745928 CCTCCCAGCCTGGAAAAGAAGGG + Exonic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1186131705 X:6473687-6473709 TCCCTCTGCCTTGCATAGAAAGG - Intergenic
1186175401 X:6921095-6921117 CCACAGTGCCTGGCCATGAATGG - Intergenic
1186551794 X:10513794-10513816 CCACTGTGCCTGGCCAACAATGG + Intronic
1186647943 X:11527324-11527346 CCACTGTGCCTGGCAACAATTGG - Intronic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1187326984 X:18300024-18300046 CCACTATGCCTGGCCAGAAAAGG + Intronic
1187544444 X:20234001-20234023 CCAATGTGCCTGGCACATAATGG - Intronic
1188499469 X:30809705-30809727 ACATACTGCCTGGCAAATAATGG - Intergenic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1190580032 X:51883370-51883392 CCACTCTGCTTGGGAGAGACTGG - Intronic
1190809664 X:53871052-53871074 CCACAGTGCCTGGCCCAGAATGG - Intergenic
1191895387 X:65987184-65987206 ATACTCTGCCTGGCACACAAAGG - Intergenic
1192774295 X:74225748-74225770 CCACTGTGCCCGGCCAACAATGG + Intergenic
1193144180 X:78060389-78060411 CGTCTCTGAGTGGCAAAGAAGGG + Intergenic
1193227494 X:79001117-79001139 CCATTCTGCCTGGCATAAGATGG - Intergenic
1193859798 X:86651435-86651457 GCTCTCTGCCTGACAAAGACTGG + Intronic
1194676430 X:96799520-96799542 CCACTGCGCCCGGCCAAGAAAGG - Intronic
1195381746 X:104277760-104277782 CCAGTATGGCTGGCCAAGAAGGG - Intergenic
1195945629 X:110207845-110207867 CCACTCTGCCTGGCTCTAAAGGG - Intronic
1196011600 X:110893714-110893736 CCACTCTGGCTGGTAGAAAAAGG - Intergenic
1196193047 X:112813983-112814005 CCACTGCGCCTGGCAAACAGAGG - Intronic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196972247 X:121122328-121122350 CCACTGTGCCTGGCCTAGCATGG + Intergenic
1197341214 X:125267832-125267854 TCACTCTTCCTTGCATAGAATGG + Intergenic
1197659320 X:129152613-129152635 CCACCATGCCTGGCCTAGAATGG + Intergenic
1197703217 X:129615619-129615641 GCACTGTGCCTGGCACACAATGG - Intergenic
1197990354 X:132310862-132310884 CCACTGTGCCTGGCCAATGATGG - Intergenic
1199644415 X:149892496-149892518 CCACTGTGCCCGGCCAAGAAAGG - Intergenic
1199696147 X:150343856-150343878 CCACTCTAGCTGGCAAAGTCGGG - Intergenic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1199889059 X:152056862-152056884 CCACTGTGCCTGGCCTGGAATGG + Intergenic
1200041683 X:153375456-153375478 CCACTCTGCCTGGTACACTATGG - Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic