ID: 1103883509

View in Genome Browser
Species Human (GRCh38)
Location 12:124184361-124184383
Sequence CAGGGTCACCAGAAAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 6, 3: 49, 4: 503}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103883509_1103883515 4 Left 1103883509 12:124184361-124184383 CCCTCTCCTTTCTGGTGACCCTG 0: 1
1: 0
2: 6
3: 49
4: 503
Right 1103883515 12:124184388-124184410 GTACCCCATGAAGCTGGACGTGG 0: 1
1: 0
2: 0
3: 6
4: 97
1103883509_1103883520 11 Left 1103883509 12:124184361-124184383 CCCTCTCCTTTCTGGTGACCCTG 0: 1
1: 0
2: 6
3: 49
4: 503
Right 1103883520 12:124184395-124184417 ATGAAGCTGGACGTGGGCAGTGG 0: 1
1: 0
2: 1
3: 19
4: 329
1103883509_1103883514 -2 Left 1103883509 12:124184361-124184383 CCCTCTCCTTTCTGGTGACCCTG 0: 1
1: 0
2: 6
3: 49
4: 503
Right 1103883514 12:124184382-124184404 TGACTCGTACCCCATGAAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 55
1103883509_1103883516 5 Left 1103883509 12:124184361-124184383 CCCTCTCCTTTCTGGTGACCCTG 0: 1
1: 0
2: 6
3: 49
4: 503
Right 1103883516 12:124184389-124184411 TACCCCATGAAGCTGGACGTGGG 0: 1
1: 0
2: 0
3: 6
4: 53
1103883509_1103883521 14 Left 1103883509 12:124184361-124184383 CCCTCTCCTTTCTGGTGACCCTG 0: 1
1: 0
2: 6
3: 49
4: 503
Right 1103883521 12:124184398-124184420 AAGCTGGACGTGGGCAGTGGTGG 0: 1
1: 0
2: 0
3: 34
4: 346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103883509 Original CRISPR CAGGGTCACCAGAAAGGAGA GGG (reversed) Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900241980 1:1621506-1621528 CAGCGTCACCCGACAGGTGAGGG + Intronic
900548676 1:3242646-3242668 CAGGGTGACCCGGAAGGCGATGG + Intronic
900595515 1:3478537-3478559 CAGGGTCACCTGGAAGGGGTGGG - Exonic
900640594 1:3686392-3686414 CAGCTTCACCAGCAAGGACATGG - Intronic
900646808 1:3712800-3712822 CAGGGTCACCTGTCAGCAGAGGG + Intronic
900787132 1:4655939-4655961 CGGGGCCCCGAGAAAGGAGAAGG - Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
901959637 1:12814997-12815019 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903271356 1:22190369-22190391 CAGGAGCACCAGAATGGGGAAGG + Intergenic
903537443 1:24076369-24076391 GAGGGACACAAGAAGGGAGAGGG - Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
904757874 1:32779044-32779066 TAGGGTCACCAGAAATGATGAGG - Intronic
904847107 1:33428792-33428814 GAGGGTGAACAGAAAGGAGGAGG + Intronic
905288981 1:36908401-36908423 CAGGCTCTCTAGAAGGGAGAGGG - Intronic
905446973 1:38033977-38033999 CAGGGCCACCAGAAAGGTTTAGG - Intergenic
905632077 1:39524555-39524577 CAGGGCCAGCAGGGAGGAGAGGG + Intronic
905841202 1:41180362-41180384 CAGGGCAATCAGACAGGAGAAGG + Intronic
906045647 1:42828943-42828965 CAGAGTCACTAGAAAGTTGAGGG + Intronic
906142475 1:43542071-43542093 CAGGGTCACCTGTGGGGAGAAGG - Intronic
906164918 1:43678992-43679014 CACTGTCACCAGAATGCAGATGG + Intronic
906771891 1:48492554-48492576 CAGTGTCACCAGGAAGCACAAGG - Intergenic
909676629 1:78245543-78245565 CAGGGCAATCAGACAGGAGAAGG - Intergenic
912419278 1:109532368-109532390 CACGGTCTCCAGGAGGGAGAAGG + Intergenic
914996721 1:152549784-152549806 CAGGGTAATCAGGCAGGAGAAGG - Intronic
915003565 1:152615597-152615619 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
915296094 1:154922948-154922970 GAGGGTCACTGGAAAGCAGATGG - Intergenic
916807056 1:168269408-168269430 CAGTGCCACAAAAAAGGAGAAGG - Intergenic
917168797 1:172145434-172145456 CAGATTCAACAGACAGGAGAAGG - Intronic
917499607 1:175574260-175574282 CAGGGTGGGGAGAAAGGAGAAGG - Intronic
917984702 1:180304254-180304276 CAGGGTAATCAGGCAGGAGAAGG + Intronic
919326825 1:196118682-196118704 AAGGGTCAAGAGAAAAGAGAAGG + Intergenic
920202041 1:204265671-204265693 CAGAGGCACCAGAGAGCAGAAGG - Intronic
920864971 1:209744353-209744375 CAGGGAAACCAGGAAGGAGTTGG - Intergenic
921493088 1:215803280-215803302 CAGGGCAACCAGGCAGGAGAAGG + Intronic
922622068 1:226996459-226996481 CAGGGCAACCAGACAAGAGAAGG - Intronic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923121545 1:230997106-230997128 TAGGGTCACTGGAAAGGAGAAGG - Exonic
923575713 1:235157219-235157241 AAGGGAGACCAGTAAGGAGATGG + Intronic
923862713 1:237907657-237907679 CAGGGTGGAGAGAAAGGAGAGGG + Intergenic
924313975 1:242776576-242776598 CAGGAGCAAGAGAAAGGAGAGGG + Intergenic
1064966792 10:21022232-21022254 CGTGGATACCAGAAAGGAGAGGG - Intronic
1065904467 10:30237871-30237893 CAGGGTCAGAAGGAAGGAGATGG + Intergenic
1066037881 10:31512062-31512084 TAGGGGCACTAGGAAGGAGACGG - Intronic
1068663535 10:59648209-59648231 CAGGGTCATCAGAGCAGAGAGGG - Intergenic
1068872141 10:61956661-61956683 AAGGGCCACCAGAAAGGTGAAGG - Intronic
1070246724 10:74739194-74739216 CAAGGCCAACAGAAAGGAAACGG + Intergenic
1071326882 10:84526831-84526853 CAGGCTCATCGGAAAGGAAAGGG - Intergenic
1071433381 10:85623952-85623974 CTGGGACACCTGCAAGGAGATGG - Intronic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072351055 10:94557608-94557630 AAGAGTCACCAGAAAGAAGCAGG - Intronic
1072459469 10:95605871-95605893 GAGGGTCACAAGAGAGGAAAAGG + Intergenic
1072690872 10:97571654-97571676 CAAGGGAACCAGAAAGGAAAAGG + Intergenic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1074241230 10:111641226-111641248 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1074412040 10:113236633-113236655 CAGGTACACCAGAAAGGGGAGGG + Intergenic
1075316143 10:121455168-121455190 CAAGGCCACCAGGAAGGAGAAGG - Intergenic
1076294513 10:129374210-129374232 CAGTGTGAACAGAAAGCAGAGGG - Intergenic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1077723475 11:4650324-4650346 GAGGAACAGCAGAAAGGAGAGGG + Intronic
1079062362 11:17260471-17260493 CAGCATCACCAAAAAGGATAAGG + Intronic
1081340489 11:41921519-41921541 CTGGGTCTCCAGAAAGGGAAAGG - Intergenic
1082112079 11:48288167-48288189 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082140193 11:48599949-48599971 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1082247894 11:49946072-49946094 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1082273336 11:50195735-50195757 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1082599942 11:55136839-55136861 CAGGGCCATCAGGCAGGAGAAGG + Intergenic
1083063402 11:59898252-59898274 CAGGGTCAGCAGGAAGGCGGCGG - Intergenic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083989510 11:66238199-66238221 CAGGAAGACCAGAGAGGAGAAGG + Intronic
1084166008 11:67375035-67375057 CAGGGGCACCAGGAAGGAGTGGG - Intronic
1084664582 11:70569558-70569580 GAGGGGCCACAGAAAGGAGAGGG - Intronic
1084708815 11:70831342-70831364 CAGAGTTTCCAGAAAGGAAAAGG + Intronic
1084767657 11:71323153-71323175 GAGGGTCACAAGACGGGAGACGG - Intergenic
1085741259 11:79080169-79080191 AAAGGTCACCAGAAAGGTGAGGG - Intronic
1086334312 11:85784152-85784174 CAGGGTCTCTAGAAAGGTGAGGG - Intronic
1087910671 11:103750086-103750108 CAGGTTCACCATAAAGCTGATGG - Intergenic
1089343716 11:117776988-117777010 GAGGGTCCCCAGAAAGGAACAGG + Intronic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090279733 11:125445476-125445498 CAGGGGCTGCAGAAAGGAGCTGG - Intergenic
1090660807 11:128880472-128880494 TGGGGACACCAGAAAGGGGAGGG + Intergenic
1091434728 12:463250-463272 CAGGGTTACCAGTAATGACAGGG + Intronic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1092772798 12:11913301-11913323 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1093477103 12:19568212-19568234 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1093547909 12:20369490-20369512 CAGCGCCAGCAGAAAGGACAGGG - Exonic
1094684598 12:32698569-32698591 CAGGGTCTGCAGGAAGCAGATGG - Intronic
1094728119 12:33143758-33143780 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1095878412 12:47106635-47106657 GAGGGGCCCCATAAAGGAGATGG - Intronic
1096812611 12:54181275-54181297 CAAGGTATCCAGAATGGAGAGGG + Exonic
1096994356 12:55829641-55829663 CGGGGTCACCAGGGAAGAGACGG + Intronic
1097228181 12:57491520-57491542 CAGTGACAACAGAGAGGAGAAGG - Intronic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097963042 12:65551408-65551430 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1098343545 12:69476029-69476051 AAGGGGCACGAGGAAGGAGAGGG - Intronic
1098987706 12:77030244-77030266 CTGGGTCAACAGAGAGGACAGGG + Exonic
1099549266 12:84022797-84022819 CAGGGCCATCAGGCAGGAGAAGG + Intergenic
1100143215 12:91644184-91644206 TAGGGTCACAAGAAATGAGCAGG + Intergenic
1101028689 12:100638816-100638838 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1101677549 12:106932024-106932046 CATGGGCACCAGAAATGAGAAGG + Intergenic
1102002841 12:109568496-109568518 CAGGCTCACCTGAAAAGTGAGGG + Intronic
1102572207 12:113833694-113833716 CAGGACCACCAGAGAGGGGAAGG - Intronic
1103123826 12:118403734-118403756 CAGAGACACCAGAATGGAGAAGG - Intronic
1103674408 12:122644378-122644400 TAGGGGAGCCAGAAAGGAGATGG + Intergenic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1104512159 12:129390692-129390714 CAGAGTCACCAGCAAGAAGAAGG - Intronic
1104645655 12:130495471-130495493 CAGGGTGACCTGGAGGGAGAGGG - Intronic
1104855876 12:131902310-131902332 CAGGATCACCAGACAAGAGTAGG + Intronic
1105892614 13:24692415-24692437 CAGGGTCACCTAGCAGGAGAGGG - Exonic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1107595651 13:41960814-41960836 CAGGGGCACCAGGGAGGACAGGG + Intronic
1111177211 13:84610888-84610910 CAAGGACAGCACAAAGGAGATGG - Intergenic
1111931701 13:94519284-94519306 GAGAGTCACCAGGAATGAGATGG - Intergenic
1112281353 13:98065516-98065538 CAGGGCCACTAGAAGGGAGGTGG + Intergenic
1112569827 13:100583951-100583973 CAGGGTGACCAGAAAGTCCATGG + Exonic
1112594481 13:100795464-100795486 CAGGGTCAAGACAAAGCAGAGGG - Intergenic
1114715016 14:24815879-24815901 CAGGCTCACCAGAGTGGAGGTGG + Intronic
1116404701 14:44553544-44553566 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1116716892 14:48439041-48439063 CAGGGCAATCAGACAGGAGATGG - Intergenic
1117756483 14:58979515-58979537 CAGGGTCACCCGACAGTAGCTGG - Intergenic
1118482976 14:66185727-66185749 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1118484832 14:66204603-66204625 CAGGGCAACCAGGCAGGAGAAGG + Intergenic
1118804485 14:69223715-69223737 CAGAGTCTCCAGAAAGGACCAGG - Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119757807 14:77131074-77131096 CAGGGTCCCCAGGGAGGAGCAGG + Intronic
1121050133 14:90815031-90815053 CAGACTACCCAGAAAGGAGAGGG - Intronic
1121608519 14:95259375-95259397 CTTGGGCACCAGAACGGAGAAGG + Intronic
1121629183 14:95410177-95410199 CAGGGTCCCCTGAGAGGAGGTGG + Intronic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122929696 14:104927631-104927653 CAGGGTCACCAGACAGGGCGGGG - Intronic
1202915737 14_GL000194v1_random:170433-170455 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202877011 14_KI270722v1_random:12611-12633 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1123685579 15:22794882-22794904 CAGGGTCAGGGGACAGGAGAGGG - Intronic
1124401725 15:29354310-29354332 CAGGGTCTCCAGCCTGGAGATGG + Intronic
1125892635 15:43277667-43277689 CAGGGGCTCCAGAAATGAGTAGG - Intronic
1125968301 15:43891757-43891779 CAGCCTCTCCAGAAAGGAAAAGG - Intronic
1127484976 15:59410579-59410601 CTGGGTCACCAGGAAGGACCAGG - Intronic
1128939989 15:71780156-71780178 CAGTGACAGAAGAAAGGAGAGGG - Exonic
1129503803 15:76064147-76064169 CTGAGTCACTAGAAAGGAAAAGG + Intronic
1129644797 15:77420052-77420074 CGTGGTCACCAGGAAGGGGACGG - Exonic
1129987464 15:79930733-79930755 CTGAGTCACCAGAGAGGACAGGG - Intergenic
1130350603 15:83088312-83088334 CAAAGTCACCAGAAAGGAAATGG - Intergenic
1130958562 15:88644666-88644688 GAGAGTCACCAGAAAGGTGAGGG + Intronic
1131038614 15:89242679-89242701 AAGGGTCACAAGCAAGGAGCAGG + Intergenic
1131272770 15:90957072-90957094 CAGGGTGGCCAGAATGGAGGCGG - Intronic
1132815203 16:1822533-1822555 CAGGCTGAGCAGGAAGGAGAAGG - Intronic
1133827904 16:9295218-9295240 GAGGATTAGCAGAAAGGAGAGGG + Intergenic
1133846027 16:9454583-9454605 CAGGGTGCCAAGAAAGGAGATGG - Intergenic
1134074969 16:11284230-11284252 CAGGGCTCCTAGAAAGGAGAAGG + Intronic
1134202510 16:12210618-12210640 CAGGGGGACCAGAAAGGTGGTGG - Intronic
1135809898 16:25577494-25577516 CTGGGTCAACAGGGAGGAGAAGG + Intergenic
1136554145 16:30997810-30997832 GAGGGTCACCAGACAGAAGGGGG + Intronic
1137004093 16:35256012-35256034 CAGGAACAGCAGCAAGGAGAGGG - Intergenic
1137027024 16:35486572-35486594 CAGGGACAGCAGGGAGGAGAGGG - Intergenic
1137503798 16:49032835-49032857 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1138512681 16:57517721-57517743 CATGGTCACCAGCAAGAAGAGGG - Intronic
1138561047 16:57801393-57801415 CAGGGGCACCAGGGAGCAGAGGG - Intronic
1138982555 16:62287583-62287605 CAGGGGCTCCGGAAAGGATATGG + Intergenic
1140251166 16:73295679-73295701 GAGGGTCACCAGGAAAAAGAAGG + Intergenic
1141250266 16:82349791-82349813 CAGGGGCACTAGAAAGAGGAAGG + Intergenic
1141768714 16:86075557-86075579 CAGAGTCTTCAGACAGGAGAGGG - Intergenic
1141774293 16:86111877-86111899 CAGGGTCACCAGCTAAGAGGTGG - Intergenic
1141954498 16:87361383-87361405 CAGGGGCACAACACAGGAGACGG + Intronic
1142122847 16:88395692-88395714 CTGTGTGACCAGCAAGGAGAAGG + Intergenic
1142598999 17:1043964-1043986 CAGCGTCCCCAGACTGGAGAAGG - Intronic
1143095715 17:4477283-4477305 CAGGGTCACAAGAGAGGACAGGG + Intronic
1143255322 17:5553480-5553502 CAAGGTCACCAGAAACCTGAAGG - Exonic
1144413522 17:15023900-15023922 CAGGGGCACCCAAAAGGGGAAGG - Intergenic
1144519671 17:15945373-15945395 CAGGGACACCAGGAAGTAGTTGG - Exonic
1144997365 17:19279371-19279393 CAAGGTCACCAGATGGGGGAGGG + Intronic
1145686832 17:26677543-26677565 CAGGGTAATTAGGAAGGAGAAGG + Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1147416139 17:40291599-40291621 CAGGAGCACCAGAAAGGTAAAGG - Exonic
1148108752 17:45132792-45132814 CAGGGCCCCCGGGAAGGAGAGGG - Intronic
1149118828 17:53135991-53136013 CAGGGTCTCTAAAATGGAGATGG - Intergenic
1149721392 17:58848267-58848289 CAGGGTAATCAGGCAGGAGAAGG - Intronic
1149992307 17:61389979-61390001 CAGGGCCACCAGGATGGGGAAGG - Intronic
1151362498 17:73596950-73596972 CAGAGTCCCCAGAATGGAAATGG - Intronic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152419140 17:80182695-80182717 CAGGCTCTCCAGGAAGGCGATGG - Exonic
1153896797 18:9570208-9570230 CATGGCCACCAGAAAGGAACTGG - Exonic
1154374657 18:13799111-13799133 CAGGTTCAGCATAAAAGAGAAGG - Intergenic
1154510178 18:15091000-15091022 CAGGGACACCTTAAGGGAGAAGG - Intergenic
1155090740 18:22507276-22507298 AAGAATCACCAGAAAGGAGCAGG + Intergenic
1156125429 18:33899266-33899288 CAGGGTGAAAAGAAAGGAGTTGG - Intronic
1156379485 18:36544731-36544753 CAGTCCCACCAGAAAGGGGAGGG - Intronic
1156481905 18:37441630-37441652 GAGGGTGACCACAAAGCAGATGG - Intronic
1157687249 18:49652234-49652256 CAGGGTCTCCTGAATGGAGAGGG - Intergenic
1158153714 18:54401725-54401747 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158176776 18:54666183-54666205 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1158786026 18:60712670-60712692 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1159327575 18:66943151-66943173 CAGGGTCATCAGCATGCAGATGG - Intergenic
1160144526 18:76352577-76352599 CAGGGTCAACACAGAGGACAAGG + Intergenic
1160403483 18:78628678-78628700 CAGGGTCACCAGGCCTGAGATGG - Intergenic
1160445304 18:78922846-78922868 CAGGGTCACCCGTCAGCAGAGGG + Intergenic
1161857704 19:6775112-6775134 CAGGGCTTCCTGAAAGGAGAAGG + Intronic
1162743138 19:12784202-12784224 CAGGGTGACCAGACAGGGGGCGG + Intronic
1165483777 19:36083046-36083068 CAGGGTCTGCAGGAAGGACAGGG - Exonic
1166161092 19:40953855-40953877 CAAGGGCACCAGCAAGGAGCTGG - Intergenic
1166487414 19:43225288-43225310 CAGTGTGAGCAGAAAGGAAATGG + Intronic
1166593916 19:44027602-44027624 CAGGGGCATCAGCAGGGAGAAGG - Intronic
1166823088 19:45592448-45592470 TAAGGTCACCAGTAAGGAGAAGG + Exonic
1166906983 19:46118335-46118357 GAGGTTCACCAGAGAAGAGATGG + Intergenic
1166919198 19:46217269-46217291 CAGGGTCTAGAGAAAAGAGAAGG + Intergenic
1166963803 19:46515577-46515599 CTGGGTCTCCAGTATGGAGAAGG + Intronic
1167208576 19:48118934-48118956 CAGGGTCACCAGCTAGTAGCCGG + Intronic
1167768485 19:51499676-51499698 CAGGGTCCCCGGGATGGAGAAGG + Exonic
1202673664 1_KI270710v1_random:20321-20343 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
926344026 2:11929352-11929374 CAGGGCCACTAGGATGGAGATGG + Intergenic
926446767 2:12952368-12952390 CAGTCTCACCACAAAGGTGATGG - Intergenic
926590099 2:14731606-14731628 CAGGCTCAACAGAAATGAAAAGG + Intergenic
927929411 2:27034506-27034528 CAGGAACACCAGGGAGGAGATGG + Intronic
928795737 2:35016577-35016599 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
928851188 2:35749122-35749144 CAGGGAAATCAGGAAGGAGAAGG + Intergenic
928878314 2:36067191-36067213 CAGGTTGACCAGAAAGGTAAAGG + Intergenic
929938464 2:46312220-46312242 CAGGGACACAAAAAAAGAGAAGG - Intronic
929999383 2:46850644-46850666 CAGGGTCCCCAGAAAAGTGAGGG + Intronic
930891410 2:56392622-56392644 CAGAGACACCAGAAAGGAAATGG + Intergenic
932520599 2:72407862-72407884 CAGGGCAATCAGACAGGAGAAGG + Intronic
933550757 2:83772316-83772338 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
933633310 2:84680679-84680701 CAGGGAGACCAGAATGGAAATGG + Intronic
933988358 2:87613054-87613076 CAGGCTCACCAGGAAGCAGGAGG - Intergenic
934671746 2:96218200-96218222 CAGGGTCATCAGAAAGTAAAGGG - Intergenic
935020497 2:99225904-99225926 CAGGGCCATCAGGCAGGAGAAGG - Intronic
935397641 2:102624668-102624690 CAGTGACACTTGAAAGGAGATGG - Intronic
935797457 2:106658568-106658590 CATGGTCACAAGAAGAGAGAGGG - Intergenic
935815681 2:106843831-106843853 CCTGGTCTCCAGGAAGGAGAGGG + Exonic
936305483 2:111337754-111337776 CAGGCTCACCAGGAAGCAGGAGG + Intergenic
936768938 2:115888336-115888358 CAGGGTGAGAGGAAAGGAGAAGG - Intergenic
937178262 2:119964960-119964982 CAGGGTACCGAGCAAGGAGATGG + Intronic
938505400 2:131875438-131875460 CAGGGACACCTTAAGGGAGAAGG - Intergenic
938893027 2:135724308-135724330 CAGGGGAACCATAAAGGCGAAGG - Exonic
939544706 2:143538373-143538395 CAGGGTAATCAGGCAGGAGAAGG - Intronic
939760504 2:146171534-146171556 CAGGGTGTCAAGGAAGGAGATGG + Intergenic
940787840 2:158001374-158001396 GAGGGTCACCTGACAGGAGCAGG + Intronic
941440787 2:165532707-165532729 CAGGGTGATCAGGCAGGAGAAGG + Intronic
941623603 2:167806322-167806344 CAGGGCAATCAGACAGGAGAAGG - Intergenic
941856733 2:170238875-170238897 GAAGGTCAAGAGAAAGGAGAAGG - Intronic
942873959 2:180769227-180769249 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943131050 2:183853533-183853555 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
943618806 2:190124123-190124145 CAGGGTCTCCAGATTGCAGATGG + Intronic
944684886 2:202109552-202109574 CAGAATCAGCAGGAAGGAGAAGG - Intronic
944756877 2:202772430-202772452 GAGGGTCAAAAGAAAGGAGCTGG + Intergenic
945056200 2:205871410-205871432 GATGGTCCCCAGAAAGGAAAAGG - Intergenic
945986073 2:216354644-216354666 CAGGGGAACCAGAAAGGAAATGG + Intronic
946284407 2:218692290-218692312 CAAGGTAACCAGAGTGGAGAAGG + Exonic
947293749 2:228607016-228607038 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
947308871 2:228778349-228778371 CAGGCTGTCCAGCAAGGAGATGG - Intergenic
947461124 2:230305939-230305961 CAGGGTCACAAGCCAGGAGAGGG + Intronic
947614792 2:231548882-231548904 CAGGGGCACAAGAAAGGAGAAGG - Intergenic
947774767 2:232698799-232698821 GTGCTTCACCAGAAAGGAGAGGG + Intronic
948674789 2:239590499-239590521 CTGGGTTATCAGAAAGGTGAAGG + Intergenic
948687532 2:239678264-239678286 CAGGGTCTCCAGGAAGGTGTCGG - Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948752640 2:240141373-240141395 CAGGGTGACCAGGAATGACAGGG - Intronic
1168874411 20:1160917-1160939 CAAGGCCAACAGAAAGAAGATGG + Intronic
1169546425 20:6655391-6655413 CAAGGTCCCCAGCAAGGAGCTGG - Intergenic
1170429781 20:16265433-16265455 CATTGTCAGCATAAAGGAGAAGG + Intergenic
1170666723 20:18393089-18393111 CTGGGGCCCAAGAAAGGAGAAGG + Intronic
1171722144 20:28573819-28573841 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1172224836 20:33298467-33298489 AAGGGCGACCAGAGAGGAGAAGG + Intronic
1172272632 20:33663298-33663320 GAGGGTTTCCAGAAAGGAGGCGG + Intronic
1172623943 20:36336854-36336876 CAGTGGCCCCAGGAAGGAGAAGG - Intronic
1173163746 20:40671640-40671662 CAGGGACACCAGGAAGGGCATGG + Intergenic
1173323607 20:42011958-42011980 CAAGCTGACCAGGAAGGAGAGGG - Intergenic
1173521815 20:43705491-43705513 CGTGGTGGCCAGAAAGGAGAGGG - Intronic
1174057111 20:47805750-47805772 CAGGGTCCAGAGAACGGAGAGGG + Intergenic
1174080773 20:47969363-47969385 CAGGGTGTCCACAAAGGAGGCGG + Intergenic
1174086515 20:48012366-48012388 AAGAGTCACAGGAAAGGAGAGGG - Intergenic
1174552056 20:51369137-51369159 CATGGTCACCAAAAAGGATGTGG + Intergenic
1174883017 20:54301956-54301978 CAGGGGCTCCAGAATGTAGACGG - Intergenic
1175412796 20:58782458-58782480 CAGGGTGAGCAGACAGGACAGGG - Intergenic
1175555778 20:59855226-59855248 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1176347960 21:5768534-5768556 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176354774 21:5889118-5889140 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176496867 21:7555921-7555943 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176542281 21:8166604-8166626 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176561232 21:8349649-8349671 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176635089 21:9185080-9185102 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1176638276 21:9270053-9270075 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1176787693 21:13278432-13278454 CAGGGACACCTTAAGGGAGAAGG + Intergenic
1177986858 21:27986887-27986909 CAGGGACACCTTAAGGGAGAAGG + Intergenic
1178116382 21:29421739-29421761 CAGGGCAATCAGGAAGGAGAAGG + Intronic
1178564148 21:33667924-33667946 CAGGGGCTCCAGCAAGCAGATGG + Intronic
1179455715 21:41498473-41498495 CAGCCTGACCAGAAAGAAGAAGG + Intronic
1179680614 21:43018597-43018619 CAGGGTCCCCACAAAGGGCACGG + Intronic
1180295697 22:10932506-10932528 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180370698 22:12033354-12033376 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1180371590 22:12042887-12042909 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180415062 22:12701730-12701752 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180422318 22:12877550-12877572 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1180931171 22:19592957-19592979 CAGAGTCTACAGAAATGAGATGG + Intergenic
1181056957 22:20264836-20264858 CAGGCTCACCAGAATGGGGGCGG + Intronic
1181541251 22:23574383-23574405 GACAGTCACCAGAAAGGAGAGGG - Intronic
1181797134 22:25318949-25318971 GACGGTCACGAGAAAGGAGAGGG + Intergenic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183686677 22:39365040-39365062 CCAGGTCACCAGCAAGCAGAGGG - Intronic
1183751438 22:39723260-39723282 CAAGGTCATCAGAAAGGAGAAGG - Intergenic
1184215757 22:43066273-43066295 CTGGGTCATCAGGAAGGAAATGG + Intronic
1184415603 22:44350262-44350284 CAGGGTCCCCAGAAAGGCAAAGG + Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1203247221 22_KI270733v1_random:83022-83044 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
949365547 3:3276669-3276691 CAGTGTTATCATAAAGGAGATGG - Intergenic
949554926 3:5144615-5144637 CCAGTTTACCAGAAAGGAGAAGG - Intronic
949561799 3:5209683-5209705 CAGGGTGATTAGAAAGGAAAGGG + Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950211391 3:11126281-11126303 CAGGGACTCCAGAGAGGATATGG + Intergenic
950407637 3:12814631-12814653 CTGGGACTCCAGAAGGGAGAAGG - Intronic
950665935 3:14494981-14495003 CAGGGTCACCTGGAAGCAGAAGG + Exonic
951587323 3:24228731-24228753 CATCCTCACCAGAAAGGTGATGG - Intronic
951783072 3:26386732-26386754 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
951816296 3:26758828-26758850 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
951963485 3:28355000-28355022 CAGGGTAATCAGGCAGGAGAAGG + Intronic
951964360 3:28366137-28366159 CAGGGTAATCAGGCAGGAGAAGG - Intronic
952693148 3:36233665-36233687 CAGGGTGCCAAGCAAGGAGATGG - Intergenic
953146003 3:40275493-40275515 CAGGGCAATCAGACAGGAGAAGG + Intergenic
953266040 3:41389365-41389387 CAGGGTAATCAGGCAGGAGAAGG - Intronic
953395194 3:42563599-42563621 CAGGGTCTCCAGGAAGCAGAAGG + Exonic
954704187 3:52470270-52470292 CAGGGTCCCAAGAAAGAAGCGGG - Intronic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
956513251 3:70017577-70017599 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957386315 3:79501338-79501360 CAGGGTCACTAGAACGGTGCCGG - Intronic
957563985 3:81861685-81861707 CAGGGTAAACATAAAAGAGAGGG + Intergenic
957853684 3:85845405-85845427 CATAGTTACAAGAAAGGAGAAGG - Intronic
958904729 3:99929220-99929242 CAGGGCCACCACTAGGGAGAAGG - Intronic
959946737 3:112133237-112133259 CAGAGACAGCAGAAAGGAGAAGG + Exonic
960238597 3:115314299-115314321 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
960389191 3:117056036-117056058 CATTGTAAACAGAAAGGAGATGG - Intronic
960611326 3:119557568-119557590 CAGGGTTAAGAGAAAGGACATGG - Intronic
961455344 3:127021102-127021124 CAGAGTCACCACAAGGGACATGG - Intronic
961514102 3:127422383-127422405 CAGGGCTTCCAGAATGGAGAGGG + Intergenic
961516886 3:127443630-127443652 CAGGCACACCAGCAGGGAGAGGG + Intergenic
961657053 3:128448758-128448780 TAAGGTCCTCAGAAAGGAGAGGG - Intergenic
962667062 3:137664713-137664735 CAGGGCAATCAGACAGGAGAAGG + Intergenic
962697920 3:137969271-137969293 CAGGGCAATCAGACAGGAGAAGG + Intergenic
963188319 3:142442292-142442314 CGGGGTCATCAGAAAGGAACGGG + Intronic
963282109 3:143394599-143394621 CAGGGCAATCAGACAGGAGAAGG + Intronic
964624863 3:158749045-158749067 AGGAGTCACCAGACAGGAGAGGG - Intronic
964634060 3:158841806-158841828 CAGGTTCACCAGATAGGTGGTGG + Intergenic
964916567 3:161848394-161848416 CAAGGCCATCAGAAAGGTGAAGG - Intergenic
965800922 3:172493243-172493265 CAGGGCCATCAGGCAGGAGAAGG - Intergenic
967365184 3:188678385-188678407 ATGGGTCACCAGAAAGAATATGG + Intronic
967888943 3:194351401-194351423 CAGGGTCACAGGACGGGAGAGGG + Intergenic
968058742 3:195712692-195712714 CAGTGGCACTAGAAAGGGGATGG - Intergenic
1202748620 3_GL000221v1_random:134968-134990 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
968406278 4:342084-342106 CAGGGGAAACAGAAAGGAAATGG + Intronic
968483711 4:848877-848899 CAGGGGCCCCTGGAAGGAGAAGG - Intergenic
968846431 4:3044808-3044830 GCTGGTCACCAGAAAGAAGAAGG + Intergenic
969863251 4:10054107-10054129 TAGGGGCACTAGAAAGGAGAGGG - Intronic
971072323 4:23109002-23109024 TAGGGTCTCCACAAAGGATAGGG + Intergenic
971072994 4:23115613-23115635 CAAGGTCACCAGTGAGGAGGTGG + Intergenic
972248629 4:37275077-37275099 CAGGGCAACCAGGCAGGAGAAGG + Intronic
973116426 4:46465786-46465808 CAGGGCAATCAGACAGGAGAAGG - Intronic
973648536 4:52974167-52974189 CAGGGCAATCAGGAAGGAGAAGG + Intronic
973693888 4:53470487-53470509 CAGGGCAATCAGGAAGGAGAAGG + Intronic
975109211 4:70605207-70605229 AAGAGTCAGGAGAAAGGAGAAGG + Intronic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
977884590 4:102241464-102241486 CAAGGCCATCAGAAAGGTGAAGG + Intergenic
977998710 4:103529288-103529310 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
978004472 4:103599448-103599470 CAGGGCAATCAGACAGGAGAAGG - Intronic
978565856 4:110080739-110080761 CAGGGTAATCAGGCAGGAGAAGG + Intronic
978909916 4:114050768-114050790 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
979658626 4:123226205-123226227 CAGGGCAATCAGGAAGGAGAAGG - Intronic
980345239 4:131607504-131607526 GAGGGTCACTAGAAAAGGGAAGG + Intergenic
980444576 4:132888082-132888104 TGGGGTCATCAGAAAGGAAAGGG + Intergenic
981390975 4:144191138-144191160 AAGGGTCACCAGAGAGCAGGAGG - Intergenic
981493550 4:145367043-145367065 CAGGGCAATCAGACAGGAGAAGG - Intergenic
981500518 4:145446362-145446384 AAGAATCACCAGAAAGGAGCAGG + Intergenic
982275332 4:153631828-153631850 CAGTGTAGCCAGGAAGGAGAGGG - Intronic
983084550 4:163427194-163427216 CAAAGCCATCAGAAAGGAGAAGG + Intergenic
983648051 4:170011781-170011803 CTGGGGCACCAGACAAGAGATGG + Intronic
983722938 4:170880815-170880837 CAGAGTAACCAAAAAGGAGCGGG - Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984724091 4:183003351-183003373 CTGGGTCATCAGAAAGGAAAGGG + Intergenic
1202753173 4_GL000008v2_random:28465-28487 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1202759072 4_GL000008v2_random:93262-93284 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
985614983 5:914867-914889 CAGAGTCCACAGAAAGGAAATGG + Intronic
986418541 5:7553035-7553057 CAGGCTTTCCAGAAAGGAAAAGG - Intronic
987005211 5:13703563-13703585 CAGGGTCATTAGAGAGCAGAGGG - Intronic
988274108 5:29058085-29058107 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
989181008 5:38577170-38577192 CAGGATGAGAAGAAAGGAGAGGG - Intronic
989412598 5:41137519-41137541 CAGGGCAACCAGGCAGGAGAAGG + Intergenic
989838749 5:46031826-46031848 CAGGGAAATCAGACAGGAGAAGG + Intergenic
990084349 5:51955931-51955953 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
990892640 5:60664976-60664998 CGGGGTCATCAGAAAGGAAAGGG + Intronic
991383559 5:66059531-66059553 CAGGGTAATCAGGCAGGAGAAGG - Intronic
991497794 5:67244581-67244603 CAGGATCACCAGGAAGGAACAGG + Intergenic
992049786 5:72931678-72931700 CAAAGCCACCAGAAAGGTGAAGG + Intergenic
992507863 5:77405921-77405943 GAGAGTCAACAGAAAGGACAAGG + Intronic
992644276 5:78797637-78797659 CGGGGGCAGCAGAAAGGTGATGG - Intronic
993346389 5:86788608-86788630 CAGAGTCTCAAGAAAAGAGAAGG + Intergenic
993915494 5:93739966-93739988 CTGGGGCACCAGAAATGAAAAGG + Intronic
994798640 5:104340470-104340492 TAGGGTCAACACCAAGGAGAAGG - Intergenic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
995383923 5:111567583-111567605 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
996003094 5:118387105-118387127 CAGGGCAATCAGACAGGAGAAGG + Intergenic
996455486 5:123676555-123676577 CAGGGTAATCAGACAGGAGTAGG - Intergenic
997365269 5:133321502-133321524 CAGGGGCACCAGGGAGGAGTGGG - Intronic
999634079 5:153601902-153601924 CAGGGCTGCTAGAAAGGAGAAGG + Intronic
1000110800 5:158106454-158106476 CAGGGTCACCAGCTAGTAAATGG - Intergenic
1000148450 5:158476098-158476120 CAGGCTCACAAGAAAGTGGAGGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001835109 5:174825085-174825107 CAGGGAGACCAGCAAGGAGGTGG - Intergenic
1001859686 5:175043075-175043097 CATAGGCAACAGAAAGGAGATGG - Intergenic
1002057359 5:176606139-176606161 CAGGGTCCCCAAGGAGGAGAAGG - Intronic
1002086096 5:176776533-176776555 CAGGCTGACCGGAAAGAAGATGG - Intergenic
1002304641 5:178275935-178275957 CAGGGCACCCAGCAAGGAGATGG - Intronic
1002308539 5:178298560-178298582 CAGGGGCAACAGAGAGGAGCAGG - Intronic
1003191202 6:3876429-3876451 CAGGATCATCAGCAAAGAGAGGG - Intergenic
1003669064 6:8139123-8139145 CAAAGTGACCAGGAAGGAGAGGG - Intergenic
1004221522 6:13751603-13751625 CAGGGGCAACAGAAATGAGCAGG + Intergenic
1004505708 6:16245180-16245202 CAGAGTCATCAGGAAGGAGGTGG + Intronic
1005323304 6:24676779-24676801 CAGAGTCACCAGAAAGGAAAGGG - Intronic
1005496657 6:26393382-26393404 CAGGACCACCAGAAGGGAGAGGG + Exonic
1005505957 6:26468964-26468986 CAGGACCACCAGAGAGGAGAGGG + Exonic
1005558520 6:27012557-27012579 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1005917447 6:30365649-30365671 AAGGATCACGAGAAAGGAGTGGG + Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1008262609 6:49385643-49385665 CAGGTTCAGCACAAAGCAGAGGG - Intergenic
1009510512 6:64545518-64545540 CAGGGCAATCAGACAGGAGAAGG + Intronic
1009659395 6:66591536-66591558 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1010364511 6:75033642-75033664 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1011708943 6:90031351-90031373 CAGGGCAACCAGGCAGGAGAAGG + Intronic
1012180059 6:96141584-96141606 AAGGCTGAACAGAAAGGAGAAGG + Intronic
1016079270 6:139835822-139835844 CAGGGTCATTGGAAAGTAGATGG - Intergenic
1016375704 6:143418462-143418484 CAGGGAAACAAAAAAGGAGAAGG + Intergenic
1018497859 6:164368623-164368645 CAGGGTCACAATAAAGAAGGTGG - Intergenic
1018738409 6:166707590-166707612 CAGGGTCATTATAAAGGAGGAGG + Intronic
1019075516 6:169384434-169384456 CAGGGTCAGCAGAAGGGATCAGG - Intergenic
1019943380 7:4308469-4308491 CTGGATCTCCAGAACGGAGAGGG - Intergenic
1020009597 7:4800768-4800790 CAGGATCACCATTATGGAGAGGG - Intronic
1020385919 7:7602221-7602243 CAGGGCAATCAGACAGGAGAAGG + Intronic
1021267717 7:18545548-18545570 CACGGGCACCATAAAGCAGAAGG + Intronic
1021463656 7:20916942-20916964 CAGGGTTACCAGTGAGGAAATGG - Intergenic
1022050382 7:26662812-26662834 CTGGGTTCCCAGAAAGCAGAGGG + Intergenic
1022427430 7:30282788-30282810 AAGGCTCACCAGAGAGGAGGTGG + Intergenic
1022529457 7:31057868-31057890 CCTGGATACCAGAAAGGAGATGG - Intronic
1023059729 7:36315850-36315872 CACAGACAGCAGAAAGGAGACGG + Intergenic
1024054585 7:45651791-45651813 CTGAGTGACCAGGAAGGAGAGGG + Intronic
1024192931 7:47031085-47031107 CAGGGTCGCCAGGAGGCAGAGGG + Intergenic
1024197206 7:47071083-47071105 CAGGGAAACAAGAGAGGAGAGGG + Intergenic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1025095428 7:56092251-56092273 CAGGGTCACCACATGGGAGTAGG + Intronic
1026766073 7:73160680-73160702 CAGGGTTACCACAGAGGACAAGG - Intergenic
1027042548 7:74970376-74970398 CAGGGTTACCACAGAGGACAAGG - Intronic
1027081095 7:75231981-75232003 CAGGGTTACCACAGAGGACAAGG + Intergenic
1028235847 7:88360931-88360953 CACATTCTCCAGAAAGGAGATGG + Intergenic
1028399868 7:90413283-90413305 AATGGTTGCCAGAAAGGAGAAGG - Exonic
1028666919 7:93355774-93355796 CAGATTCCCCAGAAATGAGAGGG - Intronic
1028733415 7:94179263-94179285 CTGGTCCCCCAGAAAGGAGAGGG - Intergenic
1028873473 7:95794191-95794213 CAGAATCAGAAGAAAGGAGATGG - Intronic
1029200045 7:98833369-98833391 CAAGCTCACCAGACAAGAGAGGG + Intergenic
1029205747 7:98868595-98868617 CATGGACTCCAGAAAGGGGAAGG + Intronic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1032331645 7:130986132-130986154 CTGGGTCACCAGTAATTAGATGG + Intergenic
1033023314 7:137749347-137749369 CAGGGTCCACAGAAATGAAAGGG - Intronic
1033715745 7:144000357-144000379 CATGTTCACCAGGAAGGTGATGG + Intergenic
1034162146 7:149001706-149001728 GAGGGACCTCAGAAAGGAGACGG - Intergenic
1034718953 7:153270277-153270299 CAGGGTGATCAGGCAGGAGAAGG + Intergenic
1034764312 7:153703677-153703699 TAGGGCCACCACATAGGAGATGG + Intergenic
1034878399 7:154745180-154745202 CAGGATCACAGGACAGGAGAGGG - Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1037341520 8:17850651-17850673 GTTGGTCACCAGAAAGGACAGGG + Intergenic
1038064429 8:23948598-23948620 CGGGAGTACCAGAAAGGAGAAGG - Intergenic
1038152983 8:24958898-24958920 GAGGCTGCCCAGAAAGGAGAGGG + Intergenic
1038158406 8:25013115-25013137 CAGGGCAATCAGAGAGGAGAAGG + Intergenic
1038613783 8:29075280-29075302 CAGGGTGACCAGGATGGAGGAGG - Exonic
1038919508 8:32067182-32067204 CAGGGCAATCAGACAGGAGAAGG - Intronic
1039475737 8:37838595-37838617 GGGGGTGACCAGGAAGGAGAAGG - Intronic
1040539103 8:48335937-48335959 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1040541035 8:48355875-48355897 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1040910226 8:52510608-52510630 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1041809106 8:61887540-61887562 TAGGGTCAGCATTAAGGAGATGG + Intergenic
1042056248 8:64767313-64767335 CAGGTTCATCGGAAAGGAAAGGG + Intronic
1042364626 8:67922582-67922604 CAGGGTCATCAGAAAGGAAAGGG + Intergenic
1044508411 8:93048100-93048122 CAGGGGCACCATAATGGAGTTGG - Intergenic
1044854487 8:96461002-96461024 CAGGCTCACCAGAAAGCAGGTGG + Intergenic
1046081204 8:109372498-109372520 CAGGGCAACCAGGCAGGAGAAGG - Intronic
1047210397 8:122835698-122835720 CAGGGTGGCAAGAATGGAGAAGG + Intronic
1048521296 8:135157812-135157834 TAGGGTCACCAGGAAGGACTTGG - Intergenic
1049878224 8:145041755-145041777 TTTGGTCAACAGAAAGGAGATGG - Intergenic
1050007512 9:1148345-1148367 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1050960223 9:11720670-11720692 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1052104749 9:24499289-24499311 GAAGGACACCAGAGAGGAGAAGG + Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1053420194 9:37972445-37972467 CTGGGGCTCCAGAAAGGTGATGG + Intronic
1053612730 9:39731756-39731778 CTGGGTCATCATAGAGGAGATGG + Intergenic
1053718368 9:40919923-40919945 CAGGGTAATCAGGCAGGAGAGGG + Intergenic
1053870772 9:42489718-42489740 CTGGGTCATCATAGAGGAGATGG + Intergenic
1054085523 9:60739399-60739421 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054240786 9:62610634-62610656 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054554920 9:66645158-66645180 CTGGGTCATCATAGAGGAGATGG - Intergenic
1054954157 9:70888941-70888963 CAAGGACACCAGTATGGAGAAGG + Intronic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1057208636 9:93187657-93187679 CAAGGTCACCAGTGAGGAGATGG + Intronic
1057793862 9:98142289-98142311 CAGGGTCACTGCAAAGGTGAGGG + Intronic
1058962169 9:110002008-110002030 CAGGGCAATCAGGAAGGAGAAGG - Intronic
1060089532 9:120730922-120730944 CAGGGCCTCCAGGGAGGAGAGGG - Intergenic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1061287605 9:129633057-129633079 CAGGGTTACCAGACAGGAGCTGG + Intronic
1061513253 9:131073449-131073471 CAGTGTCACCAGCATGGGGAGGG + Intronic
1061631174 9:131873124-131873146 CAGACCCACCAGTAAGGAGAGGG + Intronic
1062126263 9:134864616-134864638 CATGGTCCACAGGAAGGAGAGGG - Intergenic
1203774652 EBV:65969-65991 CAAGGTCACCAACAAGGAGGAGG + Intergenic
1203757870 Un_GL000218v1:152382-152404 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203463554 Un_GL000220v1:66083-66105 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203717258 Un_KI270742v1:165058-165080 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1203533959 Un_KI270743v1:13175-13197 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1203651482 Un_KI270751v1:128644-128666 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1186044374 X:5519236-5519258 CAGGATAACAAGGAAGGAGATGG - Intergenic
1186576787 X:10775198-10775220 AAAGGTCACCAGAAGGGAGTTGG + Intronic
1186786290 X:12959155-12959177 CAGGGGCAGCAGTGAGGAGAAGG - Intergenic
1187453594 X:19421180-19421202 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1190607916 X:52164051-52164073 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1190823687 X:53997534-53997556 CAGGGTCTCTGGAAAGGTGAGGG + Intronic
1190967914 X:55319826-55319848 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1191047104 X:56150197-56150219 ATGGGTGAACAGAAAGGAGAAGG + Intergenic
1191158322 X:57299603-57299625 CAGGGACATCAGACAAGAGAAGG + Intronic
1191626991 X:63280335-63280357 CAGGGACACAGGAAAGGAGAAGG - Intergenic
1191758277 X:64618597-64618619 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1191783006 X:64888670-64888692 CAGGGCAATCAGACAGGAGAAGG + Intergenic
1192073465 X:67965271-67965293 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1192352140 X:70365236-70365258 CAGGGAAATCAGACAGGAGAAGG - Intronic
1192657336 X:73004600-73004622 TAGAATCATCAGAAAGGAGAAGG + Exonic
1192664785 X:73078407-73078429 TAGAATCATCAGAAAGGAGAAGG - Exonic
1192895915 X:75442300-75442322 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1193476628 X:81974105-81974127 CAGGGCAATCAGACAGGAGAAGG - Intergenic
1193735453 X:85150963-85150985 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1194120684 X:89960310-89960332 CTGGGTCAACTCAAAGGAGAGGG + Intergenic
1194340065 X:92696505-92696527 CAGGGAGACAGGAAAGGAGAAGG - Intergenic
1194630189 X:96273512-96273534 CAGGGTAATCAGGCAGGAGAAGG + Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195401411 X:104465208-104465230 GAGGGTGAGGAGAAAGGAGAGGG - Intergenic
1195408925 X:104547848-104547870 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1195414974 X:104610279-104610301 CAGGGTAATCAGGCAGGAGAAGG + Intronic
1195712554 X:107785617-107785639 CAGGGCCCCCAGGATGGAGAGGG - Intronic
1196077167 X:111590692-111590714 CAGGGTAATCAGGCAGGAGAAGG - Intergenic
1196109522 X:111930983-111931005 CAAGGTTACCAAAAAGGAGGAGG + Intronic
1197619982 X:128736880-128736902 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1198602214 X:138295994-138296016 CAGGGTCACAAGACAGTAGTGGG + Intergenic
1199386011 X:147223986-147224008 CAGGGCAACCAGGCAGGAGAAGG + Intergenic
1199483866 X:148327497-148327519 CAGGGCAACCAGGCAGGAGAAGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200473548 Y:3617814-3617836 CTGGGTCAACTCAAAGGAGAGGG + Intergenic
1200704741 Y:6432629-6432651 CAGGGCAATCAGGAAGGAGAAGG - Intergenic
1200934333 Y:8725013-8725035 AAGGCTCACCTGAAAGAAGAAGG + Intergenic
1201029370 Y:9732079-9732101 CAGGGCAATCAGGAAGGAGAAGG + Intergenic
1201041665 Y:9839717-9839739 CAGGGCAATTAGAAAGGAGAAGG - Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic
1201974690 Y:19836096-19836118 CAGGGTAATCAGGCAGGAGAAGG - Intergenic