ID: 1103895338

View in Genome Browser
Species Human (GRCh38)
Location 12:124269435-124269457
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 245}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103895338_1103895343 -8 Left 1103895338 12:124269435-124269457 CCACCAGGAACACAGCCCCGCGG 0: 1
1: 0
2: 3
3: 21
4: 245
Right 1103895343 12:124269450-124269472 CCCCGCGGCGCCTGGATTTTAGG 0: 1
1: 0
2: 0
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103895338 Original CRISPR CCGCGGGGCTGTGTTCCTGG TGG (reversed) Intronic