ID: 1103877270

View in Genome Browser
Species Human (GRCh38)
Location 12:124137941-124137963
Sequence ATCTAGTTCTTTAGGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103877270_1103877273 9 Left 1103877270 12:124137941-124137963 CCTTCTTACCTAAAGAACTAGAT 0: 1
1: 0
2: 3
3: 11
4: 148
Right 1103877273 12:124137973-124137995 TGTTTATTCAGATCTACTCATGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103877270 Original CRISPR ATCTAGTTCTTTAGGTAAGA AGG (reversed) Intronic
903407792 1:23113083-23113105 TTCTAGTTCTTTATGTAATTTGG - Intronic
903439072 1:23373741-23373763 ACCTAGTTCATGAGGTCAGAGGG + Intergenic
905611719 1:39358287-39358309 AGCAAGTTCTTTAGATAGGAAGG - Intronic
908103623 1:60816840-60816862 CTCTAGTCCTTTAGGTAAGATGG + Intergenic
909060329 1:70871710-70871732 CTCTAGCTCATTAGGTAATAAGG - Intronic
917200207 1:172506836-172506858 ATCTGGTTATTTAGGTCAGAAGG + Intergenic
921492155 1:215790449-215790471 GTCTAGTGCTCTTGGTAAGAAGG - Intronic
923151659 1:231238933-231238955 CTATTGTTCTTTAGGGAAGAGGG + Exonic
923646075 1:235821633-235821655 ATCTGGTTCTTTATATAAAAAGG - Intronic
1065240806 10:23702204-23702226 GTACAGTTCTTTAGGGAAGAGGG + Intronic
1067862757 10:49870051-49870073 ATCTAGTTGTTTAATTAACAAGG - Intronic
1068003418 10:51364077-51364099 ATCTAATTCTTGTGCTAAGAAGG - Intronic
1068859959 10:61838029-61838051 AGCTAGTTCTTTAAGTAAGGGGG + Intergenic
1071263266 10:83940376-83940398 ATCCAGATCTCTAGGTCAGAGGG - Intergenic
1072080483 10:92025104-92025126 ATGTAGTTCTATAGTTAAAAAGG - Intronic
1073914430 10:108385815-108385837 GTCTAGTTCTTTTGCCAAGATGG - Intergenic
1082652897 11:55816420-55816442 AACTAGTTCTTTGGTTAAAAAGG - Intergenic
1084343719 11:68528368-68528390 ATATATTTCTTTAGAGAAGAGGG - Intronic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1085976785 11:81665253-81665275 ATCTCATTCTTCATGTAAGAGGG - Intergenic
1086324497 11:85684448-85684470 ATCAAGTTCTTTAACAAAGAAGG - Intergenic
1086338011 11:85818695-85818717 ATCTATTTATTTATTTAAGACGG + Intergenic
1087113438 11:94496334-94496356 ATCTACTGGTTTAGGTATGATGG - Intronic
1090528429 11:127562733-127562755 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1093587439 12:20856869-20856891 CTCAAGTCCTTTAGGTAAAAAGG - Intronic
1093968787 12:25355471-25355493 ATATAGATATTTTGGTAAGAGGG + Intergenic
1095667709 12:44821459-44821481 TTTTAGTTCTTTAAGTAAGTAGG + Intronic
1095809603 12:46357794-46357816 ATCTGGTTTTTTACTTAAGAAGG - Intergenic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1099506913 12:83489484-83489506 ATGTAATTCTTTAAGGAAGAGGG - Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1109225649 13:59691417-59691439 ATCTAGGTGTTTAGGAAATATGG + Intronic
1109241663 13:59897441-59897463 ATATAGTTCTTAAGGAAAGTGGG + Intronic
1110244376 13:73305441-73305463 ATCTATTGCTTTATGTAAGTGGG + Intergenic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1115341754 14:32300243-32300265 TTCCAGTTCATTAGCTAAGAAGG + Intergenic
1115451326 14:33551324-33551346 AGGTATTTCTTTAGGTAAGGAGG - Intronic
1115971200 14:38946587-38946609 CTCTAGTTCCTTAAGCAAGAAGG - Intergenic
1117616418 14:57538193-57538215 ATCTTCTTCTTTAAGTAGGAGGG - Intergenic
1117754811 14:58963780-58963802 AGCCAGTTCTTAAGGTAAGTTGG - Intergenic
1118353002 14:64987341-64987363 TTCTCGTTCTTTAGGGCAGAGGG - Intronic
1122316624 14:100829149-100829171 GTTTAAGTCTTTAGGTAAGAGGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1125772482 15:42179118-42179140 ATCCAGTTCTTTGGGGAATAAGG - Intronic
1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG + Exonic
1130894476 15:88159596-88159618 GTCTACTTCTTTAGGGCAGAGGG - Intronic
1134198137 16:12174950-12174972 ATCTTGTCCCTGAGGTAAGAGGG + Intronic
1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG + Intronic
1136770373 16:32833644-32833666 AATTAGTTCTTTATGTTAGACGG - Intergenic
1203072794 16_KI270728v1_random:1095751-1095773 AATTAGTTCTTTATGTTAGACGG - Intergenic
1144175179 17:12698400-12698422 ACCAAGTTCTTGAGGTGAGAGGG + Intronic
1144448037 17:15349405-15349427 ATCTGCTTCTTTAGGTTATAAGG - Intergenic
1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG + Intronic
1145394742 17:22486290-22486312 AAATAGTTCTTTGGGTAAAAAGG - Intergenic
1146024136 17:29305013-29305035 ATCTAGTTCTTAAGGTACACGGG - Intergenic
1147053427 17:37815548-37815570 ATCTAGATCTTAAAGTAAGTTGG - Intergenic
1148544335 17:48505580-48505602 ATCTAGTTATTTTGGTCACAAGG + Intergenic
1152269846 17:79317866-79317888 ATCTTGTTCTTTATGTGAGCAGG + Intronic
1153268529 18:3295981-3296003 ATCTAGTGATGCAGGTAAGAGGG - Intergenic
1153899303 18:9602034-9602056 ATTCAGTTCTATAGGTAACAAGG - Intronic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1158025827 18:52896462-52896484 ATCTAGTACCTTCTGTAAGAAGG + Intronic
1159554067 18:69926635-69926657 ATCTAATTCTTCAGGGAACATGG + Intronic
1166062670 19:40336371-40336393 ATCCAGTTCTTTAAGGAAGCCGG - Exonic
1166597717 19:44065004-44065026 ATGTAGGTCTTTAGGTCACAGGG - Intronic
1168614958 19:57830152-57830174 ATGTAGTTCCCTAGGTAACAAGG - Intronic
927145184 2:20160356-20160378 ATTTAGTTCTTTAAGTAACCTGG + Intergenic
929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG + Intergenic
931082276 2:58787676-58787698 AACTAGAACTTTAAGTAAGAAGG - Intergenic
933052823 2:77621127-77621149 ATAAATTTCTTTAGGTAATATGG - Intergenic
935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG + Intergenic
940737445 2:157469379-157469401 ATCTAGTTCTAGAAGTATGAAGG + Intronic
940801519 2:158137868-158137890 ATCTAGTTCTAAAGGAAGGAGGG - Intergenic
941434646 2:165454186-165454208 ATCTTGGTCTCTAGGAAAGATGG - Intergenic
941837717 2:170044572-170044594 ATTTAGTTCTTTATGTACAAGGG + Intronic
942361716 2:175179963-175179985 ATCTAGTTTTTTGGATAAAAGGG + Intronic
943551227 2:189341944-189341966 ATCTTTTTCTTTAGATAATACGG - Intergenic
947079762 2:226383068-226383090 ATTTAGTTCTGTAGGGAAGAGGG + Intergenic
948279851 2:236738742-236738764 ATATAGTTCATCAGGTAGGAAGG + Intergenic
1169604063 20:7295559-7295581 ATCTCTTTGTTCAGGTAAGAAGG + Intergenic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1174584838 20:51600300-51600322 AACTAATTCTTTAGGCAACATGG - Exonic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
957118144 3:76054279-76054301 ATTTAGTTCTTTAGGTCAGATGG + Intronic
958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG + Intergenic
959895827 3:111604758-111604780 ATCTAGCTCTTTACAGAAGAAGG - Intronic
960498437 3:118405736-118405758 ATCTAGTTATTTTGGTAATTGGG + Intergenic
964092830 3:152896111-152896133 ACCTAAGTTTTTAGGTAAGAAGG + Intergenic
965662997 3:171062052-171062074 ATCTAGTGGTTTGGGCAAGATGG - Exonic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968802159 4:2750300-2750322 GTCTAGTACTTGAGGTAAGAAGG + Intronic
970367808 4:15378130-15378152 AGCTAATTCTTTAGCTAACATGG + Intronic
972549801 4:40120772-40120794 ATCTGATTCTTTAGCTCAGAGGG + Exonic
972942143 4:44208921-44208943 ATCTAAATCTGTAGGTAATAAGG + Intronic
974447191 4:62000392-62000414 ATGTATTTCTTTAGGTAATGTGG + Intronic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
975155084 4:71062468-71062490 CTCTAGTTCTTAGGGCAAGAGGG + Intergenic
976691573 4:87873108-87873130 ATCTATAGCTTTAGGTAAGATGG - Intergenic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
980733484 4:136851176-136851198 ATATAGTTCTGCAGCTAAGATGG + Intergenic
983139535 4:164132536-164132558 ATGCAGTTATTTAGTTAAGATGG + Intronic
985101318 4:186461319-186461341 TTCTTGTTCTTTTGTTAAGATGG - Intronic
986625615 5:9721068-9721090 ATCTATTTATATAGGTAAGCAGG - Intergenic
987683832 5:21171179-21171201 ATATAGTTATTTAGGTCAAAGGG + Intergenic
990090053 5:52032933-52032955 ATCTAGTTCCTCAAGTGAGAGGG + Intronic
990778660 5:59333176-59333198 ATCCAGTTCTCTAGGTCAAAAGG + Intronic
991277464 5:64866467-64866489 CTCTAGTTTTTTAGGGTAGAAGG + Intronic
991511493 5:67382047-67382069 AACTAGTTCTGTAGCAAAGAAGG + Intergenic
993680059 5:90866008-90866030 CTGTGGTTCTTTAGCTAAGAGGG + Intronic
994758626 5:103826259-103826281 AACTAGTTCTATGGGTAGGAAGG - Intergenic
995367421 5:111378485-111378507 ATTTGGATCTTTAGGTGAGAAGG + Intronic
996712218 5:126554524-126554546 ATCTGGTTCTTTATGGAAAAAGG - Intronic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1001838762 5:174855227-174855249 AACTTGTTCTTTACGTTAGAAGG - Intergenic
1003038817 6:2668763-2668785 ATTTATTTTTTTAAGTAAGAAGG + Intronic
1003203830 6:3989388-3989410 ACCTAGTTCTTAAAGGAAGAAGG - Intergenic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005696752 6:28358937-28358959 TTCCAGTTCTATAGGTCAGAAGG + Intronic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1009831032 6:68935307-68935329 AACTAGTGCTCTAGGGAAGAAGG - Intronic
1010369973 6:75096302-75096324 ATATAGATCTTTAGGTAATGGGG - Intronic
1011466066 6:87658571-87658593 ATCTACTTCATTAGGTCAGGTGG + Intronic
1011579665 6:88846345-88846367 ACTTAGTTCTTTATGTAATAAGG - Intronic
1018566435 6:165159581-165159603 ATGTAGTTTTTTTGATAAGAAGG - Intergenic
1021415167 7:20375923-20375945 ATAAAATTCTTTAGGTAAAATGG + Intronic
1021787697 7:24168867-24168889 TTATAGTTCTGTAGGTTAGAGGG + Intergenic
1021812719 7:24419031-24419053 ATCTGGATCTTTATGTGAGAGGG - Intergenic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1025552009 7:62262103-62262125 AATTAGTTCTTTATGTTAGACGG - Intergenic
1026527319 7:71165825-71165847 AGCTAGTTCCTTAGGTTTGAAGG + Intronic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1029336472 7:99904182-99904204 ATCTATGTCTTTAAGTAAAATGG - Intronic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG + Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1038080241 8:24126624-24126646 ATCTAGTTATTTGGGAAAGCAGG - Intergenic
1038302846 8:26370660-26370682 ATCTAGTCCATTAGGCAAGATGG - Exonic
1038709697 8:29931848-29931870 TTCTAGTTCCTTAAGTTAGACGG - Intergenic
1039278292 8:35955661-35955683 ATCTAGTTGTTTAGAGAAGTAGG - Intergenic
1040038006 8:42889301-42889323 ACCTAATTCTATAGGTATGAGGG + Intronic
1043259283 8:78177214-78177236 AACTAATTATTTAGGAAAGAGGG - Intergenic
1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG + Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1047670907 8:127145803-127145825 ATCTTTTTCTTTAGGTAATGAGG - Intergenic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1050915440 9:11124765-11124787 TTATAGTTCTCTAGGTCAGAAGG + Intergenic
1053089800 9:35264695-35264717 ATTTACTTCATTATGTAAGAGGG + Intronic
1054957360 9:70928070-70928092 ATCTGGATATTTAGGTAATAGGG + Intronic
1056256831 9:84808066-84808088 ATCTACTTCTTTGGGAAGGATGG + Intronic
1185956531 X:4497125-4497147 ATGAAGTTCTTCAGGGAAGAAGG - Intergenic
1187083184 X:16013001-16013023 ATCTACTTCTTCAGGTTTGATGG - Intergenic
1188908421 X:35816185-35816207 ATCTAATTTTTTAGATAATAGGG - Intergenic
1193094778 X:77535402-77535424 ATCTAGTTCTTTAAGTGTTAAGG - Intronic
1194099379 X:89684029-89684051 ATCAAGTTCTTTCAGCAAGATGG + Intergenic
1197012664 X:121586137-121586159 CTCAAGTTCTTTAGCTAAAATGG - Intergenic
1197162706 X:123342066-123342088 GTCTAGGTCTTTAGGAAATAAGG - Intronic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1199278680 X:145974631-145974653 ATCTTGTTCTTGTGGTTAGATGG - Intergenic
1200452386 Y:3345408-3345430 ATCAAGTTCTTTCAGCAAGATGG + Intergenic