ID: 1103877273

View in Genome Browser
Species Human (GRCh38)
Location 12:124137973-124137995
Sequence TGTTTATTCAGATCTACTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103877271_1103877273 1 Left 1103877271 12:124137949-124137971 CCTAAAGAACTAGATAAATCTTC 0: 1
1: 0
2: 1
3: 22
4: 324
Right 1103877273 12:124137973-124137995 TGTTTATTCAGATCTACTCATGG 0: 1
1: 0
2: 0
3: 15
4: 192
1103877270_1103877273 9 Left 1103877270 12:124137941-124137963 CCTTCTTACCTAAAGAACTAGAT 0: 1
1: 0
2: 3
3: 11
4: 148
Right 1103877273 12:124137973-124137995 TGTTTATTCAGATCTACTCATGG 0: 1
1: 0
2: 0
3: 15
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103877273 Original CRISPR TGTTTATTCAGATCTACTCA TGG Intronic
900039655 1:447784-447806 TTTTCATGCAGATATACTCATGG + Intergenic
900061087 1:682760-682782 TTTTCATGCAGATATACTCATGG + Intergenic
902990442 1:20183914-20183936 TGTTTACTGAGATCCACTCTGGG + Intergenic
903294022 1:22332312-22332334 TGTTTCTTTCCATCTACTCATGG - Intergenic
906017700 1:42597068-42597090 TTTCTATTCAGATGTCCTCAAGG - Intronic
906722855 1:48021953-48021975 TCTTTTCTCAGATCTACCCATGG - Intergenic
907977454 1:59445847-59445869 TGCTTATTCAGGCCCACTCAGGG - Intronic
908752399 1:67436884-67436906 TGTTTCTTCAAATCTTCGCAAGG - Intergenic
909498765 1:76310089-76310111 TGTTTATTCAGAGCTCAGCACGG - Intronic
911179073 1:94845070-94845092 TGTCTATTAAGATCTATTCCAGG + Intronic
912833603 1:112975664-112975686 TGTATATTCAGATCAAGTCCTGG - Intergenic
916772914 1:167930848-167930870 TGTTTATGCAGATGTGCTAAAGG - Intronic
917390505 1:174531049-174531071 TGTGTATTCAGATTCACCCATGG - Intronic
917400254 1:174640633-174640655 TGTTTATTCAGTTCTGCGCGGGG - Intronic
918455807 1:184712337-184712359 TATTTATTGAATTCTACTCATGG + Intronic
918923845 1:190753187-190753209 ACTTTATTCAGACTTACTCAGGG + Intergenic
921721342 1:218475188-218475210 AGTTTATCCAGATCTAAGCAGGG + Intergenic
922373353 1:224934168-224934190 TTTTTATTAAGATCTACTGATGG - Intronic
924249674 1:242118874-242118896 TGTTTATTCATTTCTATTCTGGG - Intronic
1062941021 10:1421527-1421549 TGTTTATTCATACCTACTGTGGG + Intronic
1063889018 10:10609906-10609928 CGTTGATTCAGAACTGCTCAAGG + Intergenic
1064581368 10:16796330-16796352 TGTTTCTTCTGATCTGCTCCAGG + Intronic
1064613950 10:17133784-17133806 TGGTTACTCAGTTCCACTCAAGG - Intergenic
1067520127 10:46993571-46993593 AGCTTATTGAGATCCACTCAAGG - Intronic
1069005423 10:63312536-63312558 TTTTTATTTAGATTTCCTCATGG - Intronic
1069813099 10:71177034-71177056 AGTTCATTCAGATCCACTCCTGG - Intergenic
1070496114 10:77024705-77024727 TGTTTATTGAGACAGACTCATGG - Intronic
1071781447 10:88850390-88850412 TGTCTATACAGATCTTCTGAAGG - Intronic
1073913693 10:108377346-108377368 TGTTTATTTTGTTCTTCTCAGGG - Intergenic
1074708904 10:116160783-116160805 TGGATATTCAGATGTATTCATGG - Intronic
1074876909 10:117620874-117620896 CGTTGATTCAGATCAAATCAAGG + Intergenic
1076965879 11:83696-83718 TTTTCATGCAGATATACTCATGG + Intergenic
1080864828 11:36184434-36184456 TGTTTTTACTGGTCTACTCATGG + Intronic
1081462514 11:43284926-43284948 CCTTCATTCAGATCTTCTCAGGG + Intergenic
1089412762 11:118260656-118260678 TATTTATTCAGATTTATTAAGGG + Intronic
1089905557 11:122034305-122034327 TCTCTTTTCAGATCAACTCAAGG + Intergenic
1091262911 11:134247990-134248012 AGTTTATCCAGAACTGCTCATGG + Intergenic
1092238333 12:6823116-6823138 TGTCTCTTCAGAACTACTGATGG - Intronic
1092364403 12:7864875-7864897 TCTTTCTTCAGATCTCCTCATGG + Intronic
1092382123 12:8005223-8005245 TCTTTTTCCAGATCTCCTCATGG + Intergenic
1095771342 12:45962307-45962329 TCTTTATTCAAATCTATTGATGG + Intronic
1099741025 12:86634483-86634505 AGTTTATCAAGATCTGCTCAGGG + Intronic
1101793181 12:107949403-107949425 TTTTTATTCACATTTGCTCAAGG - Intergenic
1103877273 12:124137973-124137995 TGTTTATTCAGATCTACTCATGG + Intronic
1105049171 12:133032721-133032743 TGTTTTTTCAGCTTTACTAAAGG + Intergenic
1110348473 13:74477284-74477306 TATGTATTCAGATATAATCAAGG + Intergenic
1110639810 13:77809824-77809846 TTTTTAATCTGATCTACTCTTGG - Intergenic
1112790798 13:103000511-103000533 TGATTATTCAGTTCAACTGAAGG + Intergenic
1113412556 13:110103045-110103067 GCTTTCTTCACATCTACTCATGG + Intergenic
1114731172 14:24994160-24994182 TCTTTCTTCAGAACTACTCCTGG - Intronic
1117955738 14:61122459-61122481 TGTTTATGCACATCTCCTAAAGG - Intergenic
1118722086 14:68601612-68601634 TCTTCATTCAGATCTGCACAGGG + Intronic
1120035180 14:79688571-79688593 TGTATATTGAGGCCTACTCAAGG + Intronic
1122007088 14:98714534-98714556 TGTGTTTTAAGATCTACTCAAGG - Intronic
1122630857 14:103107200-103107222 TGTGCAGTCAGATCTGCTCAGGG - Intronic
1125980735 15:43998671-43998693 TGCTTTTTCAGATCTAATAATGG + Intronic
1126135071 15:45382126-45382148 TGTTCATCCAGATCTACCTAAGG + Intronic
1126306756 15:47267507-47267529 TGTATTTTCTGATCTACTTATGG + Intronic
1127778176 15:62285715-62285737 TGGTTATTCAAATCTACATATGG + Intergenic
1127825747 15:62701443-62701465 CATCTATTCAGATCTTCTCACGG + Intronic
1130267650 15:82422677-82422699 TGGTTATTCAAATCTACATATGG - Intergenic
1130504374 15:84524157-84524179 TGGTTATTCAAATCTACATATGG + Intergenic
1130787796 15:87119480-87119502 TGTTCATTCAGCACTACTTAAGG + Intergenic
1131305859 15:91242567-91242589 TCTTTGTTCAGATCTTCGCATGG - Intronic
1132074423 15:98808141-98808163 TGGTTATTCTGAGCTCCTCAAGG - Intronic
1132442253 15:101879829-101879851 TTTTCATGCAGATATACTCATGG - Intergenic
1135820106 16:25677580-25677602 TGTTTGTTTTGATCTAATCATGG + Intergenic
1137367675 16:47874749-47874771 TGTCTGTTCAGATCCACTGATGG + Intergenic
1137929482 16:52573191-52573213 TGTTCATTGAAGTCTACTCATGG - Intergenic
1139031263 16:62883975-62883997 AGGGTATTCAGATATACTCAGGG + Intergenic
1140725447 16:77807433-77807455 TCTTTGTTCAGAATTACTCAAGG + Intronic
1142596875 17:1034092-1034114 TGTGTAGTCCCATCTACTCAAGG - Intronic
1143848742 17:9793532-9793554 TGAAAACTCAGATCTACTCAGGG + Intronic
1145929078 17:28671574-28671596 TGTTTTTTAAGTCCTACTCAAGG + Intronic
1147117207 17:38309892-38309914 TGTGTATTCAGAACTACACAAGG - Intronic
1148412475 17:47479712-47479734 TGTGTATTCAGAACTACACAAGG + Intergenic
1150308560 17:64108188-64108210 TTTTTAATCAGATCTATTAAAGG - Intronic
1150712415 17:67543264-67543286 GGACAATTCAGATCTACTCAGGG - Intronic
1155201771 18:23524005-23524027 TGTTTATTCAATTGTAGTCAAGG - Intronic
1155606994 18:27617574-27617596 CTTTTATTCACATCTACTTAAGG - Intergenic
1156392226 18:36660998-36661020 TGTTTTTTCAGAGCCACACAAGG - Intronic
1156878860 18:42050870-42050892 TATTTATTCAGATCTTTGCAGGG + Intronic
1158724237 18:59954417-59954439 TGATTATTCAGATTGAATCATGG + Intergenic
1158926047 18:62261951-62261973 TGTTGACTCAGATCTATTAACGG - Intronic
1159192734 18:65069109-65069131 TGTTTTTGCAGCTCTACTCTTGG + Intergenic
1160642683 19:153326-153348 TTTTCATGCAGATATACTCATGG + Intergenic
1162809226 19:13154216-13154238 TGTTTTTAAAGATCTCCTCAGGG + Exonic
1164744067 19:30598650-30598672 TGTTTATCCAGATCAAAACATGG - Intronic
1166816838 19:45551389-45551411 TGTTTTTTCAGATGTAATTAAGG + Intronic
928861567 2:35863465-35863487 TTTTTATTCTTTTCTACTCATGG - Intergenic
929298633 2:40275977-40275999 TGTTTAGTCAACTCTACTGATGG - Intronic
930272790 2:49276282-49276304 TTTTTCATCAGATCTACTCATGG - Intergenic
930615065 2:53585066-53585088 TGTCTATTCAGATCTTATGAGGG + Intronic
930768951 2:55112806-55112828 TATTTATTCAGAGCTGCTCATGG + Intergenic
930968469 2:57362675-57362697 TGTTTTTTGAGATCTACTTGGGG - Intergenic
931827221 2:66014216-66014238 AGTTTATTTAGTTCAACTCATGG - Intergenic
932198525 2:69805139-69805161 TGTTTATTCACATTTCCTCCTGG - Intronic
941695194 2:168543918-168543940 TGAATATCCACATCTACTCAGGG - Intronic
941947225 2:171112854-171112876 TGTTTATTCAGTTCTCCCCATGG - Intronic
942021497 2:171870869-171870891 TGTTTAGTCAGATCCACAAATGG - Intronic
942157708 2:173148528-173148550 TGTTTATGAAGGTCTGCTCAAGG - Intronic
942587790 2:177503269-177503291 TGTTTATTCTGCTCTGCTCTTGG - Intronic
943052435 2:182932226-182932248 TGTTTATTCACATCAATTGATGG - Intronic
946512297 2:220371546-220371568 TCTATATTCATATCTACACAAGG - Intergenic
946743647 2:222825138-222825160 TATATATTCAGAACTACTCATGG - Intergenic
947940500 2:234050413-234050435 TGTGTATTGAGATCCCCTCATGG - Intergenic
1170321456 20:15103824-15103846 CCTTTATTCAGTTCTGCTCACGG - Intronic
1171863189 20:30420041-30420063 TATTTATGCAGGTCTACCCAGGG - Intergenic
950625036 3:14239155-14239177 TGTGTTTTCAGTTGTACTCAGGG + Intergenic
951972167 3:28459007-28459029 TGTTTGTTTTGATCTACTCTTGG + Intronic
952055483 3:29439865-29439887 TGATTATACAGATTTACTCATGG + Intronic
952762379 3:36925911-36925933 TTTTTATTCAGTTCTACTGCAGG + Intronic
955546996 3:60041622-60041644 TCTTTATTCAGATCATCTCTGGG - Intronic
956901746 3:73723669-73723691 TGTTTATTCAAACCCAGTCAGGG + Intergenic
959078573 3:101777225-101777247 TGTTCATTCAGATGTTTTCACGG - Intergenic
960650954 3:119949395-119949417 TGTTTCCTCAGATCTTCACATGG - Intronic
961135708 3:124508857-124508879 TGTGTATTGATATCTACTTATGG + Intronic
962060458 3:131921439-131921461 TGTTATTTCAGAGCTCCTCATGG - Intronic
962116509 3:132514914-132514936 AGTTTGTTGAGATCTACACATGG + Intronic
964611885 3:158624075-158624097 TGTTTATTAATAGTTACTCATGG + Intergenic
965135252 3:164757750-164757772 AGTTTATTCAGATCTCCTCTGGG + Intergenic
968238448 3:197052862-197052884 TTTTTAGTAAGATCTATTCATGG - Intronic
969149337 4:5155313-5155335 TGTTTATTCAGATGTCTTCTTGG + Intronic
970455024 4:16214911-16214933 CATTTATGCAGATCTACTTAAGG + Intronic
972216665 4:36905943-36905965 TGTTTGTTCCGATCTAATTATGG + Intergenic
973306234 4:48654063-48654085 TCTTTATGCAGATATACACATGG + Intronic
979114875 4:116810834-116810856 ATTTTATTAAGATCTTCTCAAGG - Intergenic
979271136 4:118763545-118763567 TGTTTCTTCAAGTCTACACATGG + Intronic
979787988 4:124740694-124740716 TGTTTATTCAGATTCAACCAGGG + Intergenic
980421864 4:132572302-132572324 TGTTTATTCAGATATACGGTTGG + Intergenic
981565250 4:146094321-146094343 TGTTTATCCAGAACTACCCAAGG - Intergenic
982045198 4:151438125-151438147 TGTTTATTAAGATTTACATATGG + Intronic
985071908 4:186174004-186174026 TGCTCTTTCAGATCCACTCAGGG + Intergenic
986439458 5:7766926-7766948 TGTAAATTCAGAACCACTCAGGG - Intronic
987661740 5:20887142-20887164 TGTTTATTTTTATCTACTTATGG - Intergenic
988761844 5:34318168-34318190 TGTTTATTTTTATCTACTTATGG + Intergenic
989076872 5:37573304-37573326 TGTTTAATGAGAGCTACTGACGG - Intronic
991000650 5:61779465-61779487 TCTTTATCCAGATATATTCAGGG - Intergenic
992418049 5:76571944-76571966 TGGTTACACAGATCTATTCATGG - Intronic
994466643 5:100142795-100142817 TGTTGACTCAGCTCTTCTCAGGG - Intergenic
996445987 5:123551097-123551119 TGTTTATTCACAAGTACACAAGG - Intronic
997910598 5:137868812-137868834 TTTTTTTTTAGATCTACTCAAGG + Intronic
998367786 5:141641928-141641950 TGTATAATCAGCTCTGCTCAAGG + Intronic
999699785 5:154217939-154217961 TTTTTATTCAGGTCCAATCAGGG - Intronic
999713525 5:154339973-154339995 TGTAAATTCTTATCTACTCAGGG + Intronic
1000195632 5:158954905-158954927 TTTTTGTTCATATGTACTCAGGG - Intronic
1000619114 5:163462522-163462544 TGCTAATCAAGATCTACTCATGG + Intronic
1001017662 5:168156013-168156035 TGTTCATTGAGATATTCTCAGGG - Intronic
1001318982 5:170664634-170664656 TATTTATTGAGATCTACTATTGG + Intronic
1001540706 5:172536182-172536204 TGTTTTTTCAGTTTTACTGAGGG + Intergenic
1002734192 5:181371159-181371181 TTTTCATGCAGATATACTCATGG - Intergenic
1002750349 6:102966-102988 TTTTCATGCAGATATACTCATGG + Intergenic
1006976340 6:38105849-38105871 TGTCTGTTCAGATATACACATGG - Intronic
1008167392 6:48155214-48155236 TGTCTATTCAGATGATCTCATGG - Intergenic
1013110055 6:107057784-107057806 TGTTTTTTAAGATCCATTCATGG + Intergenic
1014587806 6:123222401-123222423 TGTTTATACAGATCAACTGTAGG - Intronic
1015043413 6:128748915-128748937 TGTTCATTCAGATCTGCTGGTGG - Intergenic
1016467799 6:144344051-144344073 GGTTTAGTCAGATCCTCTCATGG + Intronic
1018103646 6:160463527-160463549 TGTTTTTTCAGAAATACCCATGG + Intergenic
1019117344 6:169775603-169775625 TCTTTCTTCCTATCTACTCAGGG - Intronic
1019238440 6:170643474-170643496 TTTTCATGCAGATATACTCATGG - Intergenic
1021141597 7:17032520-17032542 AGTTTAATCAGATGTACACATGG + Intergenic
1021255610 7:18388696-18388718 TGTTGTTTCAGATGGACTCAAGG - Intronic
1023344645 7:39259289-39259311 TGTTTACTCAGATGTAATCCTGG + Intronic
1024330618 7:48151217-48151239 TGTTCTTTCAGAGCTACACATGG - Intergenic
1024844459 7:53625475-53625497 AGTTTATTCAGATCTGCTGTGGG + Intergenic
1026933145 7:74236300-74236322 GCTTTCTTCAGGTCTACTCAGGG + Intronic
1029962998 7:104708358-104708380 TGTTTATTCATCTCTTCTAATGG - Intronic
1031833476 7:126654185-126654207 TGATTTTTCAGACCAACTCATGG + Intronic
1031843763 7:126779610-126779632 TGTTTATTCAAATCTTCTTTAGG + Intronic
1035509328 8:163133-163155 TTTTCATGCAGATATACTCATGG + Intergenic
1036084252 8:5596624-5596646 TGATTCTTCAGACCTGCTCAAGG - Intergenic
1036801078 8:11793097-11793119 TGTTTTTCCAGATCAACTCTAGG + Intergenic
1038097075 8:24325293-24325315 TCTTTATTCTGATCTCTTCAAGG - Intronic
1039346321 8:36709644-36709666 TATTTATTCTGCTCTCCTCAGGG + Intergenic
1040410622 8:47151000-47151022 TGTTTATTCACGTCTATTCAGGG - Intergenic
1042396253 8:68294891-68294913 TGATCATTCAGATCTAACCATGG + Intergenic
1042795042 8:72652741-72652763 TGTTCATTTGGCTCTACTCATGG + Intronic
1043808490 8:84704122-84704144 TGTTTATTAAAATTTATTCATGG + Intronic
1043822239 8:84881006-84881028 TGTTTATTTAAATCTAATAATGG - Intronic
1044340009 8:91036117-91036139 TGTTGATTCAGAACTTCCCAGGG - Intronic
1044675400 8:94722979-94723001 TGTTAATACTGCTCTACTCAAGG - Intronic
1044934531 8:97280029-97280051 TGTATTCTCAGATCAACTCATGG + Intergenic
1046688973 8:117261213-117261235 TGTTTATACAGATTCTCTCAAGG + Intergenic
1047633020 8:126728743-126728765 TGTTTAATAAAATCTAATCATGG - Intergenic
1055255435 9:74364633-74364655 TGTTTATTTAGATTAACCCATGG + Intergenic
1056150257 9:83779957-83779979 TGATTCTTTAGATATACTCATGG - Intronic
1057362544 9:94387873-94387895 TTTTTCTTCAGATCTCCTCGTGG - Intronic
1057463166 9:95285420-95285442 TGTTTATTCACATCTATTATTGG - Intronic
1057660792 9:97000221-97000243 TTTTTCTTCAGATCTCCTCGTGG + Intronic
1057925961 9:99149332-99149354 TTTTTCTTCAGATCTGCTCCTGG + Exonic
1058161740 9:101577681-101577703 TAATTATTCAGATCAAATCAGGG - Intronic
1062758643 9:138323766-138323788 TTTTCATGCAGATATACTCATGG - Intergenic
1187111632 X:16307702-16307724 TTTTTTTTCAGATTTAATCAAGG + Intergenic
1187384769 X:18838189-18838211 TGTTTAATCACATCTACCCCTGG - Intergenic
1187440542 X:19314003-19314025 TGTTTATGCAGTTCCACTCCTGG + Intergenic
1188192450 X:27188620-27188642 TGCTTTTTAAGTTCTACTCAGGG + Intergenic
1190098575 X:47502917-47502939 TGTTTTTTCAGAACTGCTCCTGG + Intergenic
1191900493 X:66035180-66035202 TATTTATTCTTTTCTACTCAAGG - Intronic
1191950270 X:66583622-66583644 TGTTTATTTGAATCTTCTCATGG - Intergenic
1197844399 X:130785586-130785608 TGTTTCTTTAGTTCTAGTCATGG - Intronic
1197899661 X:131356607-131356629 TATTTATTGAGATCTACTTATGG - Intronic
1198846040 X:140912007-140912029 TGAGGATTCAGAGCTACTCAAGG - Intergenic
1199859266 X:151785371-151785393 TGTATATTGATATATACTCAGGG + Intergenic
1201259266 Y:12142212-12142234 TCTTTCTTCACATTTACTCATGG + Intergenic
1201999642 Y:20138358-20138380 TGTTTATTCAGATTTGTCCAGGG + Intergenic
1202365542 Y:24160425-24160447 TGGTTATTCAAATCTACATATGG - Intergenic
1202505239 Y:25509697-25509719 TGGTTATTCAAATCTACATATGG + Intergenic