ID: 1103879006

View in Genome Browser
Species Human (GRCh38)
Location 12:124151693-124151715
Sequence GGGCAGGTTAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 6, 1: 11, 2: 23, 3: 46, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103879000_1103879006 4 Left 1103879000 12:124151666-124151688 CCCACTTTCAATAACATGCAAAT 0: 2
1: 29
2: 124
3: 254
4: 588
Right 1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG 0: 6
1: 11
2: 23
3: 46
4: 157
1103878999_1103879006 23 Left 1103878999 12:124151647-124151669 CCTGGAAACTGTGTTTATACCCA 0: 1
1: 0
2: 1
3: 14
4: 187
Right 1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG 0: 6
1: 11
2: 23
3: 46
4: 157
1103879001_1103879006 3 Left 1103879001 12:124151667-124151689 CCACTTTCAATAACATGCAAATT 0: 2
1: 25
2: 112
3: 270
4: 539
Right 1103879006 12:124151693-124151715 GGGCAGGTTAATGCAAATTGAGG 0: 6
1: 11
2: 23
3: 46
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103879006 Original CRISPR GGGCAGGTTAATGCAAATTG AGG Intronic