ID: 1103889269

View in Genome Browser
Species Human (GRCh38)
Location 12:124226499-124226521
Sequence CACAGCAGCCTCGGGAGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103889266_1103889269 -10 Left 1103889266 12:124226486-124226508 CCTGTTTTTCGTGCACAGCAGCC 0: 1
1: 0
2: 0
3: 5
4: 76
Right 1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 156
1103889263_1103889269 15 Left 1103889263 12:124226461-124226483 CCGGCACATCTCAACCTGGACTA 0: 1
1: 0
2: 3
3: 8
4: 134
Right 1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 156
1103889265_1103889269 -9 Left 1103889265 12:124226485-124226507 CCCTGTTTTTCGTGCACAGCAGC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 156
1103889264_1103889269 1 Left 1103889264 12:124226475-124226497 CCTGGACTAGCCCTGTTTTTCGT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG 0: 1
1: 0
2: 0
3: 19
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103889269 Original CRISPR CACAGCAGCCTCGGGAGTTT AGG Intronic
900138935 1:1130990-1131012 CACAGCAGCCTCGGGAGCCGGGG - Intergenic
900333964 1:2151768-2151790 CACTTCAGCCTCTGGAGTGTTGG + Intronic
900482986 1:2908325-2908347 CACAGTATCCCCGGGCGTTTGGG + Intergenic
900966254 1:5960775-5960797 CCCAGCAGCCATGGGAGTGTTGG - Intronic
901530879 1:9851829-9851851 CACAACTGCCTGGGGAGTTAGGG + Intronic
901659061 1:10787427-10787449 CACAGCTCCTTCGGGAATTTCGG - Intronic
902627974 1:17687964-17687986 CACAGCAGCCTGGGGCGCTCAGG + Intronic
904125001 1:28232148-28232170 CACTGCAGCCTCGAGCTTTTGGG + Intronic
904172111 1:28598694-28598716 CACAGCAACCCCGTGAGGTTGGG + Intronic
907051997 1:51335912-51335934 CACAGCATCCCTGAGAGTTTGGG - Intronic
908695523 1:66836540-66836562 CACAGTAACTTGGGGAGTTTTGG - Intronic
908723311 1:67148839-67148861 CACAAGAGCCTCTGAAGTTTAGG - Intronic
912696071 1:111843180-111843202 CAGAACAGTCTCCGGAGTTTGGG + Intronic
916383284 1:164237448-164237470 CACAGTAGCTCCGGGAGGTTGGG + Intergenic
916939063 1:169661453-169661475 CACAGGAGCCCAGGGAGTTGGGG - Intergenic
916940100 1:169668291-169668313 CACAGGAGCCCAGGGAGTTGGGG - Intronic
919428029 1:197458276-197458298 TACAGCAGCCACAGGAGTTTAGG + Intronic
921006062 1:211094663-211094685 CACAGCAGCCTTGGTGGGTTAGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
921800768 1:219399682-219399704 CAGAGCAGCCTCGGGTGCCTGGG - Intergenic
923908204 1:238409447-238409469 CACAGAAGGCTCAGGAGGTTAGG - Intergenic
1063461525 10:6217611-6217633 CTCAGCAGCCTCCTGAGTTTGGG + Intronic
1064697404 10:17982095-17982117 CACAGCAGCCCAGTGAGCTTTGG - Intronic
1067914682 10:50384559-50384581 CACCTCAGCCTCTGGAGTGTTGG + Intronic
1069954382 10:72040854-72040876 CACTGCAGACTCGGGAGGGTGGG - Intergenic
1073747731 10:106488820-106488842 CACAGCAGCTTGGGGAACTTGGG + Intergenic
1074093383 10:110284913-110284935 CACAGCAGCCTGCCGAGTATTGG + Exonic
1075835575 10:125449904-125449926 GAAAGCAGCATGGGGAGTTTTGG - Intergenic
1077139989 11:1020084-1020106 CACAGCCTCCTCGGGAGGTAAGG - Exonic
1079051590 11:17165355-17165377 CACAGTATCCTAGAGAGTTTAGG - Intronic
1083618530 11:64037750-64037772 CACAGCTGCCTTGGGGGTGTGGG - Intronic
1088971229 11:114776165-114776187 CACAGCAGCCTCAGGGATTATGG + Intergenic
1092526939 12:9315168-9315190 CGCAGCAGCTTGGGGAGGTTGGG + Intergenic
1092540335 12:9416612-9416634 CGCAGCAGCTTGGGGAGGTTGGG - Intergenic
1100685019 12:96978388-96978410 CACAGCAGCCTCGACCTTTTGGG + Intergenic
1101950677 12:109172311-109172333 CACAGCAGCTCCGGAAGTTTAGG - Exonic
1103848890 12:123918332-123918354 CAAAGCAGCCCTGGGAGCTTGGG + Intronic
1103889269 12:124226499-124226521 CACAGCAGCCTCGGGAGTTTAGG + Intronic
1104069436 12:125331338-125331360 AACAGCAGCCTTGGGAATCTTGG - Intronic
1105005145 12:132716984-132717006 CATAGCAGCTTGGGGTGTTTAGG + Intronic
1113508520 13:110832863-110832885 CACGGCAGCCCCGGGAGCTGGGG + Intergenic
1115259838 14:31440735-31440757 CACCTCAGCCTCGAAAGTTTTGG - Intronic
1115688685 14:35823545-35823567 CACCTCAGCCTCTGGAGATTGGG + Intergenic
1118244459 14:64095851-64095873 CACAGCAGTATCGGGAGGTGTGG + Intronic
1121100885 14:91249419-91249441 CACTGCAGCCTCGAAAGTCTGGG + Intronic
1122138964 14:99650760-99650782 CACAGCAGCTCCTGGGGTTTGGG - Intronic
1122824700 14:104363988-104364010 CACAGCAGCCCCGGGGCTCTTGG - Intergenic
1125108910 15:36007357-36007379 CACAGTAGCCTCCAAAGTTTGGG - Intergenic
1125727780 15:41876898-41876920 TGCAGCAGCACCGGGAGTTTGGG - Exonic
1128548845 15:68584801-68584823 CCCTGCAGCCTGGGGAGCTTGGG + Intronic
1129179805 15:73866961-73866983 CATACCAGCCTGGTGAGTTTGGG + Intergenic
1130676180 15:85954121-85954143 CAAATCAGCCTAGAGAGTTTAGG - Intergenic
1134290829 16:12901972-12901994 GGCAGCAGCCTCGGCAGCTTCGG + Exonic
1135277707 16:21127737-21127759 CTCTGCAGCCTCAGGAATTTTGG - Exonic
1135421260 16:22307120-22307142 CACAGCGGCCTTGGGAGGTGAGG + Intronic
1136232930 16:28898082-28898104 CACAGCAGCCCGGGAAGATTTGG - Exonic
1138704383 16:58899236-58899258 CACTGCAGCCTCGGGCTTCTGGG - Intergenic
1141712982 16:85710684-85710706 CCCAGGAGCCTAGGGAGTCTGGG - Intronic
1141807903 16:86354125-86354147 CACAGCAGCCTGGTGTGGTTTGG + Intergenic
1142636497 17:1260715-1260737 CAGAGCTGCCTGGGGAGGTTCGG - Intergenic
1143505669 17:7363624-7363646 CACAGCAGCCTCCCTTGTTTGGG - Intergenic
1143545062 17:7590782-7590804 CACAGCAGCCTCTGGAGCCCGGG - Intronic
1145259358 17:21345477-21345499 CACAGCAGCCCCGGGGGCATGGG + Intergenic
1145317260 17:21742472-21742494 CACAGCAGCCCCGGGGGCGTGGG - Intergenic
1147119009 17:38324441-38324463 CACTGCAGTCTTGGGACTTTGGG - Intergenic
1148451433 17:47780783-47780805 CACTCCAGCCTCAGGAGTCTGGG - Intergenic
1149439389 17:56662282-56662304 ACCAGCAGCCTGGGGTGTTTGGG + Intergenic
1151238953 17:72743115-72743137 CACAGCAGCTTTGGGAGATTGGG + Intronic
1151391661 17:73791326-73791348 CAGAGCAGCCTCTGCAGTTTTGG + Intergenic
1152594947 17:81233458-81233480 CACAGCACCCTCCAGGGTTTCGG - Exonic
1156587242 18:38444858-38444880 CAAAGGAGTCTCGGGAGTCTGGG + Intergenic
1159519126 18:69495826-69495848 CACAGCCCCCTCTGGACTTTGGG - Intronic
1160192085 18:76722801-76722823 CACACCATGCTCTGGAGTTTAGG - Intergenic
1160712434 19:558762-558784 CAGAGCAGGCTCGGGGGTTTTGG + Intergenic
1161132527 19:2599528-2599550 CACAGGAGCTGGGGGAGTTTGGG + Intronic
1163688120 19:18723851-18723873 CACAGCAGCCTCGTCAGTGTGGG + Intronic
1164445722 19:28316132-28316154 CACAGCAGCCACGGGGGACTAGG - Intergenic
1166848661 19:45746558-45746580 CACAGCGGGCTCAGTAGTTTGGG + Intronic
1167233994 19:48302892-48302914 GATGGCAGCCTCGGGAGTTGGGG + Intronic
927560465 2:24068760-24068782 CAGAACAGCCTCGTGAGTTGTGG + Intronic
927989163 2:27435252-27435274 CAGGGGAGCCTCGGGAATTTGGG + Intronic
932228600 2:70063447-70063469 CTCAGCAGCCTTAGGAGTTCAGG - Intergenic
938986206 2:136579003-136579025 CACATCTGTCTTGGGAGTTTGGG + Intergenic
947702799 2:232249245-232249267 CACAGCAGCCTGGGAAGCATGGG - Exonic
948747641 2:240107865-240107887 CCCATCAGCCTGGGGAGTGTAGG + Intergenic
1173157496 20:40626869-40626891 CACAGAGCCCTCGGGAGTTTTGG + Intergenic
1173875796 20:46370634-46370656 TACAGCAGCCCTTGGAGTTTGGG - Intronic
1173948651 20:46972620-46972642 CACAGCAGCCCCAGGAGGTGGGG + Intronic
1176891254 21:14322048-14322070 CATGGTAGCCTCTGGAGTTTTGG - Intergenic
1178574381 21:33771933-33771955 CACAGAAGCTTAGGGAGTTCTGG + Intronic
1179177752 21:39021369-39021391 CACAGCAATCTGGGGAATTTGGG + Intergenic
1181028890 22:20140646-20140668 CACAGCAGCCTCGGGTGAAAGGG - Exonic
1182108266 22:27704589-27704611 CACAGCAGCCTCCTGAGCTGGGG + Intergenic
1184138039 22:42561001-42561023 CACAGCAGCCCCTGGAGTTGTGG - Intronic
1184413673 22:44339952-44339974 CACAGCAGCCTCTGGAGTCCAGG - Intergenic
1184518682 22:44979339-44979361 CACGACAGCCTCTGGAGTGTTGG - Intronic
950726715 3:14921667-14921689 CACAGCAGCCCTGGGAGTTAGGG + Intronic
952357847 3:32601209-32601231 GACAGCAGCTTTGGGAATTTGGG - Intergenic
954697991 3:52437569-52437591 CACAGCAGCCTGGGGAGACTTGG + Exonic
955326356 3:58011569-58011591 CACAACAGCCTCAAGAGCTTAGG - Intronic
956873871 3:73443223-73443245 CACAGCAGCTTCAGGAGGGTAGG - Intronic
961502821 3:127349976-127349998 CGCAGCAGCCTCGGGGGATGCGG - Intergenic
964821394 3:160774204-160774226 CACAGCAGCTTCAGGAGTGGCGG - Intronic
966912190 3:184565870-184565892 CACGGCAGCTTCGGCAGCTTCGG - Intronic
967161889 3:186746372-186746394 CAGAGGAGCCTTGGGAGTCTGGG - Intergenic
967235845 3:187382977-187382999 CAGAGAAGCCTCTGGAGGTTCGG + Intergenic
968673861 4:1866516-1866538 CACAGCAGCACCTGGAGTTGGGG + Intergenic
969080102 4:4611421-4611443 CACAGCAGCCACTGGAACTTGGG + Intergenic
969526578 4:7706895-7706917 CACAGCAGCCAGGGGAGCTCAGG - Intronic
969583878 4:8080957-8080979 CACAGCAGTCTCTGGAGCATAGG + Intronic
971485271 4:27153612-27153634 CCCAGCAGACTGGGAAGTTTGGG - Intergenic
973048611 4:45567334-45567356 CACAGGAGCCCAGGGAGTTTGGG - Intergenic
973995420 4:56453709-56453731 CACACCAGACTGGGGAGTTCAGG + Exonic
974683549 4:65195250-65195272 CTCAGCACCCTCAGGACTTTGGG - Intergenic
974961358 4:68705267-68705289 CACAGCAGCCTCCACAGTGTGGG + Intergenic
981099151 4:140811603-140811625 CTCAGCAGCTTCGGGAGCCTTGG - Intergenic
982671466 4:158324975-158324997 CACAGCAGCCTCGATATTTTGGG + Intronic
983192365 4:164768158-164768180 CACTGCAGCCTCGGCCTTTTGGG - Intergenic
984796569 4:183665716-183665738 CACAGCAGCCACTTGAGTCTGGG - Intronic
984839107 4:184051628-184051650 CACAGTAGTCTCGGAGGTTTAGG + Intergenic
985663931 5:1172102-1172124 CCCAGCAGCCTGGGGAGATCAGG + Intergenic
987049455 5:14137048-14137070 CACTGTAGCTTGGGGAGTTTGGG - Intergenic
990950114 5:61290175-61290197 CACATCAGCCACGAGAGTCTGGG + Intergenic
992623003 5:78611640-78611662 GACACCAGCCTAGGGAGTCTGGG + Intronic
992677065 5:79115861-79115883 CACAGCAGCTTCAGGAGTCCAGG - Exonic
995021398 5:107371109-107371131 CAGAGCATCCTGGAGAGTTTTGG + Intergenic
998093601 5:139384599-139384621 CACAGCACCCTGGGGAGTTCTGG - Intergenic
999739866 5:154541996-154542018 CACAACAGCCCTGGGAGGTTGGG + Intergenic
1000671193 5:164065228-164065250 CACAGAAGCCTTTGGAGTATTGG - Intergenic
1001601669 5:172932923-172932945 CTCAGTAGCCTCATGAGTTTGGG - Intronic
1001629265 5:173162714-173162736 CACAGCAGCCTCGCATGTCTAGG + Intronic
1002168415 5:177362085-177362107 CACAGCAGCCTCAGGAAATTGGG + Intronic
1003670354 6:8151655-8151677 CACTGCAGCCTCCGCATTTTGGG + Intergenic
1005796137 6:29364060-29364082 CTCATCAGCCTAAGGAGTTTTGG - Intronic
1006787951 6:36680379-36680401 CCCAACAGCGGCGGGAGTTTCGG + Intronic
1011896653 6:92236012-92236034 CAAAACACCCTGGGGAGTTTTGG - Intergenic
1013012669 6:106134386-106134408 CACAGCAGCCATGGAAGTGTTGG + Intergenic
1014739039 6:125126140-125126162 CACAGGAGCCCATGGAGTTTTGG - Intronic
1016223101 6:141699948-141699970 CACATCAGCCTCCAGAGTTGCGG + Intergenic
1018159421 6:161024040-161024062 CACTGCAGCCTCGAAATTTTGGG + Intronic
1023307346 7:38844830-38844852 CACAGCAGCCTAGGGTTTTAGGG - Intronic
1023764664 7:43499196-43499218 CACTGGAGCCTTGGGAGGTTGGG + Intronic
1024397064 7:48881909-48881931 CACAGCAGTGTTGGGAGTTGGGG - Intergenic
1029919370 7:104246294-104246316 CATATCAGCTTAGGGAGTTTTGG + Intergenic
1030497963 7:110323523-110323545 CACATCAGCCTCCTGAGTATGGG + Intergenic
1033772601 7:144569075-144569097 CACAACAGCCTTGAGATTTTCGG - Intronic
1034349140 7:150405229-150405251 CACAGCAGCCCCGTGAGGCTGGG - Intronic
1035663173 8:1362418-1362440 CACAGCGCCCTCGGGAGGCTCGG + Intergenic
1037347796 8:17918261-17918283 CCAAGCATCCTCGGGAGTTTGGG - Intergenic
1038099062 8:24351468-24351490 CAAAGTAGCCTCGGCATTTTAGG - Intronic
1038432632 8:27512281-27512303 AACAGCAGGCTAGGGAGCTTGGG + Intronic
1039050305 8:33486474-33486496 CACTGCAGCCTCGGACTTTTCGG - Intronic
1041448162 8:57976208-57976230 CATTGCAGCCTGGGCAGTTTGGG + Intergenic
1041500394 8:58533469-58533491 CACAGCTGACTGAGGAGTTTTGG - Intergenic
1042027119 8:64435795-64435817 CACAGCAGCCTCAGAAGAGTTGG + Intergenic
1042825019 8:72971453-72971475 CACTGCAGCCTCGGTCTTTTGGG - Intergenic
1047013235 8:120695130-120695152 CACTGCTGCCTCAGGAGATTGGG + Intronic
1049369874 8:142259200-142259222 GACAGCAGTCACGGGAGTTGGGG - Intronic
1049731243 8:144179660-144179682 CCCAGCAGCCTTGAGAGTATAGG + Intronic
1051299822 9:15636663-15636685 CACTTGAGCCTGGGGAGTTTGGG + Intronic
1051842615 9:21415273-21415295 CACAGTAGCCTGCAGAGTTTTGG + Intronic
1052534091 9:29726195-29726217 CACAGCAGCCTCAGGGGAATGGG + Intergenic
1054313552 9:63556333-63556355 CACAGCAGCCCCTGGGGTTAGGG + Intergenic
1055444845 9:76372269-76372291 CACAGCAACCTTGGGAGGTCAGG - Intergenic
1058273309 9:103004443-103004465 CATAGCTCCCTCGGGATTTTAGG - Intronic
1060493276 9:124100359-124100381 CCCAGCAGCCTGGGGAGTGGTGG - Intergenic
1060777853 9:126389733-126389755 GACAGCAACCTGGGGAGTTGGGG - Intronic
1062431073 9:136527116-136527138 CACAGCAGCAGCGGGAGACTGGG - Intronic
1062448669 9:136606469-136606491 CCCAGCAGCCTCATGAGTTTGGG - Intergenic
1190194709 X:48307114-48307136 CACCACAGCCTCGGGACTTCAGG + Intergenic
1190283765 X:48948646-48948668 ATCAGCAGCCTGAGGAGTTTGGG + Intronic
1190320172 X:49175444-49175466 CACTGCAGCCTCAAAAGTTTTGG - Intronic
1190833023 X:54076077-54076099 CACTGCAGCCTGGGCACTTTGGG + Intronic
1197204290 X:123776586-123776608 CACTGCAGCCTCGGCCTTTTGGG - Intergenic
1198657485 X:138930841-138930863 CATAGCAGCCAAGGGAGGTTTGG - Intronic
1199816003 X:151397340-151397362 CACTGCAGCCTCCTGAGTTCAGG + Exonic