ID: 1103870902

View in Genome Browser
Species Human (GRCh38)
Location 12:124090904-124090926
Sequence CACCTAAGGCTGCCCTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103870900_1103870902 -2 Left 1103870900 12:124090883-124090905 CCATGAGTGAGGAGCACAGTTCA 0: 1
1: 0
2: 2
3: 19
4: 174
Right 1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG 0: 1
1: 0
2: 1
3: 13
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103870902 Original CRISPR CACCTAAGGCTGCCCTTGTC AGG Intronic
905201071 1:36317500-36317522 CACCTTAGTGTGCCCTTCTCTGG + Intronic
906733691 1:48104590-48104612 CACATAAGGCAGCCACTGTCAGG - Intergenic
911665779 1:100549841-100549863 CATATAAGACTGCCCTTGGCTGG + Intergenic
912385489 1:109269271-109269293 GACCTCAAGCTGCGCTTGTCAGG - Exonic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
916500643 1:165384054-165384076 CAGCTAATGCTGCCAGTGTCAGG - Intergenic
919181084 1:194083041-194083063 CTCCTAAGACTGCCATGGTCAGG + Intergenic
921416610 1:214895914-214895936 AACCTAAATCTGTCCTTGTCTGG + Intergenic
923369608 1:233296798-233296820 TACTTATGGCTGCCCTAGTCAGG + Intergenic
924394365 1:243603408-243603430 CTTCTAAGGCTTCTCTTGTCTGG + Intronic
924422815 1:243925112-243925134 CAGCCAAGGCTGGCCTTGCCGGG - Intergenic
924474167 1:244368701-244368723 CACCTGAGCCTGCCCTTGTGTGG + Intronic
1065056077 10:21843916-21843938 CACCTCACCCTGCCCTTGACAGG - Intronic
1067720159 10:48722144-48722166 CACATCACGCAGCCCTTGTCTGG + Intronic
1069610227 10:69767976-69767998 CACCTCTTGCTGCCCTTGGCTGG - Intergenic
1070441147 10:76444619-76444641 AACCTAAGGCTGTGCTTGGCTGG - Intronic
1071411646 10:85402808-85402830 CACCCAAGGGTGTCCTTGGCAGG + Intergenic
1075213939 10:120515590-120515612 TACCGCAGGCTGCCCTTGTGTGG + Intronic
1075776605 10:124993157-124993179 GAGCTGAGGCTGCCCTTGGCAGG + Intronic
1077177291 11:1196641-1196663 CACCGAAGGCTGCTTCTGTCCGG + Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083054938 11:59810603-59810625 CTCCTGCGGGTGCCCTTGTCAGG - Exonic
1084437911 11:69154969-69154991 AACCTAAGGCTGACCTGGGCAGG - Intergenic
1090372994 11:126269461-126269483 CTCCCAAGGCGGCCCTTTTCAGG + Intronic
1097438280 12:59577427-59577449 CACCAAAGTATGCCCTTGGCAGG - Intergenic
1099032100 12:77539401-77539423 CACCAAAGGCTGGCCATGTGAGG - Intergenic
1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG + Intronic
1108527586 13:51299273-51299295 CACCCAAGGCAGCCCTTATGAGG + Intergenic
1109285748 13:60406238-60406260 CATCTAAGGCTGCAGCTGTCCGG + Intronic
1109591976 13:64496537-64496559 CACCTAAGGATGCATTTCTCAGG + Intergenic
1110413937 13:75232102-75232124 TACCTAAGTCTGACCTAGTCAGG + Intergenic
1113779048 13:112965610-112965632 CACCTATGCCTGCCCTTCTGTGG + Intronic
1119125912 14:72126250-72126272 CCCCAAAGGCTACCCTTCTCTGG - Intronic
1121227813 14:92334274-92334296 CTCCGGAGGCTGCCCTTCTCAGG - Intronic
1121405336 14:93716195-93716217 CACCTATGGCTGCCTTTGTCTGG - Intergenic
1122783764 14:104154664-104154686 CACCAGAGGCTGCCATGGTCTGG + Intronic
1125750049 15:42021744-42021766 CAGGCAAAGCTGCCCTTGTCAGG - Intronic
1126163600 15:45635280-45635302 CAGCTCTTGCTGCCCTTGTCTGG + Intronic
1126645274 15:50869399-50869421 CACCTAAGTATGCTCTTGTCTGG + Intergenic
1128344311 15:66843901-66843923 CACATAAGGATGCCCAAGTCTGG - Intergenic
1128589584 15:68883200-68883222 CTGCTAAGGCTGCCACTGTCAGG + Intronic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1134764267 16:16742917-16742939 CACTTAACTCTGCCCTTGTAGGG - Intergenic
1134981789 16:18616298-18616320 CACTTAACTCTGCCCTTGTAGGG + Intergenic
1135354414 16:21757468-21757490 CAACTATGGCTGCCCTTGGGTGG + Intronic
1135452905 16:22573608-22573630 CAACTATGGCTGCCCTTGGGTGG + Intergenic
1139753047 16:69120711-69120733 CTCCTAAAGCTGCTCTTGGCAGG + Intronic
1144437847 17:15257478-15257500 CACCAAAGCCTGCCCTTTTCGGG + Intronic
1146802587 17:35838524-35838546 CAGCTAAGGCAGCCATTGACTGG + Exonic
1147662956 17:42126985-42127007 GGCCTAAGGCTGCCCTGATCTGG + Intronic
1149776952 17:59365737-59365759 CAGCTAAAGCTCCCCTTGGCTGG - Intronic
1150221462 17:63497824-63497846 CACCGCAGGCAGCCCCTGTCTGG + Intronic
1151578661 17:74965203-74965225 CAGCTCAGGCTGCCCTTGCCAGG + Intronic
1167980003 19:53267455-53267477 CCCCAAAAGCTGCCATTGTCTGG + Exonic
1167985882 19:53315328-53315350 CCCCAAAAGCTGCCATTGTCTGG - Intergenic
926171824 2:10557615-10557637 TCCCTTAGGCTGCCCTTGCCAGG + Intergenic
926695976 2:15770446-15770468 CACCTAAGCCTGCCCTGGCTTGG - Intergenic
931226148 2:60333847-60333869 GAGCTAAAGCTGCCCTTGACAGG - Intergenic
931417078 2:62091540-62091562 CATCTAAGTATGCCCATGTCTGG + Intronic
932712544 2:74077941-74077963 CACATAATGCTGCTTTTGTCTGG - Intronic
935510357 2:103964170-103964192 CACCTATGGCTTCACTTGGCAGG + Intergenic
935754264 2:106264946-106264968 CACAGGAGGCTGCCCCTGTCAGG + Intergenic
936114115 2:109688416-109688438 CACAGGAGGCTGCCCATGTCAGG - Intergenic
936862973 2:117040233-117040255 CACCTAAGTCTTCACTTCTCTGG - Intergenic
938584971 2:132681416-132681438 CACCTAAGCCTGCCATGGCCCGG - Intronic
939567589 2:143802890-143802912 CACCTCAGGCTGATTTTGTCAGG - Intergenic
940243067 2:151584240-151584262 GACCTAATGTTGCACTTGTCAGG - Intronic
940244022 2:151594792-151594814 GACCTAATGTTGCACTTGTCAGG - Intronic
940244981 2:151605345-151605367 GACCTAATGTTGCACTTGTCAGG - Intronic
942994932 2:182249456-182249478 CACCAAAGAGAGCCCTTGTCAGG + Intronic
948351219 2:237342774-237342796 CACATAAGTCTGTCCTTGTGTGG - Intronic
949017453 2:241721411-241721433 CACCTAAGTCTGTCCTTTGCAGG - Intronic
949059167 2:241946871-241946893 CCCCTGGGGCTGCCCTTGGCTGG + Intergenic
1168799860 20:637473-637495 CTCCCCAGGCTGCCCTTCTCTGG + Intergenic
1171210899 20:23316179-23316201 CACCTAGGGATGTCCTAGTCTGG + Intergenic
1172477937 20:35252843-35252865 CACCTGAGCCTGCCCATGCCTGG - Intronic
1172477951 20:35252881-35252903 CACCTGAGCCTGCCCATGCCTGG - Intronic
1172477965 20:35252919-35252941 CACCTGAGCCTGCCCATGCCGGG - Intronic
1172477980 20:35252957-35252979 CACCTGAGCCTGCCCATGCCTGG - Intronic
1172477994 20:35252995-35253017 CACCTGAGCCTGCCCATGCCTGG - Intronic
1172478008 20:35253033-35253055 CACCTGAGCCTGCCCATGCCTGG - Intronic
1172478022 20:35253071-35253093 CACCTGAGCCTGCCCATGCCTGG - Intronic
1175329746 20:58155377-58155399 CACCTGAGGCTTCCCGTCTCTGG + Intronic
1176738248 21:10572735-10572757 CACCTAAAGCAGTCCTTGTAAGG - Intronic
1180501632 22:15935042-15935064 CATCTAAGCATGCCCTTATCTGG + Intergenic
1180967700 22:19799147-19799169 CACCCCAGGCAGCCCTGGTCTGG - Intronic
1181694215 22:24584943-24584965 GTCCTAGGGCTGCCCTTGGCAGG - Intronic
950571563 3:13803376-13803398 AACCTAGGTCTGCCCTTGCCTGG + Intergenic
950953821 3:17029620-17029642 TACCCAAGGCTTCCCTTTTCTGG - Intronic
960504132 3:118472300-118472322 CCCCTAAGGCTGCCCTAATCAGG - Intergenic
961969863 3:130950768-130950790 CACTTAAGAGAGCCCTTGTCTGG - Intronic
962538331 3:136351718-136351740 CACCCAAGGCTGCCTTTCTCAGG + Intronic
972780374 4:42282115-42282137 CAACTAGGGCTGCTCTTGTCCGG - Intergenic
983163234 4:164443542-164443564 CACCTGATTCTGTCCTTGTCAGG - Intergenic
985622580 5:963190-963212 CTCCTGTGTCTGCCCTTGTCTGG - Intergenic
986534058 5:8767946-8767968 CATCTATGCCTGCCCTTGTGTGG + Intergenic
989784209 5:45307684-45307706 CTCCTTAGTCTCCCCTTGTCTGG - Intronic
990076188 5:51848574-51848596 CAACTAAGGCTTTTCTTGTCTGG - Intergenic
994774297 5:104024770-104024792 CACGTGAGGCTGCCCTGGCCCGG - Intergenic
998203830 5:140145581-140145603 CTCCCAAGGCTGTCATTGTCAGG + Intergenic
1000013507 5:157256623-157256645 CACCTAAGGCCACCCTTTTGAGG + Intergenic
1000297096 5:159921450-159921472 CACCTAGGGAAGGCCTTGTCAGG + Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1003411449 6:5866524-5866546 CACCTAAGGCGGCCCTTCTAGGG - Intergenic
1008629228 6:53348156-53348178 TACCAAGGGCTGCCGTTGTCTGG + Intronic
1009795121 6:68456465-68456487 TTCCTAAGGCTTCCCTTGGCTGG + Intergenic
1013269914 6:108535760-108535782 CACCTCAGGGTGCCCTCTTCAGG - Intergenic
1016185826 6:141196620-141196642 AACCCCAGGCTGCCCTTGTTTGG - Intergenic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1019701548 7:2476856-2476878 CTCCTAAGCCTGCCCTTGGCCGG - Intronic
1023875598 7:44284683-44284705 CAAATAAAGCTGGCCTTGTCTGG + Intronic
1029633532 7:101768516-101768538 CACCCAAGGCTTTCCTTTTCAGG + Intergenic
1032198356 7:129802413-129802435 CACCTAAGCATGCACTTCTCAGG + Intergenic
1032513725 7:132491960-132491982 CACCCCAGGCTGCCCTTGGAAGG - Intronic
1033729168 7:144157710-144157732 CTTCTAAGGCTGCCCTTCTGTGG + Intergenic
1033737021 7:144232338-144232360 ATCCTAAGACTGCCCTTCTCTGG - Exonic
1033746036 7:144318608-144318630 ATCCTAAGACTGCCCTTCTCTGG + Exonic
1033869648 7:145735719-145735741 CTCCTAAAGCTGTCCTAGTCTGG + Intergenic
1034431898 7:151045345-151045367 CACCTCAGGGGGCCCTTCTCAGG - Exonic
1034907350 7:154962026-154962048 CACCAAAGGCGGCCCCTGTTGGG - Intronic
1037947954 8:23000909-23000931 CATCTGTGGCTGCCCTAGTCTGG - Intronic
1040314386 8:46253300-46253322 CCCCTAAGGGTGCCCCTGGCAGG + Intergenic
1040913364 8:52543474-52543496 CACATAAGGCTGCCCTGAACTGG - Intronic
1041480676 8:58316532-58316554 CAACTTAGGCTGCCATTTTCAGG + Intergenic
1045022791 8:98059049-98059071 CACCTCAGTCTTACCTTGTCTGG + Intergenic
1048568135 8:135625447-135625469 CTCCTAAGGCTGCCCTGGTGTGG - Intronic
1049221035 8:141429030-141429052 CACCTGAGGCTGCGCTGGTCAGG + Intronic
1049311201 8:141934819-141934841 CCCCTGGGGCTGCCCTAGTCTGG + Intergenic
1051715340 9:19977002-19977024 CAACAAAGGCTGGCCATGTCAGG + Intergenic
1052748686 9:32466772-32466794 CACCTTAGGCTGGCTTTCTCAGG + Intronic
1055845833 9:80562350-80562372 AATCTAAGGCTGTCCTTGACAGG + Intergenic
1056970603 9:91198607-91198629 CAGCTGAGGCTCCCCTTGCCTGG - Intergenic
1058652406 9:107189040-107189062 CACATAAGGCTGTCCAAGTCTGG - Intergenic
1062060698 9:134493804-134493826 CGACTAACACTGCCCTTGTCAGG + Intergenic
1189868119 X:45352547-45352569 CACCTAAGGCTGCGCTCTTGGGG + Intergenic
1190510490 X:51169392-51169414 CAGCCAAGCCTTCCCTTGTCTGG + Intergenic
1195277359 X:103294695-103294717 CACCTAATGCTGGCCTAGTATGG + Intergenic
1195537893 X:106029703-106029725 CAACTAAGGCAGCCCTTGAAGGG - Intergenic
1196179035 X:112670467-112670489 CATCTAAGGCTAGCCCTGTCTGG - Intronic
1199172367 X:144746194-144746216 CACCTAAGTATACCCTTGTCTGG - Intergenic
1200163590 X:154021133-154021155 CCCCTCAGCCTGCCCTTGCCTGG + Intergenic
1200398688 X:156006303-156006325 CATCAAGGGCCGCCCTTGTCTGG + Intronic
1200704022 Y:6426236-6426258 AACCTAAGGCCGCCCCTTTCTGG + Intergenic
1201030089 Y:9738472-9738494 AACCTAAGGCCGCCCCTTTCTGG - Intergenic