ID: 1103873829

View in Genome Browser
Species Human (GRCh38)
Location 12:124111825-124111847
Sequence TGGACTGGGGTTGCATTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103873829_1103873836 10 Left 1103873829 12:124111825-124111847 CCAGAAAATGCAACCCCAGTCCA 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1103873836 12:124111858-124111880 TCAGTATGTGTCCTAATTAAGGG 0: 1
1: 0
2: 1
3: 12
4: 132
1103873829_1103873835 9 Left 1103873829 12:124111825-124111847 CCAGAAAATGCAACCCCAGTCCA 0: 1
1: 0
2: 0
3: 17
4: 138
Right 1103873835 12:124111857-124111879 GTCAGTATGTGTCCTAATTAAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103873829 Original CRISPR TGGACTGGGGTTGCATTTTC TGG (reversed) Intronic
900933608 1:5751891-5751913 TGGACTGGGTTTGCATTGCCAGG - Intergenic
901091751 1:6646250-6646272 TTGAGTGGGGTTGCATCTGCTGG - Intronic
901227912 1:7625093-7625115 AGGAGTGGGGTTGCATTCACAGG + Intronic
903020141 1:20387781-20387803 TGGTTTGGGGTTGCCTTGTCGGG + Intergenic
904244831 1:29180649-29180671 AGGACTGGGGTGACATTTTAGGG - Intronic
904365737 1:30010032-30010054 GGGACTTGTGGTGCATTTTCTGG - Intergenic
909321682 1:74296611-74296633 TATACTGGGGGTGTATTTTCTGG + Intronic
909584633 1:77275786-77275808 TGGGCTTGTGTTGTATTTTCTGG + Intergenic
910052948 1:82997598-82997620 TGGAGTCATGTTGCATTTTCTGG + Intergenic
911123248 1:94316629-94316651 TGGACTAGGGTTTCCTTTTTAGG - Intergenic
911804397 1:102187236-102187258 TGGACAGAGGTTAAATTTTCAGG - Intergenic
913286559 1:117232084-117232106 TAGTCTGGGGCTGCAATTTCAGG - Intergenic
914813456 1:151046586-151046608 AGGACTTGGGTTTTATTTTCTGG - Intronic
918775887 1:188629716-188629738 TGGGATGGGATTGTATTTTCTGG + Intergenic
918804418 1:189020961-189020983 TGGACTGGGGTTATATGTTCTGG - Intergenic
1065898040 10:30181883-30181905 TGGACTGGGGTCTCATCTTGGGG - Intergenic
1066960868 10:42223264-42223286 TGGAGTGGGGTGGCATGATCTGG - Intergenic
1069851368 10:71407353-71407375 TGGGCTGAGGTTGAATGTTCAGG + Intronic
1070644524 10:78192363-78192385 TGCACTAGGGTTACATTTCCAGG + Intergenic
1072654068 10:97318680-97318702 TGGACTGGGGTTGGCATTGCTGG - Intergenic
1075340190 10:121641299-121641321 TTGATTGAGGTTGAATTTTCTGG - Intergenic
1077086717 11:756225-756247 TTGACTGGGGTGGTATTTACAGG - Intronic
1078542288 11:12222113-12222135 TGGATGGGGGTTGGATTCTCTGG + Intronic
1083896958 11:65624807-65624829 TGGGCTGGGGGTGCCTTTCCAGG + Intronic
1090864696 11:130689226-130689248 TGTACTGGGGTGGCAGTTGCGGG - Intronic
1092356320 12:7798319-7798341 TGGAGTGGGGTGGCATTATCTGG - Exonic
1092545579 12:9448678-9448700 AGGGCTGGGGTTTCATCTTCTGG - Intergenic
1092675139 12:10908650-10908672 TGTAATTGAGTTGCATTTTCTGG + Exonic
1093317205 12:17666646-17666668 TGGACTGGGCTGGCAGTTCCAGG - Intergenic
1093638973 12:21503059-21503081 TGGACTGGGGCTGCCTCTTGGGG + Intronic
1094507374 12:31073373-31073395 AGGGCTGGGGTTTCATCTTCTGG + Intergenic
1097382083 12:58907392-58907414 TGCATTGGGGGTGAATTTTCAGG - Intronic
1098771477 12:74558959-74558981 TGGACTGGGGTGGAATTTTACGG - Intergenic
1099027810 12:77487874-77487896 TGGACAGGCTTTGCATTTTATGG - Intergenic
1099036704 12:77596832-77596854 TGAACTGGGTTGGCATTTTGGGG + Intergenic
1100090703 12:90966580-90966602 TGGCCTGTAGTTTCATTTTCTGG + Intronic
1103873829 12:124111825-124111847 TGGACTGGGGTTGCATTTTCTGG - Intronic
1104677040 12:130718168-130718190 TGGAGTGGGGTTTCCTTTTGGGG + Intergenic
1106659467 13:31783741-31783763 TGGACTTGGGTTGCATGGTGGGG + Intronic
1107237142 13:38185382-38185404 TGGAGTGGGTTTTCATTTTCCGG + Intergenic
1107816575 13:44250002-44250024 TGGACCGGGGTTGAGTGTTCAGG - Intergenic
1108458547 13:50641999-50642021 TTGCCTGGAGTTGCATTTCCTGG - Intronic
1109259120 13:60122029-60122051 ATGACTGGATTTGCATTTTCAGG - Intronic
1110227222 13:73132278-73132300 TGGACTGGGGTTATATATTTGGG - Intergenic
1112230495 13:97584768-97584790 TGCACTGGGGGTCCATTTTCAGG + Intergenic
1113877616 13:113604489-113604511 TGAAATGGGGTTGCCTATTCAGG + Intronic
1119917765 14:78418052-78418074 TGGCCTGAGGTTGCATATTTAGG + Intronic
1122017925 14:98812330-98812352 TGGACTGGGGTGACAGTTTTTGG + Intergenic
1122240882 14:100366255-100366277 TGGACTGGGGGAGCTTTCTCTGG + Intronic
1123091112 14:105742685-105742707 TGGACTGGGGCTGCATAGCCGGG + Intergenic
1135946879 16:26873045-26873067 TGGAGTCTGGTTGTATTTTCAGG + Intergenic
1137532259 16:49285977-49285999 TGGAATGAGGTAACATTTTCAGG + Intergenic
1138369154 16:56510921-56510943 TGGTTTGGGGTTTTATTTTCAGG - Exonic
1138402194 16:56755496-56755518 TGGTCAGGGGTTGCTTTTTGGGG + Intronic
1143076344 17:4347266-4347288 TAGACTTGGGTTACATTTCCAGG - Intronic
1143480173 17:7223625-7223647 TGGACTGAGGTTGCATAGTTGGG - Exonic
1146201587 17:30863243-30863265 TGGACTGTGGTAGCATGATCTGG + Intronic
1148144234 17:45352440-45352462 CGGTATGGGGTTTCATTTTCAGG + Intergenic
1149092073 17:52795502-52795524 AGGCCTGGGGCTGCCTTTTCAGG - Intergenic
1149948688 17:60960572-60960594 TGGACTGCGGCTTCATTTTCTGG + Intronic
1151684181 17:75637119-75637141 TGGACTGAGGCTGAATTTACTGG - Exonic
1153441613 18:5125924-5125946 TGAACTGGTGTTGAATTTTGTGG - Intergenic
1166799458 19:45447220-45447242 TGCTCTGGGAATGCATTTTCAGG + Intronic
926625443 2:15086090-15086112 GGGACTTGTGTTGCCTTTTCTGG + Intergenic
927207203 2:20618194-20618216 TGGACTGGGCTGGCCTTTCCTGG + Exonic
927587328 2:24319495-24319517 TGGACAGGAGATACATTTTCTGG - Intronic
928816371 2:35299571-35299593 TGCACTGGTGTTTCATTGTCTGG - Intergenic
929770373 2:44886803-44886825 TAGACTGGGGCTTCATTTTCTGG - Intergenic
930133968 2:47882259-47882281 TCGACTGGGGTTGAATGTTGTGG + Intronic
933747524 2:85581914-85581936 TGGACTGTGGCTGCATTTCTTGG + Exonic
934041264 2:88129389-88129411 TAGACTGGAGTTGCCTTTTGAGG - Intergenic
935187070 2:100744134-100744156 TAGACTGAGGCTCCATTTTCTGG + Intergenic
935469715 2:103443616-103443638 TGTACTGGGGTTCCAGTTCCAGG + Intergenic
936572505 2:113628200-113628222 TGGACTGTGGTTACATTCTCAGG + Intronic
942320130 2:174729510-174729532 AGGACAGGGGTTGCATTGGCAGG - Intergenic
944269046 2:197760392-197760414 TGGCCTGGGGGTGCATCTGCTGG - Intronic
944818982 2:203409883-203409905 TGGAAAGAGGTTGGATTTTCAGG - Intronic
948990456 2:241551364-241551386 GGGCCTGGGGGTGCCTTTTCTGG + Intergenic
1170290012 20:14758495-14758517 TGGACTGGGATTGAATATTTAGG + Intronic
1170990227 20:21294578-21294600 TGGACTGGGTTAACATTTTGGGG + Intergenic
1174637964 20:52018134-52018156 TGGGCTTGGGTTGAGTTTTCTGG + Intergenic
1177423828 21:20897005-20897027 TGGGTTGGTGTTGCTTTTTCTGG + Intergenic
1179289779 21:40008297-40008319 TAGAGTGGGGTTGAAGTTTCTGG + Intergenic
1181295543 22:21835626-21835648 GGGAATGGGGTTGCTTTTTGAGG + Intronic
1181894533 22:26095355-26095377 GGCACTTGGGCTGCATTTTCTGG + Intergenic
1182774105 22:32818407-32818429 AGGCCTGGGGTCCCATTTTCTGG - Intronic
1183477848 22:38045915-38045937 TCGGCTGGGGTTCCCTTTTCTGG + Intergenic
1184173527 22:42773007-42773029 GGCCCTGGGGTTGCATTTTGGGG - Intergenic
1185089829 22:48759960-48759982 TGTGCTGGGGTTGCATTTCGCGG - Intronic
1185427682 22:50782679-50782701 TGGACTGTGGTTACATTCTCAGG - Intronic
955766732 3:62352094-62352116 AGGACTTGGTTTCCATTTTCAGG + Intergenic
957414226 3:79879575-79879597 TGGAATGGCATTACATTTTCAGG + Intergenic
960961896 3:123076876-123076898 TGCACTGCAGTTGCAATTTCAGG + Intronic
961159007 3:124706202-124706224 TGGCCTGGAGTTTTATTTTCTGG + Intronic
962647316 3:137453253-137453275 TAGACTGGGGTTGCAGTTTTTGG + Intergenic
964815986 3:160718552-160718574 TGGATTGGGATTGAATTTACCGG - Intergenic
966448613 3:180032401-180032423 GGAACGGGGGTGGCATTTTCAGG - Intronic
967574700 3:191076727-191076749 TGGATTGGGGTCCCACTTTCTGG - Intergenic
968621363 4:1604779-1604801 TAGGCTGGGGATGCTTTTTCTGG - Intergenic
968759148 4:2433093-2433115 TGGACTGGGATGTCATTTACTGG + Intronic
969434300 4:7176736-7176758 TAAACTAGGCTTGCATTTTCAGG + Intergenic
970662750 4:18304742-18304764 TGGTCTTGGGAGGCATTTTCTGG + Intergenic
971520329 4:27541652-27541674 TGGTCTTTGGTTGCAATTTCCGG - Intergenic
973969611 4:56199025-56199047 TGGAATGGAGTGGCATTTTGGGG + Intronic
975498592 4:75060039-75060061 TCCACTGGGCTTTCATTTTCAGG - Intergenic
978386028 4:108176043-108176065 TGGACTGGGGCTATATTCTCAGG + Intergenic
979536210 4:121823504-121823526 TGGACGGGCGCTGCCTTTTCCGG + Exonic
983651459 4:170040539-170040561 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
984698687 4:182804505-182804527 TGGAATGGGGATGCATTTTGTGG - Intergenic
986087669 5:4467861-4467883 TGGACTGAGGTGGCATCTCCAGG - Intergenic
988357963 5:30201209-30201231 TGGACTGGGCAGGCATTTTTTGG - Intergenic
992839106 5:80669224-80669246 TGGATTGGGGTTCCCATTTCTGG + Intronic
997408382 5:133670459-133670481 TGGACTGGGGCATCATTTCCAGG + Intergenic
1004457170 6:15801942-15801964 AGGACTGGGGTCCCATTTCCTGG + Intergenic
1004616484 6:17295256-17295278 TGGATTGGGGTTGGTTTTTTTGG + Intergenic
1005242162 6:23843602-23843624 TAGACTAGGAATGCATTTTCAGG + Intergenic
1007150095 6:39681753-39681775 TGGACTGGAAATGCAATTTCTGG + Intronic
1014998583 6:128185721-128185743 TGGACTGAGGGAGCATTTTGTGG - Intronic
1015427216 6:133085184-133085206 TGGAGTGGGTTTGCTTTTACTGG - Intergenic
1018561787 6:165107430-165107452 TCGACTGGAGTGTCATTTTCTGG + Intergenic
1020894329 7:13920625-13920647 TGGACAGGGACTGCATTTTAAGG - Intronic
1022662232 7:32377913-32377935 TGGACTGGGATTGTGATTTCTGG + Intergenic
1022896588 7:34756131-34756153 TGGACTGAGCTGGCAGTTTCAGG - Intronic
1024785916 7:52907666-52907688 TGGAATGAGCTTGCATTTTCAGG + Intergenic
1025076131 7:55944875-55944897 TGCAGTGGCGATGCATTTTCAGG + Intergenic
1028074619 7:86496661-86496683 TGCAATGGGATTCCATTTTCTGG + Intergenic
1030433657 7:109486990-109487012 TGGAATGGGGGTGTATTTTAAGG + Intergenic
1030522962 7:110620827-110620849 TAGACTGGGGTTGCAGGTTTGGG - Intergenic
1031451010 7:121918339-121918361 TGCACTGGGTCTGCATTTTGTGG - Intronic
1032155853 7:129467098-129467120 TGGAGTGGGATTTTATTTTCTGG + Intronic
1032480569 7:132243407-132243429 TGGAATGTGGCTGCATGTTCTGG + Intronic
1032519079 7:132529128-132529150 TGGACTGGGGCTGGCTTTGCTGG - Intronic
1034395544 7:150821511-150821533 GGGACTGGGGCTGCATTCTCAGG - Intergenic
1034460684 7:151196309-151196331 GGGACTGGGGTTGGGTGTTCAGG + Intronic
1036734905 8:11304318-11304340 TGTTCTGGGGATGCATTATCTGG + Intronic
1037067762 8:14603107-14603129 TGGCCTGGGAGTGCATTCTCAGG + Intronic
1037635365 8:20697057-20697079 TGGACTGGGGAAGCATCTTAAGG + Intergenic
1038782100 8:30576851-30576873 GGTACTGGGGTTGCATCATCGGG - Intergenic
1039522426 8:38182367-38182389 TGGACTGGGGTTTCAGTTTGGGG + Intronic
1040482700 8:47841266-47841288 GTGCCTGGGGTTGCATTTGCTGG - Intronic
1040941531 8:52838867-52838889 TGTACTGTGGTTGTATTTTTAGG - Intergenic
1046038119 8:108868575-108868597 TGGATGGAGGTTGCATTTTTAGG - Intergenic
1046510994 8:115202713-115202735 TATACTGGGGTGGCATATTCTGG - Intergenic
1049333261 8:142067021-142067043 TGGATTTGGTTTGCATTTCCTGG - Intergenic
1053673610 9:40397188-40397210 TGACCTGGGGTTTCACTTTCTGG + Intergenic
1053923413 9:43023546-43023568 TGACCTGGGGTTTCACTTTCTGG + Intergenic
1054384710 9:64537253-64537275 TGACCTGGGGTTTCACTTTCTGG + Intergenic
1054511019 9:65979101-65979123 TGACCTGGGGTTTCACTTTCTGG - Intergenic
1056957776 9:91096190-91096212 TGGACTGGGGTTGCCATTAGAGG + Intergenic
1061383586 9:130275371-130275393 GGGACTCTGGTTGCATGTTCCGG + Intergenic
1187759970 X:22571895-22571917 TTGACTGGGGTTGCAGGTTTTGG - Intergenic
1189259510 X:39668481-39668503 AGGGCTGGGGCTCCATTTTCTGG - Intergenic
1190681744 X:52831709-52831731 TGGACTTGTGGTGCCTTTTCTGG + Intergenic
1191690577 X:63934060-63934082 TGGACTGGGGTCGCTTTTCCTGG + Intergenic
1195438977 X:104879911-104879933 TGGACTGAGGATTGATTTTCAGG + Intronic
1197658072 X:129138861-129138883 TGGATTGTGGTTGCTTTTTCAGG + Intergenic