ID: 1103884462

View in Genome Browser
Species Human (GRCh38)
Location 12:124190229-124190251
Sequence GTGACTATCCTGAATGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 0, 2: 12, 3: 76, 4: 491}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103884462 Original CRISPR GTGACTATCCTGAATGATCT GGG (reversed) Intronic
901424264 1:9171384-9171406 GAGACCATCTTGGATGATCTGGG + Intergenic
901864953 1:12099797-12099819 GTGACTGTCCTGAATACTGTAGG + Intronic
902293581 1:15450998-15451020 GTGACCATCTTGGATTATCTGGG + Intergenic
903456828 1:23493308-23493330 GTGATTATCTTGGATTATCTAGG - Intergenic
903966329 1:27092474-27092496 GAGATTACCCTGAATTATCTGGG + Intergenic
904548137 1:31293057-31293079 ATGAACATGCTGAATGATCTTGG - Intronic
906093953 1:43207426-43207448 GTGACTATGCTGAATACTGTAGG - Intronic
907785900 1:57612397-57612419 GAGACTATTCTGAATTATCTGGG + Intronic
910239139 1:85067650-85067672 GAGATTATCCTGGATTATCTAGG + Intronic
910286391 1:85559218-85559240 GTGTCTCTACTGAATGACCTAGG - Intronic
910462260 1:87460216-87460238 TGGATTATCCTGAATTATCTGGG + Intergenic
910803456 1:91167324-91167346 GTAACTATCCTTAATTATCCAGG - Intergenic
911252943 1:95599224-95599246 GAGATTATCCTGGATTATCTAGG + Intergenic
911324042 1:96447959-96447981 GTGATTATCCTGAACCATCCGGG + Intergenic
911522186 1:98942674-98942696 GTGAATTTCCTGAATTGTCTTGG + Intronic
911528149 1:99010798-99010820 GTGGCTATCATGAATGGCCTAGG - Intergenic
911721352 1:101194720-101194742 GTGAAGATCCTGAATAAGCTGGG - Intergenic
912959110 1:114179586-114179608 GAGATTATCCTGTATTATCTGGG + Intergenic
913057371 1:115174955-115174977 GAGATCATCCTGGATGATCTAGG - Intergenic
914044900 1:144083153-144083175 GAGAATATCCTGAATTATCTGGG - Intergenic
914133210 1:144877533-144877555 GAGAATATCCTGAATTATCTGGG + Intergenic
914324784 1:146601933-146601955 GAGACTATCCTGCATCATGTTGG + Intergenic
916181679 1:162089612-162089634 GAGATTATCCTGGATTATCTGGG + Intronic
916194828 1:162213003-162213025 CTGACTCTCCTGAATAATATGGG + Intronic
916300132 1:163264550-163264572 GATACAATCATGAATGATCTTGG - Intronic
916500905 1:165385923-165385945 GGGATTATCCTGGATTATCTAGG + Intergenic
916632896 1:166636049-166636071 GAGACTATCTTGGATTATCTAGG - Intergenic
917635211 1:176929265-176929287 GAGATTATCTTGAATTATCTGGG + Intronic
918970547 1:191410837-191410859 GAGACTATCCTGAATTATCCAGG + Intergenic
918973869 1:191454936-191454958 GCGACTGTCCTGAATGCTGTAGG - Intergenic
919188900 1:194189988-194190010 GTGATTATCCTGAACCATCCAGG + Intergenic
919467439 1:197939356-197939378 GTTACTATACTGAATGCTGTAGG + Intergenic
919582015 1:199388116-199388138 GTGATTATCCTGAACCATCCAGG + Intergenic
919813654 1:201424457-201424479 GAGATTATCCTGGATTATCTTGG + Intronic
920083031 1:203390373-203390395 AAGATTATCCTGGATGATCTGGG + Intergenic
921189069 1:212693977-212693999 GAGACTATCCTGGATTATCCAGG + Intronic
921839879 1:219817153-219817175 GAGACTATCCTGAGTCATCTAGG + Intronic
922254233 1:223878565-223878587 GAGATTATCCTGGATTATCTGGG - Intergenic
922340260 1:224649177-224649199 GAGATTATCCTGAATTATCTGGG + Intronic
922372466 1:224925112-224925134 GGGATTATCCTGGATTATCTGGG + Intronic
923012674 1:230101007-230101029 GTGACTGTCCTGAATACTGTAGG - Intronic
923216536 1:231853425-231853447 GTGACTGTCCTGAATACTGTAGG + Intronic
924292337 1:242549770-242549792 GTGACTGTACTGAATGCTGTAGG + Intergenic
924322028 1:242860063-242860085 GAGATTATCCTGTATTATCTGGG + Intergenic
924891234 1:248282693-248282715 TTGACTATCCAGTATGATGTTGG + Intergenic
1062889331 10:1046389-1046411 GTGACTGTGCTGAATAATGTGGG - Intronic
1063807374 10:9660872-9660894 GTGACTCTGCTGAATGCTGTAGG + Intergenic
1064005454 10:11695569-11695591 GAGATTATCCTGGATTATCTGGG + Intergenic
1065414933 10:25473990-25474012 GAGATTATCCTGGATTATCTGGG + Intronic
1065780981 10:29167543-29167565 GAGATTATCCTGAATTATCTTGG - Intergenic
1066030675 10:31420378-31420400 GTCAAGAACCTGAATGATCTTGG - Intronic
1066077900 10:31898704-31898726 GTGACTGTCCTGAATACTGTAGG - Intronic
1066957026 10:42182835-42182857 GAGAGTATCCTGAATTATCTGGG - Intergenic
1067124426 10:43503988-43504010 GTGACTATACTGAATACTGTAGG - Intergenic
1067270250 10:44785364-44785386 GTGACTGTACTGAATGATGTGGG + Intergenic
1068451419 10:57194448-57194470 GAGAAAATCCTGAATCATCTAGG + Intergenic
1070010891 10:72473492-72473514 GAGACTATCCTGGCTGCTCTGGG + Intronic
1070588545 10:77784883-77784905 AAGAGTATCCTGAAAGATCTGGG + Intergenic
1070762009 10:79029793-79029815 GAGATTATCCTGGATTATCTGGG + Intergenic
1070984465 10:80676615-80676637 GTGATTATTCTGATGGATCTGGG + Intergenic
1071764397 10:88646143-88646165 GTGACTTTGGTGAATTATCTGGG - Intergenic
1071927615 10:90428693-90428715 GAGATTATCCTGAATTATCTGGG - Intergenic
1072294826 10:93998855-93998877 GAGATGATCCTGGATGATCTGGG + Intronic
1072347196 10:94519846-94519868 GAGCTTATCCTGAATTATCTGGG - Intronic
1072791034 10:98318059-98318081 GAGATTATCCTGGATTATCTGGG + Intergenic
1074564038 10:114560525-114560547 GTGACTATACTGAATACTGTAGG - Intronic
1074726412 10:116314751-116314773 GAGATTATCCTGGATTATCTGGG + Intergenic
1075194694 10:120345823-120345845 GTGACTATACTGAATACTGTAGG - Intergenic
1075508871 10:123052492-123052514 GAGATTACCCTGAATTATCTGGG - Intronic
1075994367 10:126865163-126865185 GAGATTATCCTGAATTCTCTAGG + Intergenic
1078871055 11:15345294-15345316 GTGAGTATCCTGTGTGGTCTTGG + Intergenic
1079067245 11:17306083-17306105 GTGAATTTCCTGTATTATCTTGG + Intronic
1079155429 11:17942067-17942089 GTGACTATCCAAAGTAATCTTGG - Intronic
1079646485 11:22869679-22869701 GAGACTATCCTGGATTATCTGGG - Intergenic
1080208491 11:29757478-29757500 GTAGATATCCTGAATTATCTGGG - Intergenic
1080247796 11:30199137-30199159 GAGATTATCCTGAATTATCTAGG + Intergenic
1080368926 11:31611424-31611446 TTTACTATCCTGAATGAGTTGGG - Intronic
1080687826 11:34530083-34530105 GAGTTTATCCTGGATGATCTGGG + Intergenic
1080940544 11:36913164-36913186 GAGATTATCCTGGATTATCTGGG - Intergenic
1080963711 11:37189894-37189916 GAGATTATCCTGAATTATCTGGG + Intergenic
1081223122 11:40487488-40487510 GAGACTATCCTGGATCACCTGGG + Intronic
1081602556 11:44505371-44505393 GAGATTATCCTGGATTATCTGGG + Intergenic
1083040173 11:59678489-59678511 GAGATTATCCTGTATTATCTGGG - Intergenic
1083395405 11:62388101-62388123 GTGACTGTCCTGAATCCTCTAGG + Intronic
1083983194 11:66191297-66191319 GAGATTATCCTGGATTATCTGGG - Intronic
1084725608 11:70939867-70939889 GAGACTATCCTGGATCATCCAGG + Intronic
1085278072 11:75312645-75312667 GAGATTATCCTGCATGACCTGGG + Intronic
1086362960 11:86078127-86078149 GAGATTATCCTGGATTATCTGGG + Intergenic
1086435016 11:86771633-86771655 GAGATTATCCTGTATTATCTGGG - Intergenic
1087332941 11:96805720-96805742 GAGATTATCCTGAATTATCTGGG - Intergenic
1088151336 11:106749099-106749121 GTGACTATACTGAATACTGTAGG - Intronic
1088383842 11:109227227-109227249 GTTACTATACTGAATGCTGTAGG + Intergenic
1088489395 11:110372038-110372060 ATGGTTATCCTGAATTATCTGGG - Intergenic
1089939087 11:122396816-122396838 GAGATTATCCTGAATTATCCAGG - Intergenic
1090693802 11:129215708-129215730 GAGATTATCCTGGATTATCTGGG - Intronic
1090793996 11:130118572-130118594 GTGATTATTCTGAATTAACTAGG - Intronic
1091345345 11:134849004-134849026 GGGATTATCCTGGATTATCTAGG - Intergenic
1092555257 12:9553007-9553029 GTGACTATACTGAATACTGTAGG + Intergenic
1092856157 12:12675531-12675553 GAGACTATCCTGGATTATCCAGG + Intronic
1092907178 12:13112004-13112026 GAGACTATCCTGGATCATCAGGG + Intronic
1093264942 12:16991690-16991712 GTGATTATCCTGAACCATCCAGG + Intergenic
1093286189 12:17267215-17267237 GTGACTGTACTGAATGCTGTAGG - Intergenic
1093994636 12:25628592-25628614 GTGACTCTCCTGAATTACCCTGG + Intronic
1094004947 12:25739296-25739318 AGGACTGTCCTGGATGATCTAGG + Intergenic
1094098248 12:26732351-26732373 AATACTATCCTGAAGGATCTAGG - Intronic
1094516840 12:31137675-31137697 GTGACTATACTGAATACTGTAGG - Intergenic
1095197580 12:39339352-39339374 GTTACTATGCTGAATACTCTAGG - Intronic
1095207587 12:39456317-39456339 GTTACTATACTGAATGCTGTAGG - Intergenic
1095569008 12:43660742-43660764 GTGATTATCCTGAACCATCCAGG + Intergenic
1096188123 12:49597059-49597081 GTGACTATTCTGAATACTCTAGG - Intronic
1096857819 12:54497832-54497854 CTCACTATCCTGAATGATCGCGG + Exonic
1097908331 12:64943637-64943659 GAGAGTATCCTGGATCATCTAGG - Intergenic
1098209331 12:68146939-68146961 GAGATTATCCTGGATTATCTGGG + Intergenic
1098597410 12:72290811-72290833 GTGAGTGTCCTGAAAGAACTAGG + Intronic
1098813854 12:75131516-75131538 GAGATTATCCTGGATTATCTGGG + Intronic
1098851888 12:75605527-75605549 GAGATTATCCTGAGTTATCTCGG + Intergenic
1098873879 12:75846645-75846667 GAGATTATCCTGGATCATCTAGG - Intergenic
1098880533 12:75912905-75912927 GTGACTATGCTGAATACTGTAGG - Intergenic
1099154837 12:79161337-79161359 GTGACTGTACTGAATACTCTAGG - Intronic
1099566153 12:84249221-84249243 GAGATTATCCTGGATTATCTGGG + Intergenic
1099880058 12:88456905-88456927 GAGATTATCCTGGATTATCTAGG - Intergenic
1099957058 12:89361122-89361144 GAGACTATCCTGGATTACCTAGG - Intergenic
1099972781 12:89516924-89516946 GAGATCATCCTGAATTATCTGGG - Intronic
1100724367 12:97393596-97393618 GAAACTATCCTGGATTATCTGGG - Intergenic
1101757564 12:107633048-107633070 GAGATTATCCTGGATTATCTGGG - Intronic
1102092146 12:110200338-110200360 GTGACTATACTGAATACTGTAGG + Intronic
1102163904 12:110790965-110790987 GGGATTATCCTGGATTATCTGGG - Intergenic
1102369464 12:112370037-112370059 GGGATTATCCTGTATTATCTGGG + Intronic
1102772098 12:115486891-115486913 GAGATGATCCTGAATTATCTAGG + Intergenic
1103884462 12:124190229-124190251 GTGACTATCCTGAATGATCTGGG - Intronic
1104091744 12:125523467-125523489 GAGATTATCCTGAATTATCTCGG - Intronic
1104249263 12:127075423-127075445 AAGATTATCCTGAATTATCTGGG + Intergenic
1104299595 12:127552231-127552253 GGGATTTTCCTGGATGATCTGGG - Intergenic
1104369976 12:128215875-128215897 GAGATTATCCTGGATTATCTGGG + Intergenic
1104392387 12:128402004-128402026 GGGACTATCCTGGATCATCCAGG + Intronic
1104549535 12:129743726-129743748 GAGATTATCCTGAATTATCAGGG + Intronic
1104690640 12:130823454-130823476 GAGACTACCCTGGATTATCTGGG + Intronic
1104870744 12:131993713-131993735 GTGACTCTCCTGAATCCTGTGGG + Intronic
1106074327 13:26444537-26444559 GAGATTATCCTGAATTATCTGGG + Intergenic
1106548436 13:30750755-30750777 GAGATTATCCTGGATGATCTGGG + Intronic
1106711690 13:32342661-32342683 GTTACTGTCCTGAATACTCTAGG + Intronic
1107392505 13:39981906-39981928 GAGATTATCCTGGATTATCTGGG - Intergenic
1107689457 13:42937892-42937914 GTGATTCTTCTGATTGATCTGGG - Intronic
1107884844 13:44866728-44866750 GAGATTGTCCTGGATGATCTGGG - Intergenic
1108115642 13:47124667-47124689 GAGATTGTCCTGAATTATCTGGG - Intergenic
1108561364 13:51647368-51647390 GTAACTATACTGAATAATGTAGG + Intronic
1108711613 13:53038475-53038497 GTGACTGTACTGAATAATGTAGG + Intronic
1109556574 13:63983658-63983680 GTGATTATTCTGATGGATCTAGG - Intergenic
1109662883 13:65488669-65488691 GTCACTTTCCTTCATGATCTTGG + Intergenic
1109805735 13:67440113-67440135 GTGAGCATTCTCAATGATCTTGG - Intergenic
1110154681 13:72301700-72301722 GAGATTATCCTGGATGATCAAGG + Intergenic
1110300021 13:73915239-73915261 GAAATTATCCTGAATTATCTGGG - Intronic
1111371003 13:87316647-87316669 GTGACTATACTGAATACTGTAGG - Intergenic
1111700583 13:91683091-91683113 GTGATTATCCTGAATTATCTGGG + Intronic
1111708283 13:91778932-91778954 GTGACTACGCTGAATGCTGTAGG + Intronic
1113499212 13:110760108-110760130 GAGGCTGTCCTGAATTATCTGGG + Intergenic
1114169260 14:20255128-20255150 GAGTTTATCCTGAATTATCTGGG - Intergenic
1116013500 14:39379313-39379335 GGGACTATCCTGAAAGAGGTGGG - Intronic
1116758127 14:48974907-48974929 GAGATTATCCTGGATTATCTGGG + Intergenic
1116968296 14:51038114-51038136 GAGATTATCCTGGATTATCTAGG + Intronic
1117456279 14:55899966-55899988 GTTACTATCCTGAATATTGTAGG + Intergenic
1117484882 14:56186034-56186056 GAGATTATCCTGGATTATCTGGG + Intronic
1118009247 14:61592524-61592546 GAGATTATCCTGAATTATCTGGG - Intronic
1118497449 14:66322407-66322429 GAGATGATCCTGAATTATCTGGG + Intergenic
1120125383 14:80735931-80735953 GAGATTATCCTGTATTATCTGGG - Intronic
1120234297 14:81873426-81873448 GTGATTATCCTGAATTAACTAGG - Intergenic
1120408043 14:84114049-84114071 GAGATTATCCTGAATTATGTAGG + Intergenic
1120672966 14:87385924-87385946 GAGATTATCCTGAATTATCCAGG + Intergenic
1121034717 14:90691755-90691777 GTGAGTGTCCTGAATGCTGTTGG - Intronic
1122020818 14:98836478-98836500 GAGACTATCCTGGGTGATCCTGG - Intergenic
1202936085 14_KI270725v1_random:88941-88963 GAGAGTATCCTGAATTATCTGGG + Intergenic
1124050869 15:26196628-26196650 GAGAGCATCCTGGATGATCTGGG + Intergenic
1124425558 15:29559755-29559777 GAGACTATCCTGGATTATGTAGG - Intronic
1124846581 15:33297204-33297226 GAGATTATCCTGGATAATCTGGG - Intergenic
1125054706 15:35343969-35343991 GGGACTAAACTGATTGATCTAGG + Intronic
1125071653 15:35561878-35561900 GAGATTATCCTGAATTATCTAGG + Intergenic
1125413289 15:39427271-39427293 GGGACCACCCTGAATCATCTAGG + Intergenic
1126405665 15:48320178-48320200 GAGATTATCCTGGATAATCTGGG + Intergenic
1126525844 15:49653192-49653214 GAGATTATCCTGAATTATCTAGG + Exonic
1126539588 15:49807045-49807067 CTGAAAATCCAGAATGATCTAGG + Intergenic
1126564910 15:50084884-50084906 GAGAATATCCTGAATGATGGAGG - Intronic
1128757347 15:70192106-70192128 GAGATTATCCTGGATGATCAGGG - Intergenic
1128790295 15:70428279-70428301 GTGATTATCCTGGATTATCCAGG + Intergenic
1128819584 15:70639793-70639815 GAGATTATCCTGGATTATCTAGG + Intergenic
1130195825 15:81779464-81779486 GAGATTATCCTGGATTATCTGGG - Intergenic
1130928211 15:88400802-88400824 GAGATTATCCTGGATCATCTGGG + Intergenic
1131324385 15:91428437-91428459 GAGATTATCCTGGATTATCTGGG + Intergenic
1131974074 15:97924779-97924801 GTGATTCTTCTGAAGGATCTTGG - Intergenic
1132420583 15:101663339-101663361 GTTACTGTACTGAATGCTCTAGG - Intronic
1133474684 16:6108903-6108925 GTGATTATTCTGGATTATCTAGG - Intronic
1133573799 16:7068122-7068144 GAGATTATCCTGGATAATCTGGG - Intronic
1134403052 16:13929327-13929349 GGGACTATCCTGAACAAACTGGG - Intronic
1134864093 16:17589585-17589607 GAGATTATCTTGAATTATCTGGG + Intergenic
1135463163 16:22662503-22662525 GTGATCATCCTGGATGATTTAGG - Intergenic
1137419715 16:48321673-48321695 GTGACTATACTGAATACTGTAGG + Intronic
1137504957 16:49046337-49046359 GAGATTATCCTGGATGATCTAGG - Intergenic
1137587925 16:49675315-49675337 GTGCCTCTCCTGCATGATCCAGG - Intronic
1137733816 16:50709667-50709689 GAGATGATCCTGATTGATCTGGG - Intronic
1137837247 16:51604578-51604600 GGGTCTCTCCTGAATTATCTTGG + Intergenic
1137959534 16:52868384-52868406 GAGATTATCCTCAATAATCTGGG - Intergenic
1137972658 16:53001228-53001250 GAGATTATCCTGGATTATCTGGG + Intergenic
1138894554 16:61187852-61187874 AAGACTATCCTGGATCATCTGGG - Intergenic
1139295432 16:65896449-65896471 GAGACCATCGTGAATGACCTAGG + Intergenic
1140008779 16:71109013-71109035 GAGACTATCCTGCATCATGTTGG - Intronic
1140023278 16:71260122-71260144 GTGATTATCCTGGATTCTCTGGG + Intergenic
1140330889 16:74055802-74055824 GAGATTATCCTGGATTATCTGGG - Intergenic
1140414894 16:74767499-74767521 GAGATTATCCTGGATCATCTAGG + Intronic
1140534994 16:75701905-75701927 GAGATTATCCTGGATAATCTGGG + Intronic
1140743916 16:77964538-77964560 GGGATTATCCTGCATTATCTGGG - Intronic
1141041157 16:80673809-80673831 GAGATTATCCTGTATTATCTTGG + Intronic
1141229717 16:82153972-82153994 GAGATTATCCTGGATTATCTGGG - Intronic
1141361425 16:83398471-83398493 GAGACCATCCTGGATTATCTAGG - Intronic
1141417879 16:83890854-83890876 GAGACTGTCTTGGATGATCTGGG - Intergenic
1141478254 16:84288371-84288393 GAGAGTATCCTGGATTATCTGGG - Intergenic
1143262729 17:5612105-5612127 GAGATTATCCTGGATGATCTGGG + Intronic
1143787094 17:9264003-9264025 GTGACTATCCTGAAGGAGCAAGG - Intronic
1143862861 17:9903844-9903866 GTGACTGTCCTGAATGTTGCAGG + Intronic
1144100029 17:11934860-11934882 GTGAGTGACCTGAGTGATCTTGG - Intronic
1144231851 17:13214252-13214274 ATGACTATCCTGGATTAACTGGG + Intergenic
1146103493 17:30009113-30009135 GAGATTATCCTAAATTATCTAGG - Intronic
1146789262 17:35742350-35742372 CAGACTATCCTGATTAATCTGGG + Exonic
1146963536 17:37005299-37005321 GTGATTATCCTGATGGATTTTGG + Intronic
1147485111 17:40805313-40805335 GAGATTATCCTGGATTATCTGGG + Intergenic
1148227966 17:45912356-45912378 GGGATTATCCTGTATTATCTAGG + Intronic
1148237423 17:45978262-45978284 GTGACTTTCCTGAATGTTTAAGG + Intronic
1149063318 17:52450293-52450315 GTGATGATCCTGGATTATCTGGG - Intergenic
1150281076 17:63929969-63929991 GTGGCTCTCCTGAGTGCTCTAGG + Intronic
1151025473 17:70671639-70671661 GGGATTATCCTGAATGATCTGGG + Intergenic
1151035787 17:70797513-70797535 GAGATTATCCTGGATTATCTGGG - Intergenic
1151251514 17:72839356-72839378 ATGATTATCCTGGATAATCTGGG + Intronic
1152102377 17:78309655-78309677 GAGATTATCCTGGATCATCTGGG + Intergenic
1153036598 18:769048-769070 GTCACTATACTGAATGCTGTAGG - Intronic
1153340926 18:3973980-3974002 GTGACTGTCCTGAATACTGTAGG + Intronic
1153470157 18:5435504-5435526 GTGACTATACTGAATACTGTGGG - Intronic
1153744121 18:8159667-8159689 TTCACAGTCCTGAATGATCTGGG + Intronic
1153852316 18:9106981-9107003 GAGATTATCCTGGATTATCTAGG - Intronic
1155474968 18:26228160-26228182 GTAAATATGCTGAATGATTTTGG + Intronic
1157587160 18:48810199-48810221 GTGGCTATCCCGACTGATATGGG - Intronic
1157957664 18:52116235-52116257 GCAATTATCCTGCATGATCTAGG - Intergenic
1158828570 18:61252478-61252500 GTGAGTATGCTGAAGGATTTGGG - Intergenic
1159180524 18:64896496-64896518 GTGATTATTCTGATGGATCTGGG - Intergenic
1159257088 18:65960804-65960826 GAGATTATCCTGAATTATCCAGG - Intergenic
1159367459 18:67487206-67487228 ATGAATATCTTAAATGATCTTGG - Intergenic
1159618339 18:70608336-70608358 GAGATTATCCTGAATTATCTTGG + Intergenic
1159950088 18:74476563-74476585 GAGACTATCCTGGATCATCTGGG + Intergenic
1160596222 18:79976259-79976281 GTCACTATCCTGGATTATTTGGG + Intronic
1161761958 19:6180150-6180172 GAGATCATCCTGGATGATCTGGG - Intronic
1162356490 19:10188660-10188682 GAGATTATCCTGGATTATCTGGG + Intronic
1166530640 19:43541220-43541242 GAGATTATCCCAAATGATCTAGG + Intergenic
1166763547 19:45239023-45239045 ATGCCTATCCTGAAGAATCTGGG - Intronic
1167142284 19:47660353-47660375 GAGACTGTCCTGGATTATCTGGG - Intronic
1167980889 19:53273999-53274021 GAGATTATCCTGGATGATCTAGG + Intergenic
1167985506 19:53311330-53311352 GAGATTATCCTGGATGATCCAGG - Intergenic
1168011222 19:53534731-53534753 GAGATTACCCTGAATTATCTAGG - Intronic
1202684458 1_KI270712v1_random:36557-36579 GAGAATATCCTGAATTATCTGGG - Intergenic
925497225 2:4465646-4465668 GAGATTATCCTGGATTATCTGGG + Intergenic
926468304 2:13219178-13219200 GTGACTATGCTGAATACTGTAGG - Intergenic
926572385 2:14543901-14543923 GAGACTATCTTGAATTATCTGGG + Intergenic
927529892 2:23786501-23786523 GTGACTATACTGAATACTGTAGG + Intronic
927710308 2:25321452-25321474 GGGATTATCCTGGATTATCTGGG - Intronic
929538361 2:42799773-42799795 GAGATTATCCTGGATTATCTGGG - Intergenic
930565674 2:53017081-53017103 GGGAATATCTTTAATGATCTTGG + Intergenic
930590899 2:53324614-53324636 GAGATTATGCTGAATTATCTGGG + Intergenic
930688641 2:54335976-54335998 GAGATTATCCTGAATTATCTGGG - Intronic
930929513 2:56863144-56863166 GTTACTGTCCTGAATACTCTTGG - Intergenic
931949481 2:67346326-67346348 AAGATTATCCTAAATGATCTGGG + Intergenic
931961495 2:67488015-67488037 GTGATTTTCCTGAGTTATCTAGG + Intergenic
933301954 2:80550943-80550965 GTGATTCTCCTGATGGATCTGGG - Intronic
933453667 2:82493334-82493356 GTGACTGTACTGAATGCTGTAGG + Intergenic
934247260 2:90318289-90318311 GAGAGTATCCTGAATTATCTGGG + Intergenic
934262065 2:91484314-91484336 GAGAGTATCCTGAATTATCTGGG - Intergenic
934305110 2:91815300-91815322 GAGAGTATCCTGAATTATCTGGG - Intergenic
934328147 2:92037448-92037470 GAGAGTATCCTGAATTATCTGGG + Intergenic
934466529 2:94267987-94268009 GAGAGTATCCTGAATTATCTGGG + Intergenic
935326546 2:101942867-101942889 GAGATTATCCTGAATTATCTGGG + Intergenic
935494182 2:103758173-103758195 GAGATTATCCTGGATTATCTGGG - Intergenic
935801148 2:106697668-106697690 GTGATTATCCTGAACCATCCAGG - Intergenic
936135346 2:109888273-109888295 GAGATGATCCTGGATGATCTGGG + Intergenic
936209351 2:110483212-110483234 GAGATGATCCTGGATGATCTGGG - Intergenic
936428538 2:112438451-112438473 GAGATGATCCTGGATGATCTGGG - Intergenic
937489888 2:122355593-122355615 GAGATTATCTTGAATTATCTGGG + Intergenic
937771129 2:125721832-125721854 GAGACTATCCTTAATTCTCTGGG + Intergenic
938159999 2:128977128-128977150 GAGGCTGTCCTGAATAATCTGGG + Intergenic
938618795 2:133028363-133028385 GTGATTATTCTAAATGATCATGG - Intronic
938726373 2:134112127-134112149 GAGATTATCCTGGATTATCTAGG + Intergenic
939158501 2:138555718-138555740 GTGACTATCCTGAAAAATTTGGG - Intronic
940230970 2:151451266-151451288 GTTACTATACTGAATACTCTAGG - Intronic
940329396 2:152457997-152458019 GAGATTATCCTGGATTATCTGGG - Intronic
941360469 2:164545362-164545384 GAGATTATCCTGAATTATCTGGG + Intronic
941554850 2:166964859-166964881 GAGGCTATCCTAAATGATTTAGG - Intronic
941738606 2:169008475-169008497 GAGACTATCCTGGATTATCCAGG - Intronic
942167033 2:173251896-173251918 TGAAATATCCTGAATGATCTTGG + Intronic
943342899 2:186702258-186702280 GTGACTATACTGAATACTGTAGG + Intronic
944108309 2:196103335-196103357 GAGATTATCCTGAATTATCCAGG + Intergenic
944175177 2:196820969-196820991 GAGACTATCCTGATTTATCAGGG + Intergenic
944388652 2:199193491-199193513 GTGACTATGATGAATGCTGTAGG - Intergenic
945383534 2:209169382-209169404 GAGATTATCCTGGATTATCTGGG + Intergenic
946502575 2:220265460-220265482 GTGATTATCCTGGATTATCTGGG + Intergenic
946989544 2:225312698-225312720 GATACTATTCTGAATTATCTAGG + Intergenic
947320792 2:228916070-228916092 GGTAATATCCTGAATGTTCTAGG - Intronic
947827356 2:233115419-233115441 GTGACTTTCCTGGATGGTGTTGG + Intronic
948254538 2:236556415-236556437 GAGATTATCCTGAATTATCTAGG + Intergenic
1169256237 20:4101767-4101789 GAGATTATACTGAATTATCTAGG - Intergenic
1169342228 20:4805224-4805246 GAGACTATCCTGGATTATCTGGG + Intronic
1170045901 20:12085074-12085096 GAGATTATCCTGGATTATCTGGG - Intergenic
1170201379 20:13747935-13747957 GTTACTATACTGAATGCTGTAGG + Intronic
1170632538 20:18077730-18077752 GAGATTATCCTGGATCATCTGGG + Intergenic
1171230969 20:23484746-23484768 GAGATTATCCTGGATTATCTGGG + Intergenic
1173149876 20:40557781-40557803 GTGATTATCCTGGATTATCCAGG - Intergenic
1174550989 20:51361578-51361600 GAGATTATCCTGGATTATCTGGG - Intergenic
1175275735 20:57769420-57769442 GAGATTACCCTGAATGATCCTGG + Intergenic
1175294505 20:57899144-57899166 GAGACTCTCCTGGATTATCTGGG - Intergenic
1175587441 20:60153884-60153906 GTAACTATACTGAATGCTGTAGG - Intergenic
1175628456 20:60510316-60510338 GTGCCTATACTGTATGAACTGGG - Intergenic
1176995498 21:15550736-15550758 GAGATTATCCTGAATTATTTGGG - Intergenic
1177434285 21:21030503-21030525 GAGATCATCTTGAATGATCTGGG - Intronic
1180110732 21:45647893-45647915 GAGATTATCCTGGATTATCTGGG + Intronic
1180280433 22:10688621-10688643 GAGAGTATCCTGAATTATCTGGG + Intergenic
1180286816 22:10753858-10753880 GTGACTCAACTGAAGGATCTTGG - Intergenic
1180569985 22:16705539-16705561 GAGATTATCCTGAATTATCTAGG - Intergenic
1180587655 22:16907158-16907180 GAGAGTATCCTGAATTATCTGGG + Intergenic
1181833058 22:25578563-25578585 GAGATTATCCTGGATTATCTAGG + Intronic
1182127360 22:27825790-27825812 GAGATTATCCTGGATTATCTGGG - Intergenic
1182767996 22:32772617-32772639 GAGATTATCCAGAATCATCTGGG + Intronic
1183130524 22:35830617-35830639 GTGACTATACTGAATACTGTAGG + Intronic
1183141729 22:35948153-35948175 GTGACTATACTGAATACTTTAGG - Intronic
1183209817 22:36443972-36443994 GAGAGTATCCTGGATTATCTAGG + Intergenic
1183245158 22:36687703-36687725 GAGATTATCCTGGATTATCTGGG + Intronic
1183606081 22:38867307-38867329 GTGATTATCTTAAATGATCTCGG - Intronic
1184750314 22:46482231-46482253 GAGAGTATCCTGGAGGATCTGGG + Intronic
949438584 3:4056059-4056081 GAGAGTATCCTGGATTATCTGGG - Intronic
949761082 3:7471642-7471664 GAGATTATCTTGAATTATCTAGG - Intronic
949938988 3:9139346-9139368 GAGATTATCCTGGATCATCTGGG + Intronic
950070801 3:10150849-10150871 GTGACATTCCTGATTGATTTGGG + Exonic
950144048 3:10635266-10635288 GTGACTATGTTGAATGTTATGGG - Intronic
951131661 3:19053515-19053537 GAGATTATCCTCAATAATCTGGG - Intergenic
951512973 3:23525200-23525222 GTGATTATCCTGGATTATTTAGG - Intronic
951555236 3:23915130-23915152 GATATTATCCTGAATTATCTAGG + Intronic
951934267 3:28003934-28003956 GAGATGATCCTGAATGATCCAGG + Intergenic
954245694 3:49329769-49329791 GTGATTCTCCTGAAGGATCTGGG - Intronic
954516302 3:51180621-51180643 GAGATTATCCTGGATTATCTGGG - Intronic
954924319 3:54218921-54218943 GAGATTATCCTGGATTATCTGGG - Intronic
955132581 3:56185786-56185808 GAGATTATCCTGGATAATCTGGG + Intronic
955628083 3:60941531-60941553 ATCACTATTCTGAATGATATTGG + Intronic
955969892 3:64428204-64428226 GTGATTCTTCTGAAGGATCTGGG + Intronic
956839787 3:73127888-73127910 GTGACTGTCCTGAATACTGTAGG + Intergenic
957108586 3:75924247-75924269 GAGATTATCCTGAATTATCTAGG + Intronic
957144273 3:76402854-76402876 AAGATTATCCTGAATTATCTGGG - Intronic
957624076 3:82636436-82636458 GTGACTATACTAAATAATGTAGG + Intergenic
957946472 3:87069510-87069532 GAGATTATCCTGGATTATCTAGG + Intergenic
958186555 3:90128126-90128148 GTTACTATACTGAATACTCTAGG - Intergenic
958853789 3:99360060-99360082 GAGATTATCCTGGATTATCTGGG + Intergenic
960562196 3:119097052-119097074 GAGATTATCCTGGATTATCTAGG - Intronic
962444891 3:135455431-135455453 GAGATTATCCTGGATTATCTGGG - Intergenic
963935347 3:151046654-151046676 GAGATTATCCTGGATTATCTGGG + Intergenic
963990818 3:151651721-151651743 ATGACTTACCTGAATTATCTGGG + Intergenic
964723823 3:159794008-159794030 GAGACTATCCTGAATTACCCGGG - Intronic
966264463 3:178022384-178022406 GAGATTATCCTGAATTATCCAGG - Intergenic
966343215 3:178948570-178948592 GTTACTATACTGAATACTCTAGG + Intergenic
966532009 3:180991591-180991613 GAGATTATCCTGGATTATCTGGG - Intergenic
967311747 3:188112749-188112771 GAGATTATCCTGAATTTTCTAGG - Intergenic
968852566 4:3093610-3093632 GGGGCTATCTTGGATGATCTGGG + Intronic
969065288 4:4474590-4474612 GAGATTATCCTGAATTATCTGGG + Intronic
969966408 4:11001339-11001361 GTGACTATACTGAATATTGTAGG + Intergenic
970134732 4:12909598-12909620 GAGATTATCCTGAATTATCTGGG + Intergenic
970602816 4:17653812-17653834 GAGATTATCCTGAAATATCTGGG + Intronic
970998256 4:22292664-22292686 GTGATCATCCTAAATTATCTGGG - Intergenic
971004928 4:22362564-22362586 GAGACTATCCTGGATAATCCAGG - Intronic
971973429 4:33651471-33651493 GTGAGTATCCTGGATCATCCAGG + Intergenic
972338047 4:38126136-38126158 GTGACTATACTGAATACTGTTGG + Intronic
972790102 4:42363667-42363689 GAGATTATCCTGGATTATCTGGG - Intergenic
973167594 4:47096604-47096626 GAGAGTATCCTGAATTATCCAGG + Intronic
975632806 4:76419714-76419736 GAGATTATCGTGAATTATCTAGG - Intronic
976269260 4:83214405-83214427 GTTACTATACTGAATACTCTAGG + Intergenic
976817268 4:89163623-89163645 GAGATTATCCTGGATTATCTGGG - Intergenic
977021945 4:91770616-91770638 GTGGCTCTCCTGATTGATGTGGG - Intergenic
977169264 4:93740148-93740170 GTTACTATCCTGAATACTCTAGG - Intronic
977440494 4:97060348-97060370 GTCAATATACTGAAGGATCTTGG - Intergenic
978155535 4:105485721-105485743 GTGATTATCCTGAACCATCCAGG + Intergenic
979344545 4:119571347-119571369 GAGATTATCCTGAATTATCTAGG + Intronic
980599233 4:134997951-134997973 GAGATTATCCTGAATTATCCAGG + Intergenic
980841521 4:138266827-138266849 GAGATTATCCTGGATTATCTGGG - Intergenic
980869525 4:138594846-138594868 GAGATTATCCTGGATTATCTGGG - Intergenic
981141834 4:141278085-141278107 GGGATTATCCTGGATTATCTGGG + Intergenic
981336814 4:143577759-143577781 GTGACCATCCTTGATGACCTGGG - Exonic
981346450 4:143682923-143682945 GAGACTATGCTGGATTATCTGGG + Intronic
981356461 4:143794938-143794960 GGGATTATCCTGGATTATCTAGG - Intergenic
981367993 4:143925532-143925554 GGGATTATCCTGGATTATCTAGG - Intergenic
981434196 4:144700514-144700536 GAGATTATCCTGGATCATCTGGG + Intronic
981499269 4:145431400-145431422 GAGATTATCCTGGATTATCTGGG + Intergenic
981889564 4:149718867-149718889 GAGACTATCTTGGATTATCTAGG - Intergenic
982143461 4:152354431-152354453 GTGATTTTCCTCAATGTTCTGGG + Intronic
983141903 4:164160335-164160357 GTGACTCTACTGAATGCTATAGG + Intronic
983610981 4:169644776-169644798 GTGATTATCCTGGATTATCTGGG + Intronic
984483656 4:180337673-180337695 GAGATTATCCTGTATTATCTGGG - Intergenic
984809493 4:183782284-183782306 GAGATTATCCTGAATTATCTGGG - Intergenic
985024076 4:185721692-185721714 TTGACTATGCAGAAAGATCTGGG - Intronic
986351073 5:6879891-6879913 GAGATTATCCTGGATTATCTGGG - Intergenic
986550395 5:8947485-8947507 GTGACAATCCTGAACCATCAGGG + Intergenic
986618326 5:9643319-9643341 GTTACTGTCCTGAATGCTGTAGG + Intronic
987107253 5:14652275-14652297 GTGATTATCCTGAACCATCCAGG - Intergenic
987344937 5:16970728-16970750 AAGACTATCCTGAATTATCTGGG + Intergenic
988440585 5:31228234-31228256 GAGATTATCCTGGATCATCTGGG - Intronic
988447873 5:31308608-31308630 GCAACTTTCCTGAATGATGTGGG + Intronic
988589203 5:32534399-32534421 GAGATTATCCTGAATTATCTGGG - Intronic
989001622 5:36766733-36766755 GGGATTATCCTGGATTATCTGGG - Intergenic
989563439 5:42876708-42876730 CTGATTATCCTGGATGAACTGGG - Intronic
989775748 5:45205393-45205415 GTCAATAACCTGAATGAGCTTGG - Intergenic
990592572 5:57281368-57281390 GAGATTATCCTGAATTATCTAGG + Intergenic
990727523 5:58773354-58773376 GGGACTGTCCTAAATGAACTTGG + Intronic
991363043 5:65841088-65841110 GGGATTATCCTGGATAATCTGGG + Intronic
992151527 5:73909416-73909438 GTGGCTGTCCTGAATGGTCAAGG - Exonic
992440065 5:76790038-76790060 GAGATTATCCTGGATTATCTGGG + Intergenic
992519566 5:77536693-77536715 GTGACTCTTCTGAATAATATAGG - Intronic
993748675 5:91636989-91637011 ATGAATATCCTTAATGAACTTGG + Intergenic
994617189 5:102118572-102118594 GAGATTATCCTGGATTATCTAGG + Intergenic
994667828 5:102728135-102728157 AAGACTATCCTGAATTATCTGGG + Intergenic
994880454 5:105486929-105486951 GTGACTATCCTTAATAATGTTGG + Intergenic
994947199 5:106410221-106410243 GTGATTATTCTGGATTATCTGGG + Intergenic
995751472 5:115457136-115457158 GTGCCTTTTCTGAATGGTCTGGG - Intergenic
996058087 5:119002109-119002131 GAGATTATCCTGGATTATCTGGG - Intergenic
996126544 5:119731953-119731975 GAGACTATCCTGGATAATCTAGG + Intergenic
996517642 5:124390657-124390679 GACACTATCATAAATGATCTTGG + Intergenic
996993687 5:129668245-129668267 GAGATTATCCTGAATTATCCAGG - Intronic
998256063 5:140589556-140589578 AAGAGTATCCTGAAAGATCTGGG - Intronic
998652737 5:144139838-144139860 CTGACTATCCTAGAAGATCTGGG + Intergenic
999420500 5:151438042-151438064 ATGACTATGCTGGATTATCTGGG - Intronic
1000428700 5:161124305-161124327 GGGATTATCCTGGATTATCTGGG + Intergenic
1000832224 5:166116968-166116990 GTGATTATCCTGAATTATTCAGG - Intergenic
1001307716 5:170587738-170587760 GAGATTATCCTGAATTATCCAGG - Intronic
1001834620 5:174821293-174821315 GAGATTATCCTGAATTATCTGGG + Intergenic
1002478038 5:179480523-179480545 GAGATTACCCTGAATTATCTCGG - Intergenic
1002583482 5:180225459-180225481 CAGATTATCCTGAATTATCTGGG + Intergenic
1003897328 6:10620025-10620047 GAGGTTATCCTGAATTATCTGGG - Intronic
1004342262 6:14818068-14818090 GTTACTATACTGAATGCTGTAGG - Intergenic
1005499257 6:26415777-26415799 GTGATTATTCTAAATTATCTGGG - Intergenic
1008174663 6:48252687-48252709 GAGATTATTCTGAATCATCTTGG + Intergenic
1008179089 6:48305411-48305433 GAGATTATCCTGAATTGTCTGGG + Intergenic
1008618150 6:53245884-53245906 GGGATTATCCTAAATTATCTAGG - Intergenic
1008831550 6:55769671-55769693 GTGATTCCCCTGAAGGATCTAGG - Intronic
1009197067 6:60699471-60699493 GAGATTATCCTGAATTATCTGGG - Intergenic
1010228939 6:73518242-73518264 GTGATTATCCTGAACCATCCAGG - Exonic
1010470385 6:76219839-76219861 GTGGATATCCTGAATTGTCTGGG - Intergenic
1011652061 6:89515803-89515825 GTGCCTCTCCTGGATTATCTGGG + Intronic
1011791434 6:90903242-90903264 GAGATTATCCTGGATGATCCAGG + Intergenic
1012077052 6:94702505-94702527 GTTACTATACTGAATGCTATAGG + Intergenic
1012178382 6:96119329-96119351 GTTACTATACTGAATGCTTTAGG - Intronic
1014172452 6:118293470-118293492 GATATTATCCTGAATTATCTGGG - Intronic
1014742152 6:125158120-125158142 GAGATTATCCTGGATTATCTAGG - Intronic
1015176537 6:130315644-130315666 GTTACTATCCTGAATAACTTAGG - Intronic
1015202001 6:130593187-130593209 GAGAACATCCTGAATTATCTGGG + Intergenic
1016665285 6:146632401-146632423 GAGATTATCCTGGATTATCTGGG - Intronic
1016872013 6:148826957-148826979 GAGATTATCCTGGATTATCTAGG - Intronic
1017026160 6:150182915-150182937 GTGACCATCCTGAATACTGTAGG + Intronic
1017287275 6:152690423-152690445 GAGATTATCCTGGATTATCTGGG - Intergenic
1018626254 6:165781621-165781643 GAGGCTACCCTGGATGATCTTGG + Intronic
1019836385 7:3389281-3389303 GAGATTATCCTGGATTATCTGGG + Intronic
1020367657 7:7397360-7397382 GAGATTATCCTGGATTATCTGGG - Intronic
1021462341 7:20902522-20902544 GAGATTATCCTGGATTATCTGGG + Intergenic
1021616879 7:22510949-22510971 GTGATTATCCTGAACCATCCAGG - Intronic
1021897723 7:25252956-25252978 GAGATTATCCTGGATTATCTGGG + Intergenic
1023391471 7:39715284-39715306 ATGACTATCCCGGATTATCTCGG + Intergenic
1024181486 7:46899779-46899801 GAGACTATCCTGGATTTTCTGGG + Intergenic
1024496679 7:50056447-50056469 GAGATTATCCTGAATTATCTAGG - Intronic
1024800310 7:53069898-53069920 GAGACTATCTTGAATTATCCAGG + Intergenic
1026254081 7:68695785-68695807 GAGATTATCCTGGATTATCTGGG + Intergenic
1026647615 7:72185979-72186001 GGGATTATCCTGAATTATCTGGG + Intronic
1027584641 7:80043599-80043621 GAGATTATCCTGGATGATCCAGG - Intergenic
1027780571 7:82515120-82515142 GTGATTATTCTGAATTATCTGGG + Intergenic
1028163288 7:87509846-87509868 AAGATTATCCTGAATTATCTTGG + Intronic
1028660996 7:93274748-93274770 GTGATTATTCTGATGGATCTGGG + Intronic
1029804220 7:102979404-102979426 GAGATTATCCTGGATTATCTGGG - Intronic
1029975282 7:104827980-104828002 GTGACAATACTGTATGAACTGGG - Intronic
1030351210 7:108490158-108490180 GTGACTATACTGAATACTGTAGG - Intronic
1030471149 7:109963778-109963800 GTTACTATACTGAATACTCTAGG + Intergenic
1030895310 7:115052529-115052551 GTGATTATCATGGATTATCTGGG + Intergenic
1030951657 7:115798195-115798217 GAGATTATCCTGGATTATCTAGG + Intergenic
1031142248 7:117956284-117956306 GTTCCTATCCTGAATTCTCTAGG - Intergenic
1031399037 7:121309484-121309506 GAGATTATCCTGGATTATCTGGG - Intergenic
1031440522 7:121789084-121789106 GAGATTATCCTGGATTATCTGGG - Intergenic
1031815185 7:126425006-126425028 GTGATTATTCTCAAGGATCTAGG - Intergenic
1031915382 7:127558260-127558282 GAGATTATGCTGGATGATCTGGG + Intergenic
1033849494 7:145478312-145478334 GAAACCATCATGAATGATCTCGG + Intergenic
1034013489 7:147556474-147556496 GAGATTATCCTGGATTATCTGGG + Intronic
1034362355 7:150511429-150511451 GAGATTATCCTGGATTATCTAGG + Intergenic
1034476471 7:151287047-151287069 GAGATTATCCTGGATTATCTGGG + Intergenic
1035903377 8:3481613-3481635 GGGATTGTCCTGAATGATGTAGG + Intronic
1035929874 8:3768266-3768288 GTGAATATCATGATTGAGCTAGG + Intronic
1036113637 8:5933967-5933989 GTTACTATACTGAATGCTGTAGG - Intergenic
1036920247 8:12846323-12846345 GTGACTATGCTGAAAGGTATTGG - Intergenic
1038013121 8:23490527-23490549 GGGACTATCCTGGATTATTTGGG + Intergenic
1038169429 8:25115669-25115691 GTGCTCATCCTGAATTATCTGGG + Intergenic
1038748230 8:30272710-30272732 GAGATTATCCTGGATCATCTTGG + Intergenic
1039128998 8:34239735-34239757 GAGATTATTCTGAATTATCTGGG + Intergenic
1039166601 8:34688080-34688102 CAGACTATCCTGGATTATCTGGG - Intergenic
1039589725 8:38736203-38736225 GAGACTATCCTGAATTATCTGGG - Intronic
1041243718 8:55871459-55871481 GTGAGTAACCTGTGTGATCTCGG + Intergenic
1041325112 8:56655049-56655071 GAGATTATCCTGGATTATCTAGG - Intergenic
1042011363 8:64248759-64248781 ATTACTATCCTGAGTGATGTTGG - Intergenic
1043151952 8:76728776-76728798 GTGATTACCCTGAATTATCAAGG + Intronic
1043735306 8:83733703-83733725 GTGACTATGTTTAATGATCTAGG + Intergenic
1043986996 8:86705511-86705533 GAGATTATCCTGGATTATCTGGG + Intronic
1044270958 8:90243087-90243109 GTGACCATCCTGATTTGTCTAGG - Intergenic
1044725878 8:95193771-95193793 GAGAAAATCCTGAATGATCTGGG + Intergenic
1044914943 8:97103123-97103145 TTGATTATCCTGAGTTATCTGGG - Intronic
1045323827 8:101102003-101102025 GGGATTATCCTGGATTATCTGGG - Intergenic
1045349941 8:101329516-101329538 GAGATTATCCTGAATTACCTGGG - Intergenic
1045900753 8:107276727-107276749 GTTACTTTTCTGAATGACCTTGG - Intronic
1046221736 8:111225941-111225963 GTGATTATCCCGAACCATCTAGG + Intergenic
1046230810 8:111354516-111354538 GAGATCATCCTGAATTATCTAGG + Intergenic
1046409858 8:113827575-113827597 GTGAATGTCCTGAAGGAACTGGG + Intergenic
1046692219 8:117298768-117298790 GAGATTATCCTGAATTATCGAGG + Intergenic
1047052561 8:121129146-121129168 GAGACCATCCTGGATCATCTAGG + Intergenic
1047313137 8:123708952-123708974 GTGATTATCCTGGATTACCTGGG - Intronic
1047875165 8:129128429-129128451 GAGATTATCCTGGATTATCTTGG + Intergenic
1048927156 8:139281355-139281377 GAGATTATCCTGGATTATCTGGG + Intergenic
1050593098 9:7180191-7180213 GAGATTATCCTGGATTATCTGGG + Intergenic
1050815883 9:9810825-9810847 GTGACTCTTCTGATGGATCTGGG + Intronic
1051111022 9:13636914-13636936 GAGATTATCATGAATTATCTAGG + Intergenic
1051315974 9:15832498-15832520 GTTACTATACTGAATGCTGTAGG + Intronic
1051506554 9:17833181-17833203 GTGACTATACTGAATACTGTAGG + Intergenic
1052265460 9:26566558-26566580 GTGACTATGGTGAATAGTCTAGG - Intergenic
1052467747 9:28851446-28851468 GATACTATCCTGAATTACCTGGG - Intergenic
1052988585 9:34505416-34505438 GAGATTATCCTGGATTATCTGGG - Intronic
1053446609 9:38158008-38158030 GAGGTTATCCTGAATTATCTAGG - Intergenic
1053696577 9:40644758-40644780 GAGAGTATCCTGAATGATCTGGG + Intergenic
1053942999 9:43274968-43274990 GAGAGTATCCTGAATGATCTGGG + Intergenic
1054307827 9:63443986-63444008 GAGAGTATCCTGAATGATCTGGG + Intergenic
1054406552 9:64767988-64768010 GAGAGTATCCTGAATGATCTGGG + Intergenic
1054440182 9:65253461-65253483 GAGAGTATCCTGAATGATCTGGG + Intergenic
1054490223 9:65768478-65768500 GAGAGTATCCTGAATGATCTGGG - Intergenic
1054823545 9:69548005-69548027 GAGATTATCCTGGATCATCTGGG + Intronic
1055086395 9:72318314-72318336 AAGATTATCCTGGATGATCTGGG + Intergenic
1055557084 9:77485567-77485589 GTGACTTCTCTGATTGATCTGGG - Intronic
1055827917 9:80348992-80349014 GAGATTATCCTGGATTATCTGGG + Intergenic
1056226744 9:84503204-84503226 GAGATTATCCTGGATTATCTAGG + Intergenic
1056284195 9:85071348-85071370 GAGACTAACCTGGATTATCTGGG + Intergenic
1057019667 9:91686793-91686815 GTGACTGTCCTGAATGCTGTAGG + Intronic
1057236325 9:93364861-93364883 CAGACTCTCCTGGATGATCTGGG + Intergenic
1057370227 9:94464874-94464896 GAGATTGTCCTGAATTATCTAGG + Intergenic
1057858790 9:98623771-98623793 GAGACTATCCTGGATTATCCAGG - Intronic
1058090933 9:100804623-100804645 GAGATTATCCTGGATTATCTGGG + Intergenic
1058155984 9:101515361-101515383 GGAATTATCCTGAATTATCTGGG - Intronic
1058949747 9:109892362-109892384 GAGATTATCCTGAATTATTTAGG - Intronic
1059485509 9:114623744-114623766 GAGACTATCCTGAATCATCCGGG - Intronic
1061020008 9:128008260-128008282 GAGATTATCCTGGATCATCTGGG + Intergenic
1061784760 9:133020515-133020537 GTGATTATCCTGAACCATCCAGG + Intergenic
1202779027 9_KI270717v1_random:18418-18440 GAGAGTATCCTGAATGATCTGGG + Intergenic
1203586096 Un_KI270747v1:4827-4849 GAGAGTATCCTGAATGATCTGGG + Intergenic
1185649178 X:1636314-1636336 GTGACTAGCCTGGAAGACCTGGG + Intronic
1185808923 X:3087097-3087119 GTGATTATCCTGGGTTATCTGGG - Intronic
1185990557 X:4890265-4890287 GAGACTATCTTGAATTATCCAGG + Intergenic
1186044403 X:5519453-5519475 AAGACTATCCTGTATTATCTGGG - Intergenic
1186074688 X:5865402-5865424 GTGATTATCCTGGATTATTTGGG + Intronic
1186800658 X:13089286-13089308 TTGAATATCCAGAATGATCTAGG - Intergenic
1188299237 X:28487166-28487188 GAGATTATCCTGGATTATCTAGG - Intergenic
1188400234 X:29735337-29735359 GAGATTATCCTGAATTATCTAGG - Intronic
1188467835 X:30502780-30502802 GAGATTATCCTGGATTATCTGGG + Intergenic
1188644597 X:32550140-32550162 GTGACTATACTGAATAGTGTAGG + Intronic
1189203329 X:39216608-39216630 GAGATTATTCTGAATTATCTGGG + Intergenic
1189389699 X:40565615-40565637 GTGACTGTCCTGAATATTGTAGG + Intergenic
1189536293 X:41938642-41938664 GAGACTATCCTGGATTATCTGGG - Intergenic
1190577225 X:51852278-51852300 GAGATTATCCTGGATTATCTTGG - Intronic
1191890373 X:65933254-65933276 GTGACTGTACTGAATAATGTAGG + Intergenic
1194770652 X:97900841-97900863 GTGACTATACTGAATACTGTAGG + Intergenic
1194811324 X:98390567-98390589 GTGATTATCCTGAACCATCCAGG + Intergenic
1195158523 X:102147540-102147562 TTAATTATCCTGAATTATCTAGG - Intergenic
1196415340 X:115465166-115465188 GTTACTTGCCTGAATGACCTTGG + Intergenic
1196882464 X:120210893-120210915 GTGATTATCCTGAACCATCTAGG - Intergenic
1197339716 X:125251711-125251733 GAGATTATCCTGGATTATCTGGG - Intergenic
1197346530 X:125330230-125330252 GAGATTATCCTGGATAATCTGGG + Intergenic
1198112661 X:133515238-133515260 AAGATTATCCTGTATGATCTGGG - Intergenic
1198495025 X:137183736-137183758 GGGATTATCCTGGATTATCTAGG - Intergenic
1198588790 X:138153026-138153048 GAGATTATCCTGGATTATCTAGG + Intergenic
1199262938 X:145796771-145796793 GAGACTATCCTGGATTTTCTGGG + Intergenic
1199750227 X:150808860-150808882 GTGATTATCCTGAATTATCTGGG + Intronic
1199888549 X:152049567-152049589 GGGATTATCTTGAATTATCTGGG - Intergenic
1199998626 X:153044328-153044350 GAGATTATCCTGGATTATCTTGG + Intergenic
1201194314 Y:11476692-11476714 GAGAGTAACCTGAATTATCTAGG + Intergenic
1201611508 Y:15848303-15848325 AAGATTATCCTGAATTATCTGGG - Intergenic