ID: 1103896725

View in Genome Browser
Species Human (GRCh38)
Location 12:124278086-124278108
Sequence CAGAGCACGGAGCTGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 606
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 561}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103896717_1103896725 10 Left 1103896717 12:124278053-124278075 CCTCCAGCTAGGACTGCTGAGCA 0: 1
1: 0
2: 1
3: 15
4: 173
Right 1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 561
1103896714_1103896725 15 Left 1103896714 12:124278048-124278070 CCCACCCTCCAGCTAGGACTGCT 0: 1
1: 0
2: 0
3: 19
4: 173
Right 1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 561
1103896719_1103896725 7 Left 1103896719 12:124278056-124278078 CCAGCTAGGACTGCTGAGCAGGG 0: 1
1: 0
2: 3
3: 13
4: 157
Right 1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 561
1103896716_1103896725 11 Left 1103896716 12:124278052-124278074 CCCTCCAGCTAGGACTGCTGAGC 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 561
1103896715_1103896725 14 Left 1103896715 12:124278049-124278071 CCACCCTCCAGCTAGGACTGCTG 0: 1
1: 0
2: 1
3: 23
4: 254
Right 1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 561
1103896713_1103896725 18 Left 1103896713 12:124278045-124278067 CCTCCCACCCTCCAGCTAGGACT 0: 1
1: 0
2: 2
3: 36
4: 327
Right 1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG 0: 1
1: 0
2: 3
3: 41
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103896725 Original CRISPR CAGAGCACGGAGCTGGAGGG AGG Intronic
900204117 1:1424423-1424445 ATGAACACGGAGCTGGAGGCTGG + Intergenic
900458595 1:2789537-2789559 CAGAGCGCAGGGCCGGAGGGAGG - Exonic
900996917 1:6127840-6127862 CGGAGCACGTGGTTGGAGGGCGG + Intronic
901426168 1:9183253-9183275 CTGAGCGCGGAGCTACAGGGGGG + Intergenic
901700676 1:11043524-11043546 CGGAGCACAGGGCTGGAAGGAGG + Exonic
901781638 1:11598313-11598335 CAGAGCAGGGATCTGAAGGCAGG - Intergenic
902107258 1:14048056-14048078 CAGATCACACAGCTGGAGAGTGG - Intergenic
903618826 1:24682961-24682983 CAGAGCCCAGAGCTTGAGGTTGG + Intergenic
903669836 1:25028833-25028855 CAGAGGACGGAGGTGGGGTGCGG - Intergenic
903703948 1:25271421-25271443 CAGGGCCAGGAGCTGCAGGGAGG - Intronic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
904420311 1:30386810-30386832 CAGAGTACGGGAGTGGAGGGTGG + Intergenic
904452966 1:30628227-30628249 CAGTGCACGGGGCTGGGGTGTGG + Intergenic
904479764 1:30786563-30786585 CTGAGCAAGGAGGTGGAGGGAGG + Intergenic
904603901 1:31688752-31688774 CAGGGCAGGGATCAGGAGGGAGG - Intronic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
905213210 1:36388679-36388701 CAGAGCACTGAGCTAGATGCTGG + Intergenic
905242541 1:36590125-36590147 CCTAACCCGGAGCTGGAGGGAGG + Intergenic
905403139 1:37717283-37717305 CAAGGCACGGAGCTGGCTGGAGG + Exonic
905630191 1:39514304-39514326 TGGAGCAGGGAGCTGGAGTGGGG + Intronic
905667569 1:39771886-39771908 TGGAGCAGGGAGCTGGAGTGGGG - Intronic
905734471 1:40316207-40316229 CAGAGAAAGGAGGTGTAGGGAGG + Intronic
905761074 1:40558854-40558876 CAGGGCACGGGACTGGCGGGCGG - Intergenic
905803691 1:40861577-40861599 CAGCTCACGGAGCCGGCGGGCGG + Exonic
906259669 1:44377539-44377561 CAGAGTACGGAGAGAGAGGGAGG + Intergenic
906725638 1:48042149-48042171 AAGATCACGGAGCTGGTGAGTGG - Intergenic
906836243 1:49086016-49086038 GAGACCACGGGGCTGGAGGCTGG - Intronic
907046254 1:51302088-51302110 CAGTGGAGGGAGGTGGAGGGAGG - Intronic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
907762820 1:57378121-57378143 CAGAGCTCAGAGCAGGATGGAGG + Intronic
908930409 1:69311515-69311537 CGGAGCACAGAGCTGGACAGAGG - Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912694535 1:111831306-111831328 CAGAGGAGGGATCTGGTGGGAGG + Intronic
912733985 1:112133842-112133864 AAGAGGAGGGAGCTGGAGTGAGG - Intergenic
914419032 1:147511162-147511184 GAGAGCACAGAGCTGCAGAGTGG + Intergenic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
918079165 1:181192389-181192411 CAGAGAAAAGAGCTGCAGGGAGG + Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919728120 1:200896854-200896876 CAGAGCGCGGGGCCGCAGGGTGG - Intronic
919943029 1:202301423-202301445 CAGTTCAGGGAGGTGGAGGGAGG - Intronic
920030029 1:203031535-203031557 CAGAGTACAGAACTGCAGGGAGG - Intronic
920121274 1:203660491-203660513 AAGAGAACGGAGGTGGGGGGTGG + Intronic
920244339 1:204576516-204576538 CAGAGCCGGGAGCAGGAGGATGG + Intergenic
920263169 1:204703449-204703471 GTGTGCAGGGAGCTGGAGGGCGG - Intergenic
921985142 1:221304672-221304694 TAGAGCACTGAGCTGGAAGGAGG - Intergenic
922599764 1:226840999-226841021 CTGAGCAGGGAGCTCAAGGGAGG + Intergenic
923678795 1:236102590-236102612 GAGAACACTGAGCTGGGGGGTGG - Intergenic
924517507 1:244779094-244779116 CACAGCAGGAAGATGGAGGGTGG + Intergenic
924815713 1:247440268-247440290 CAGAGAACGGGGGTGGAAGGTGG - Intronic
924919913 1:248618081-248618103 CAGAACACTGAGCTGGTGAGTGG + Intergenic
1063017803 10:2095881-2095903 CAGGGCACAGGGCTTGAGGGTGG - Intergenic
1063959718 10:11297295-11297317 CAGAGCCGGGAGCTGCAGAGTGG + Intronic
1065883632 10:30058904-30058926 CAGAGACCGGAGCGGGAGCGGGG + Intronic
1066008096 10:31166461-31166483 CATTGCAGGGAGCTGGAGTGCGG - Intergenic
1067088274 10:43254100-43254122 CAGAGCACAGCCCTGGTGGGAGG - Intronic
1067574567 10:47401175-47401197 CAGAGTAAGGAGCTTGAAGGGGG - Intergenic
1069510368 10:69037658-69037680 CAGAGCCCGGAGATGCAGGCAGG + Intergenic
1069829038 10:71271535-71271557 CAGAGGAAGGGTCTGGAGGGAGG + Intronic
1069898323 10:71692635-71692657 CTGAGCAGGGAGCTGGGGGTGGG - Intronic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1069909555 10:71751129-71751151 CTGAGCCCAGAGCAGGAGGGAGG + Exonic
1070286491 10:75087475-75087497 CTGAGGAGGGAGCGGGAGGGTGG + Intergenic
1070392792 10:75985716-75985738 CAGAACTCAGAGATGGAGGGAGG + Intronic
1070665771 10:78342384-78342406 CAGAGCATAGAGCTGGCTGGTGG + Intergenic
1070851255 10:79563066-79563088 CAGAGGACTGAGCTGGAAAGAGG - Intergenic
1070968887 10:80547554-80547576 CAGTGCTGGGAGCGGGAGGGAGG + Intronic
1071149773 10:82620399-82620421 CAGAGAGGGGAGCTGGAGAGGGG + Intronic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1072317812 10:94220896-94220918 CGGAGCCCGGCGCTGGAGGTAGG - Intronic
1073330279 10:102665927-102665949 CAGGGCACTGAGCTGGGAGGGGG + Intergenic
1073478121 10:103767618-103767640 CACAGCACGGTTCTGGAAGGTGG - Intronic
1073639971 10:105241666-105241688 CAGAGAGGGGAGCTGGAGAGGGG + Intronic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1074813931 10:117130900-117130922 AAGAGCAGGAAGCTGGAAGGAGG + Intronic
1075155285 10:119971190-119971212 CAGAGTGTGGGGCTGGAGGGAGG - Intergenic
1075574099 10:123565980-123566002 CACAGGACAGTGCTGGAGGGTGG - Intergenic
1075840647 10:125499525-125499547 CAGAGCACAGAGCTGCAGGCAGG + Intergenic
1075918593 10:126190867-126190889 TAGAGCACGCAGCAGGTGGGAGG + Intronic
1076024501 10:127100665-127100687 CTGCGCAGGGAGCTGGAAGGAGG + Intronic
1076413161 10:130265879-130265901 CAGAGGAGGGAGGTGGAGGGAGG + Intergenic
1076491143 10:130862355-130862377 CAGCGCCCAGGGCTGGAGGGAGG - Intergenic
1076817288 10:132921217-132921239 CTGGGCACTGAGCTGGAGGGAGG + Intronic
1076828549 10:132982864-132982886 CGGCGCTGGGAGCTGGAGGGTGG - Intergenic
1076828561 10:132982902-132982924 CGGCGCTGGGAGCTGGAGGGTGG - Intergenic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077554084 11:3217720-3217742 CAGAAAATGGAGCTGGAGAGAGG - Intergenic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078446630 11:11409599-11409621 GAGAGCATGGAGCTGGGGTGGGG - Intronic
1078740885 11:14065198-14065220 CAGAGCAAGGTCCTTGAGGGCGG - Intronic
1079413535 11:20211942-20211964 AAGAGCCCAGAGCTAGAGGGCGG - Intergenic
1081850608 11:46272755-46272777 AAGAGCGAGGAGATGGAGGGTGG + Intergenic
1081914432 11:46721644-46721666 CAGAACACAGTGCAGGAGGGAGG - Intronic
1083728933 11:64642877-64642899 CGGAGCTCGGAGCCGGAGGGGGG - Intronic
1084093241 11:66893175-66893197 CATAGCACAGAGCTGGAGTCAGG - Intronic
1084169586 11:67394278-67394300 CAGGGCAGGAGGCTGGAGGGAGG + Intronic
1084751220 11:71205432-71205454 CACAGGCAGGAGCTGGAGGGTGG - Intronic
1084974205 11:72787708-72787730 CTGAGCACAGAGCTGAAGGGAGG - Intronic
1085261090 11:75205131-75205153 CAGAGCACTGAGCTGGACCCTGG + Exonic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1088167494 11:106956300-106956322 AAGGGCACAGAACTGGAGGGAGG - Intronic
1088972586 11:114786935-114786957 CAGACCAGGGACCTGGAGGAGGG - Intergenic
1088976708 11:114822407-114822429 CAGAGCCTGGAGCTGGATTGAGG + Intergenic
1089025793 11:115268568-115268590 CAGAGCACTGAGCTGGGGTAGGG - Intronic
1089399634 11:118156963-118156985 CAGTGCTCTGAGCTGGAGGAAGG - Intergenic
1089565542 11:119369299-119369321 ATGAGCACAGAGCTGGCGGGGGG - Intronic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1089615015 11:119690393-119690415 CAGACCTCCGAGCTGGGGGGTGG + Intronic
1089843148 11:121436288-121436310 CAGATCACTGAGCTGGGGTGTGG - Intergenic
1090238548 11:125166144-125166166 CAGAGCAGAGGGCTGGAGGTCGG + Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090407825 11:126487957-126487979 CAGAAGGCGGAGGTGGAGGGAGG + Intronic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1091791734 12:3275830-3275852 CAGTGCAAGGAGCTGCAGGGGGG - Intronic
1092106360 12:5924435-5924457 CAGAGCTGGGTCCTGGAGGGTGG + Intronic
1092168278 12:6356516-6356538 GTGAGCACGGAGCTGAGGGGAGG + Intronic
1092233836 12:6793209-6793231 CAGAACAGGGAGCTGGAGGCAGG + Intronic
1092526245 12:9311951-9311973 CAGACCAGCCAGCTGGAGGGAGG + Intergenic
1092541031 12:9419839-9419861 CAGACCAGCCAGCTGGAGGGAGG - Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093773027 12:23039274-23039296 CAGAGGAGGGACCTGGTGGGAGG - Intergenic
1094106486 12:26817215-26817237 CAAAGCACAGAGCTAGAGGAAGG + Intronic
1094487010 12:30933478-30933500 GAGAGGAAGGAGCTGGAAGGGGG - Intronic
1094512014 12:31102647-31102669 CAGACCAGCCAGCTGGAGGGAGG + Intronic
1095698230 12:45164745-45164767 CAGAGCACCCAGTGGGAGGGGGG - Intergenic
1096499289 12:52055415-52055437 GATTGCACAGAGCTGGAGGGAGG + Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096748634 12:53744841-53744863 CAGAGAAGGGAGCTGGACTGAGG - Intergenic
1096805912 12:54141032-54141054 CAGAGGCCAGAGCAGGAGGGAGG + Intergenic
1096912490 12:54998255-54998277 TAGAGGATGGAGCTGGGGGGAGG - Intergenic
1097007778 12:55931521-55931543 TAGAGCCCGGGGCGGGAGGGAGG + Intronic
1097679362 12:62634146-62634168 CAGGTCACGGAGGAGGAGGGAGG - Intergenic
1098157006 12:67609505-67609527 CAGGCCATGGAGCTGGAGGTAGG - Intergenic
1099408041 12:82286615-82286637 CAAAGGACGGACCTGGTGGGAGG - Intronic
1100315585 12:93441819-93441841 CAGAGCGAAGAGCTGGAGGCCGG + Intronic
1100974577 12:100109050-100109072 CAGGGGAAGGAGCTGGTGGGAGG + Intronic
1101495699 12:105252141-105252163 CATTGCCAGGAGCTGGAGGGAGG + Intronic
1101973585 12:109335299-109335321 CAGAGCAGGGAGCAGGTGTGGGG + Intergenic
1102422532 12:112815195-112815217 CAGGGCACAGAGCAGGATGGAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103237440 12:119385193-119385215 CAGAGCAGGGAGGAGAAGGGTGG - Intronic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1103938357 12:124488612-124488634 GAGAAGACGGGGCTGGAGGGAGG + Intronic
1104135595 12:125934918-125934940 CAGAGGAGGGACCTGGTGGGAGG + Intergenic
1104495470 12:129232952-129232974 CAGAGGAGGGACCTGGTGGGAGG - Intronic
1104803474 12:131570284-131570306 CTGAGCTCGGAGCTGGTGGAGGG + Intergenic
1104862678 12:131932365-131932387 CAGAACACTGAGCTGGAAAGTGG - Intronic
1105258087 13:18758170-18758192 CAGAGCACAAAACTGGAGGCTGG - Intergenic
1105260744 13:18777476-18777498 CAGAGCACAGAACTGGAGGCTGG - Intergenic
1106672628 13:31922897-31922919 CACAGCACAGAGCAGCAGGGAGG - Intergenic
1107037050 13:35912595-35912617 CAGAGAGGGGAGCTGGAGAGGGG - Intronic
1107142272 13:37013798-37013820 AAGAGCACAGAGCTGAAAGGAGG + Intronic
1109845849 13:67989848-67989870 CATAGCAGGGAGCCAGAGGGAGG + Intergenic
1111104542 13:83628735-83628757 CAGAGGAAGGACCTGGTGGGAGG + Intergenic
1111200464 13:84928614-84928636 AAGAGCACGGAACTGGATGGAGG + Intergenic
1111726253 13:92013283-92013305 CAGAGAGGGGAGCTGGAGAGGGG + Intronic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1113317586 13:109199252-109199274 CAGGGCACAGAGATGGAGCGAGG - Intronic
1113743370 13:112725929-112725951 CAGAGCAAGGTGCTGGGGAGGGG + Intronic
1113812044 13:113148921-113148943 CGGAACACGGAGCAGGAGGAGGG + Exonic
1114238877 14:20847635-20847657 CAGATCACGGAGCTGGGGCCAGG - Intergenic
1114617494 14:24076066-24076088 CAGAGCTGGGATCTGTAGGGAGG - Intronic
1115410895 14:33073429-33073451 CAGGGCAAGGAGATAGAGGGTGG + Intronic
1116866026 14:50032341-50032363 GAGAGCAGGGATCTTGAGGGAGG + Intergenic
1117928572 14:60812811-60812833 CAGAGAGGGGAGCTGGAGAGGGG - Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118708964 14:68504153-68504175 CAGAGTACAGAGCTGGATCGGGG + Intronic
1119030470 14:71188338-71188360 CAGTGAAGGGAGCTGGGGGGTGG + Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1120192236 14:81450014-81450036 GAGACCACGGTTCTGGAGGGAGG + Intergenic
1120951397 14:90045235-90045257 CAGAGCTCAGAGCTGGAGTCAGG + Intergenic
1121303461 14:92890124-92890146 CAGTTCACTGAGATGGAGGGAGG - Intergenic
1121558658 14:94857883-94857905 CAGAGCACGTAGCTAGCAGGAGG + Intergenic
1121965874 14:98305199-98305221 CATAGGAGGGAGCTGGTGGGAGG + Intergenic
1122272912 14:100576347-100576369 CAGTGCATGGAGGAGGAGGGAGG - Intronic
1122276305 14:100592496-100592518 CAGAGCGTGGAGCCGGAGGCTGG + Intergenic
1122359642 14:101151704-101151726 CAAGGCAGGGAGGTGGAGGGAGG - Intergenic
1122951457 14:105047388-105047410 CAGGGCATGGTGCTGGAGGCAGG + Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123875644 15:24621524-24621546 CAGAGAACAAAGCTGGAGGCTGG - Intergenic
1123898045 15:24848199-24848221 CACAGGACGGAGCTGGGGGGCGG + Intronic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1125066238 15:35488603-35488625 CAGAGGAGGGACCTGGTGGGAGG - Intronic
1125323293 15:38511269-38511291 TAGAGCAAGGAGCTGGAGCGAGG + Intronic
1125380551 15:39082164-39082186 AAGACCAGGGAGGTGGAGGGTGG - Intergenic
1125405920 15:39352625-39352647 GAAAGCACAGAGCTGGAGGATGG + Intergenic
1125832643 15:42727752-42727774 CACAGCACTGATCAGGAGGGAGG - Exonic
1125931731 15:43604934-43604956 CTGAGCTGGGAGCAGGAGGGAGG - Intronic
1126088353 15:45029792-45029814 CAGAGAAGGGAACTGGAGAGGGG + Intronic
1127358769 15:58226703-58226725 CAGAGGACGTAGTTAGAGGGTGG + Intronic
1128562786 15:68679491-68679513 CAGAGCACAGAGGCAGAGGGAGG + Intronic
1129165267 15:73773703-73773725 CAGAGCAAGGCTCTGCAGGGAGG - Intergenic
1129196959 15:73973984-73974006 GAGCCCACGGAGCTGGGGGGAGG - Intergenic
1129205924 15:74036942-74036964 GAGTGCGCGGGGCTGGAGGGAGG - Intronic
1129354549 15:74981032-74981054 CAGTGCAAGGGACTGGAGGGAGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129464440 15:75716033-75716055 CAGAGCACAGGGTGGGAGGGAGG + Intergenic
1129514905 15:76151456-76151478 CAGAACAGGGCCCTGGAGGGTGG - Intronic
1129720806 15:77876979-77877001 CAGAGCACAGGGTGGGAGGGAGG - Intergenic
1130068405 15:80626253-80626275 CAGAGAAAGGAGGTGGAAGGAGG - Intergenic
1131137934 15:89952762-89952784 CAGAGCAGGGAGCTCGTGGAGGG + Intergenic
1132195686 15:99913149-99913171 CAGAGCACTGAGGTGCAGGCTGG + Intergenic
1132310462 15:100853915-100853937 CATAGCAGGGAGCTGGGGGCAGG - Intergenic
1132372104 15:101306398-101306420 CAGAGCATGGAGCTTGTGGAGGG - Intronic
1132748516 16:1446845-1446867 CTGAGCACGGGGCTGGGGAGGGG + Intronic
1132850430 16:2022622-2022644 CCCAGCACAGAGCCGGAGGGAGG - Intergenic
1132990119 16:2787985-2788007 CAGACCCCGGATCTGGAAGGGGG - Intergenic
1133026103 16:2989589-2989611 CAGGGCACGGGGCAGGGGGGAGG + Intergenic
1133570330 16:7034224-7034246 GAGAGCACTGAGATGGAGAGAGG - Intronic
1133771436 16:8869007-8869029 GAGAGCGCGGAGCTGGGGAGGGG + Intronic
1133781132 16:8940369-8940391 CTGAGCACTGTGCTGGAGGCTGG - Intronic
1134692198 16:16198171-16198193 CAGAGCCAGGACCTGGCGGGTGG + Exonic
1134756667 16:16673316-16673338 CACATCAAGGAGCTGGAGTGAGG - Intergenic
1134989401 16:18685847-18685869 CACATCAAGGAGCTGGAGTGAGG + Intergenic
1135113819 16:19709788-19709810 CAGAACAGTGAGCTGGAGAGGGG - Intronic
1135281729 16:21158749-21158771 GAGAGCTCGGAGCTTGGGGGTGG + Intronic
1135542716 16:23344695-23344717 CAGAGAATGGAGTTGGAGGTGGG + Intronic
1135926818 16:26702073-26702095 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135990214 16:27214175-27214197 CAGATCAGGCAGCTGGAGCGTGG + Intronic
1136707403 16:32201500-32201522 CAGAGCCTGGAGCTTGTGGGAGG + Intergenic
1136760509 16:32727917-32727939 CAGAGCCTGGAGCTTGTGGGAGG - Intergenic
1136807594 16:33142469-33142491 CAGAGCCTGGAGCTTGTGGGAGG + Intergenic
1138804591 16:60079037-60079059 CGGAGCAAAGAGCGGGAGGGCGG - Intergenic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139560047 16:67736116-67736138 CTGAGCACGGAGGTGAAGGGTGG - Intronic
1139739775 16:69025315-69025337 CAGAGAAGGGAGCTGGAGAGAGG + Intronic
1142159294 16:88548328-88548350 CAGACCACAGGGCTGGTGGGTGG - Intergenic
1142189278 16:88710247-88710269 CAGACCATGGAGCTGGACGAAGG - Exonic
1203062662 16_KI270728v1_random:988232-988254 CAGAGCCTGGAGCTTGTGGGAGG - Intergenic
1142644027 17:1300663-1300685 CAGAGCACAGAGCAGGAGAAGGG + Exonic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143483326 17:7239205-7239227 CAGAGCGCTGAGCCGGCGGGGGG - Intronic
1143681292 17:8477777-8477799 GAGGGCAGGGAGCGGGAGGGAGG + Intronic
1144595668 17:16568609-16568631 CAGGGCTCGGAGCTGGAGCCTGG - Intronic
1145067749 17:19773640-19773662 CAGAGAGGCGAGCTGGAGGGAGG + Intronic
1145974703 17:28977409-28977431 CATGGCACCGAGGTGGAGGGTGG + Intronic
1147214949 17:38893622-38893644 CAGACCACACAGCTGGTGGGCGG - Intronic
1147538839 17:41339724-41339746 AAGAGCACCCAGCTGCAGGGTGG + Intergenic
1147760688 17:42795769-42795791 CAGAGGACAGTGCTGGAGGCGGG + Exonic
1148074385 17:44927142-44927164 CCGAGCTGGGGGCTGGAGGGAGG - Intronic
1148104473 17:45112126-45112148 CAGGTTCCGGAGCTGGAGGGAGG + Exonic
1149923222 17:60678046-60678068 CAGTGCAAGGGGCCGGAGGGCGG + Intronic
1150664471 17:67119459-67119481 CAGGGCTGGGAGCTGGAGGATGG + Intronic
1151527064 17:74677737-74677759 CAGAGCAGGCAGCTGGTGTGGGG + Intronic
1151544094 17:74781702-74781724 CAGAGAACAGAGCTGCAGGGAGG + Intronic
1151546851 17:74798564-74798586 CAGAGCAGGGTGCTGGGGGGTGG + Intronic
1151963080 17:77417762-77417784 CAAAGCATGGGGCTGGACGGTGG - Intronic
1152007928 17:77694144-77694166 CAGGGGAGGGACCTGGAGGGAGG + Intergenic
1152100558 17:78299412-78299434 AAGAGCACGGACCAGGAGGTAGG - Intergenic
1152245974 17:79184757-79184779 GTGAGCCCTGAGCTGGAGGGAGG + Intronic
1152562427 17:81085251-81085273 CAGAGCACGTTGCTGGCGGCTGG + Intronic
1152655106 17:81515630-81515652 CAGGGCAAGGAGCTGGAGGTGGG - Intronic
1152932346 17:83116263-83116285 TGGAGCTCGGAGCTGCAGGGTGG + Intergenic
1153660723 18:7323551-7323573 CAGAACACAGAGCTGGGGAGGGG - Intergenic
1153871021 18:9320246-9320268 CAGAGGCTGGAGCTGGAAGGGGG - Intergenic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154323856 18:13375822-13375844 AAGAGCAAGGCGCTGGCGGGCGG - Intronic
1154425270 18:14267315-14267337 CAGAGCACAAAACTGGAGGCTGG + Intergenic
1154428003 18:14286902-14286924 CAGAGCACAAAACTGGAGGCTGG + Intergenic
1154432966 18:14322554-14322576 CAGAGCACAAAACTGGAGGCTGG + Intergenic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1155763032 18:29589653-29589675 AAGGGCACAGAGCTGGATGGAGG + Intergenic
1155799961 18:30089381-30089403 TAGAGAAGGGAGCTGGAGAGGGG - Intergenic
1155839080 18:30625557-30625579 CAGAGAGAGGAGCTGGAGAGGGG + Intergenic
1157100636 18:44725808-44725830 AAGAAAACGGAGTTGGAGGGGGG - Intronic
1157127891 18:44974446-44974468 AAGAGGAGGGAGTTGGAGGGAGG + Intronic
1157491174 18:48124855-48124877 CAGAGCAGAGAGGTGGAGAGAGG - Intronic
1158440269 18:57468981-57469003 CAGAGCAGGGAAGTGAAGGGGGG + Intronic
1159607022 18:70485425-70485447 CAGAGCACTGAGAGGGAGTGTGG - Intergenic
1159632260 18:70762818-70762840 CATGGCAGGGAGCTGCAGGGAGG - Intergenic
1160392266 18:78543130-78543152 CAGAGCAGGAGGCTGGAGGCAGG + Intergenic
1160397569 18:78583525-78583547 AGGAGCACGGGGCTGGAGAGAGG - Intergenic
1160608059 18:80066982-80067004 CAGAGGAGGGTGCTGGAGGGAGG + Intronic
1160632231 18:80254593-80254615 CAGGGCAGGGGGGTGGAGGGTGG + Intergenic
1160845411 19:1164036-1164058 CAGAGGACCCACCTGGAGGGAGG - Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1161101610 19:2424538-2424560 CTTAGCCTGGAGCTGGAGGGGGG - Intronic
1161125648 19:2555892-2555914 CAGTGCACGGATCGCGAGGGGGG + Intronic
1161125660 19:2555937-2555959 CAGTGCACGGATCGCGAGGGGGG + Intronic
1161568308 19:5015837-5015859 CAGAGCACGGGGAGAGAGGGGGG - Intronic
1161709114 19:5837937-5837959 CAGAGCCCGGACTGGGAGGGAGG + Intronic
1161803675 19:6430094-6430116 CAGAGCATGGTCCAGGAGGGCGG - Exonic
1161956799 19:7500678-7500700 CCAAGCACTGAGCTGGAGGCTGG - Intronic
1161994092 19:7701882-7701904 CAGAGAAGGGAGGTGGTGGGTGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162181914 19:8875732-8875754 GAGAGCATGGACCTGGAGTGTGG + Intronic
1163110079 19:15154900-15154922 ACGACCACGGAGCTGGAGAGTGG - Intergenic
1163160505 19:15461389-15461411 CAGAGGCAGGGGCTGGAGGGAGG - Intronic
1163257869 19:16168443-16168465 CAGATCACAGGGGTGGAGGGTGG - Intronic
1163479776 19:17548248-17548270 AAGGGCACGGAGCGGGAGGCTGG + Intronic
1163659399 19:18567795-18567817 CAGAGCAGGGAGCTGGGCTGAGG + Intronic
1163678614 19:18668121-18668143 CAGAGCACGTGGCTGGCGCGCGG - Exonic
1163822920 19:19506339-19506361 CTGAGCAGAAAGCTGGAGGGGGG + Exonic
1164144692 19:22504791-22504813 TAGAGCAGGGAGCTGGAAAGTGG + Intronic
1164622680 19:29706564-29706586 CTGAGCACTGAGATGGAGGTGGG + Intronic
1164647632 19:29871351-29871373 GTGAGCACGTAGTTGGAGGGGGG - Intergenic
1165012598 19:32859684-32859706 CACGGCATGGAGCTGGAGGCAGG - Intronic
1165243190 19:34482732-34482754 GAGAGCACGGGGCTGGCTGGGGG + Intronic
1165735266 19:38171883-38171905 CAGAGCAAGGCCCTGGAGGTAGG + Intronic
1165739402 19:38196435-38196457 CAGAGCAAGGAGGTCAAGGGCGG + Intronic
1165739423 19:38196534-38196556 CAGAGCAAGGAGGTCAAGGGCGG + Intronic
1165739441 19:38196614-38196636 CAGAGCATGGAGGTCAAGGGTGG + Intronic
1165739468 19:38196733-38196755 CAGAGCATGGAGGCCGAGGGGGG + Intronic
1166391329 19:42410451-42410473 CAGAGCGCGGAGCTGGGTGAGGG + Exonic
1166771744 19:45287578-45287600 CTGACCATGGGGCTGGAGGGGGG - Exonic
1167040640 19:47020899-47020921 CCCAGCAAGGAGCTGGGGGGGGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167705708 19:51079758-51079780 CAGGGAACCGGGCTGGAGGGTGG - Intronic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
924971693 2:133888-133910 CAGAGCAGGTTGCTGGAGAGAGG + Intergenic
925099264 2:1231616-1231638 CAGAGGAGGGAGGTGAAGGGAGG - Intronic
925284965 2:2709785-2709807 CAGAGCAGGCAGCTGGATGTGGG + Intergenic
925580415 2:5404635-5404657 GAGGGCACAGACCTGGAGGGCGG + Intergenic
925843675 2:8016795-8016817 AAGAACACAGAGCTGGAGGTAGG - Intergenic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926695814 2:15769791-15769813 CAGAGCACTGGGCTGGGGTGGGG - Intergenic
927198515 2:20564355-20564377 GGGAGCCCAGAGCTGGAGGGTGG - Intronic
927210628 2:20637002-20637024 CAGAGTACAGAGCTGGGGAGGGG + Intronic
927518940 2:23687821-23687843 CAGGGGACGCGGCTGGAGGGAGG + Intronic
927945724 2:27134183-27134205 CAGGGCCCGAAGCTGGAGTGTGG + Intronic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928124634 2:28607044-28607066 CAGAGCCCAGAGCTGTATGGAGG + Intronic
930030784 2:47056913-47056935 CAGCACACGGGGCTGGATGGGGG - Intronic
930687662 2:54326330-54326352 CAGAGAAGGGACCTGGTGGGAGG + Intergenic
931722487 2:65077429-65077451 CAGAGCAAAGACATGGAGGGAGG + Intronic
932267819 2:70383399-70383421 CAGGGGAAGGAGCTGGTGGGAGG + Intergenic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
933129622 2:78655943-78655965 AAGAGCACAGAACTGGATGGAGG + Intergenic
934475222 2:94588920-94588942 GAGAGCAGGGGGCTGGAGTGGGG - Intronic
934718686 2:96558115-96558137 CAGGCCAGGGAGCTGGAGTGGGG - Intergenic
934738734 2:96703732-96703754 CTGAGCACAGAGCTGTGGGGTGG - Intergenic
935408496 2:102735210-102735232 AAAGGCATGGAGCTGGAGGGTGG + Intronic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
937931636 2:127209486-127209508 AAGAGCACAGAACTGGATGGAGG + Intronic
938219674 2:129554604-129554626 CAGAGCACACAGCTGGAGAGAGG - Intergenic
938377826 2:130820118-130820140 CACAGACCAGAGCTGGAGGGAGG + Intergenic
938384522 2:130854763-130854785 CAGAACACAGAGCTGGGGGTGGG - Intronic
938745861 2:134277546-134277568 CAGGGGAGGGAGCTGGTGGGAGG - Intronic
939914388 2:148021255-148021277 CAGGGCTCAGGGCTGGAGGGTGG - Intronic
942043639 2:172086668-172086690 AAGAGCACGGTGGTGGAAGGCGG + Exonic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942246386 2:174012782-174012804 CTGAGCTCGGACCTGGAAGGCGG - Intergenic
942307939 2:174627134-174627156 CAGAGCACAGTGGTGGAGGATGG - Intronic
942644532 2:178095934-178095956 CAGAGCACAGAGCAGCAGTGGGG + Intronic
943712445 2:191111975-191111997 CAGAGCACGGAGAGGTAGGAGGG + Intronic
943912492 2:193586380-193586402 CAGAGCAGGGGCCTGGTGGGAGG + Intergenic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
946907419 2:224430127-224430149 CAGAGAGGGGAGCTGGACGGGGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948608735 2:239153729-239153751 GAAAGCAGGGAGTTGGAGGGTGG + Intronic
948649471 2:239431581-239431603 CAGAGCATGGAACTGGAGGTAGG - Intergenic
948685457 2:239666966-239666988 CTGAGCAGAGGGCTGGAGGGTGG - Intergenic
948809265 2:240466567-240466589 CGGTGCAGGGAGCTGGGGGGAGG - Exonic
1169029247 20:2395235-2395257 CAGACATCGGAGCTGGAGCGGGG + Exonic
1169922436 20:10749645-10749667 GAAAGCAAGGTGCTGGAGGGAGG - Intergenic
1171390928 20:24801314-24801336 CTGAGCAGGGTGCTGGAGCGCGG - Intergenic
1171419847 20:25010736-25010758 CTGAGGATGGAGCTGGAGGGAGG + Intronic
1172038727 20:32028941-32028963 GAGGGCCAGGAGCTGGAGGGAGG + Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172528805 20:35616973-35616995 CAGAGGGCGGAGCTGGAGCCGGG + Intronic
1172781339 20:37438519-37438541 CAGAGCAGGGAGGAGGAGCGGGG + Intergenic
1173516224 20:43667221-43667243 CAGAGCCCGGAGCGGGAGCCGGG - Exonic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173896924 20:46558290-46558312 CAGAGTATGTAGCTGGAGAGGGG + Exonic
1174035917 20:47668197-47668219 TAGAGCTGGGAGATGGAGGGTGG - Intronic
1175142851 20:56873564-56873586 CAGAGCCCGGAGCTGCTGAGCGG - Intergenic
1175661498 20:60816835-60816857 GGGAGCAGGGAGCCGGAGGGGGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1176019294 20:62954318-62954340 GCGAGAACAGAGCTGGAGGGCGG + Intronic
1176844083 21:13863202-13863224 CAGAGCACAAAACTGGAGGCTGG - Intergenic
1177099294 21:16879936-16879958 AAGGGCACAGAGCTGGATGGAGG + Intergenic
1178609994 21:34072560-34072582 CAGAGCCCCTGGCTGGAGGGCGG + Intergenic
1179019685 21:37627224-37627246 AAGAGCACAGAGCTGGCGTGAGG - Intronic
1179485379 21:41706714-41706736 CAGGGGAGGGAGCTGGAGGTGGG - Intergenic
1179884323 21:44306985-44307007 CAGAGCACGGGCCTGGGGGCAGG + Intronic
1179891725 21:44338891-44338913 GAGAGGGCGGAGCCGGAGGGAGG - Intronic
1179891774 21:44339005-44339027 GAGAGGGCGGAGCCGGAGGGAGG - Intronic
1180074192 21:45454447-45454469 CAGAGCACTGAGGGGGTGGGTGG + Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182202911 22:28591948-28591970 TAGAGGGCGGAGCTGGGGGGAGG + Intronic
1182353322 22:29710929-29710951 GAGTGCAGGGAGCTGGAGGTGGG - Intergenic
1183058038 22:35318954-35318976 CCCAGCTCTGAGCTGGAGGGAGG + Intronic
1183188164 22:36304384-36304406 CAGAGTAGGGAGTTGGTGGGAGG - Intronic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183342017 22:37286739-37286761 CAGAGCACGGAGCTGGGACGGGG + Intronic
1183379212 22:37482527-37482549 CTGAGCTGGGAGCTAGAGGGTGG - Intronic
1183392314 22:37552523-37552545 GAGAGCAAGAAGTTGGAGGGGGG - Intergenic
1183538277 22:38415622-38415644 CAGGGCAGGGCGCGGGAGGGCGG + Intergenic
1183539768 22:38423271-38423293 GAGAGCCCGCAGCTGCAGGGAGG - Intergenic
1184092350 22:42299324-42299346 CAGAGCAGGGGGCTGGATGTGGG - Intronic
1184499159 22:44861546-44861568 CAGAGCAGAGAACTGGAGGGAGG - Intronic
1184547843 22:45184223-45184245 CAGAGACCCGGGCTGGAGGGAGG + Intronic
1185042429 22:48511994-48512016 CATGGCACAGAGCTGCAGGGAGG + Intronic
1185104283 22:48858409-48858431 CAGAGCAAGGTGCTGGTGGCAGG - Intergenic
1185324812 22:50220406-50220428 CAGAGCACTGTGCTGGACTGTGG - Exonic
1185384468 22:50525518-50525540 GAGCGCAGGGAGCTGGAGGTCGG - Intronic
1185423208 22:50746860-50746882 CAGAGCACGGAGCTTATGCGGGG - Intergenic
950452434 3:13072917-13072939 CTGAGCTGGGAGCTGGAGTGAGG - Intronic
950747058 3:15099068-15099090 CAGAGCCCGGGCCTGAAGGGGGG - Exonic
950841767 3:15974795-15974817 GAGACCGCGGGGCTGGAGGGGGG - Intergenic
953397306 3:42583267-42583289 GAGAGAATGGAGCTGGAGTGTGG + Intronic
953592425 3:44271912-44271934 CAGAGGACAGGGGTGGAGGGTGG - Intronic
953681988 3:45046298-45046320 CAGGGCACAGAGCTGGGTGGAGG + Intergenic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954938303 3:54347219-54347241 CATAGGAAGGAGCTGCAGGGAGG + Intronic
954961853 3:54572443-54572465 CATAGCACAGAGCTGGGGTGAGG - Intronic
956860220 3:73315871-73315893 CAGAGCAGGGGGCTGGAGGGAGG - Intergenic
957935543 3:86937136-86937158 CAGAGCCCGAAAATGGAGGGAGG - Intergenic
958807107 3:98824366-98824388 CAGATCATGGAGCTGGAGAGTGG + Intronic
958880552 3:99664582-99664604 CAGGGCACTGAGCTGGGAGGAGG - Intronic
959653495 3:108774652-108774674 CAGATCAAGGTGCTGCAGGGTGG + Intergenic
961372298 3:126439027-126439049 CAGAGGGGTGAGCTGGAGGGCGG - Intronic
961456921 3:127028966-127028988 GGGAGGAGGGAGCTGGAGGGTGG - Intronic
961598920 3:128043512-128043534 CAGAGAAGGGAGCTGGAGAGGGG + Intergenic
962386414 3:134936124-134936146 CAGAGAATGGAGCTGGGGTGGGG + Intronic
963603015 3:147393413-147393435 CAGTGCAGGGAGCTGGAGGGAGG - Intronic
965039705 3:163490581-163490603 CAGAGAGGGGAGCTGGAGAGGGG + Intergenic
965706392 3:171512149-171512171 CAGAGCACGAAGGTGGATGTGGG - Intergenic
966221390 3:177555013-177555035 GAGGGCAAGGAGCTGGTGGGTGG + Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968278213 3:197456839-197456861 CAGAGCACCGGGCTGGCCGGTGG - Intergenic
968280649 3:197474243-197474265 CAGGGGAGGGATCTGGAGGGAGG + Intergenic
969135815 4:5027880-5027902 CAGAGCTGGGAGATGGATGGAGG + Intergenic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969469834 4:7381323-7381345 CGGAGCACAGAGCTGGAGGGCGG + Intronic
969666541 4:8560612-8560634 CTGTGCATGGAGCTGGAGAGAGG + Intronic
970223584 4:13834964-13834986 CAGAGCAGGGAGCTGGTCGAAGG - Intergenic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
972316913 4:37935261-37935283 CAGAGATCTGAGCTGGAGGAAGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974703086 4:65476578-65476600 CAGAGCACGGAGTGAGAGGAGGG + Intronic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
977022922 4:91777808-91777830 AAGAGGCAGGAGCTGGAGGGAGG + Intergenic
977220474 4:94332203-94332225 CAGAGAGGGGAGCTGGAGAGAGG - Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978350737 4:107818233-107818255 CAGAGAATGGAGCTGGTGGTTGG - Intergenic
978598616 4:110405027-110405049 CAGACCACTGAGCTGGAGTTCGG + Intronic
978696209 4:111583710-111583732 CAGAGGAGGGACCTGGTGGGAGG - Intergenic
979690506 4:123553938-123553960 AAGAGGTGGGAGCTGGAGGGGGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980729133 4:136804661-136804683 CAGAGAGGGGAGATGGAGGGAGG - Intergenic
982174048 4:152688740-152688762 CAGGGCACGGAGGAGGAGGAGGG + Intronic
984021866 4:174495153-174495175 GAGAACATGGAGCTGGAAGGAGG - Intronic
984999438 4:185469953-185469975 CAGAGCACGGGGCAGGAGAAGGG - Intronic
985489700 5:172080-172102 CAGAGCAGGGCCGTGGAGGGTGG + Intronic
985509283 5:303065-303087 GAAAGGAAGGAGCTGGAGGGAGG + Intronic
985738990 5:1603827-1603849 GAAAGGAAGGAGCTGGAGGGAGG - Intergenic
985899663 5:2778794-2778816 CAGAGAACGGTGCAGCAGGGAGG + Intergenic
986016440 5:3761525-3761547 AAGGCCACGGAGATGGAGGGAGG - Intergenic
986140785 5:5027347-5027369 AAGAGCACAGAACTGGATGGAGG + Intergenic
986209037 5:5652822-5652844 CAGACCCCGAAGCTGGAGGGAGG - Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
987088524 5:14490502-14490524 CAGACCACTGAGCTGCAGGAAGG - Intronic
987089293 5:14497126-14497148 CAGGGCACGGGGCTGGTGGGTGG - Intronic
987097626 5:14563981-14564003 CAGAGCCTGGTGCTCGAGGGAGG + Intergenic
987146213 5:14993889-14993911 CAGCACACGGAGCGGGTGGGAGG + Intergenic
987486444 5:18532969-18532991 CAGAGAGGGGAGCTGGAGAGAGG - Intergenic
988491809 5:31711544-31711566 CAGTGCAGAGAGGTGGAGGGAGG + Intronic
988856105 5:35229633-35229655 CAGAAGCCGGAGCTGGACGGAGG - Intronic
992435904 5:76755954-76755976 CAGAGGACTGAGGTGGACGGAGG - Intergenic
996862575 5:128083373-128083395 CAGAGCGCGGCGGGGGAGGGAGG + Intergenic
997846029 5:137286683-137286705 CAAATCACAGAGCAGGAGGGTGG + Intronic
998385135 5:141753201-141753223 CAGAGCGGGGAGCTGGAAAGGGG + Intergenic
999956595 5:156709848-156709870 CAGAGTAGGGGGCGGGAGGGTGG - Intronic
1000614228 5:163410182-163410204 CACAGCACCCAGCTGCAGGGAGG - Intergenic
1001400350 5:171442621-171442643 AAGAGAACAAAGCTGGAGGGTGG - Intronic
1001690016 5:173625945-173625967 CAGAGCACTGAAATGGAGGTAGG - Intergenic
1001795973 5:174502647-174502669 CAGAGCAGGGAGGTGGACAGAGG + Intergenic
1001831277 5:174791323-174791345 TAGAGGCCTGAGCTGGAGGGTGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002073545 5:176694895-176694917 CAGAGCAGTGGGCTGGTGGGTGG + Intergenic
1002764631 6:228295-228317 CAGAGCACGAGGAGGGAGGGAGG + Intergenic
1003303709 6:4907952-4907974 GAGAACACGGAGCTCAAGGGGGG - Intronic
1005026429 6:21466927-21466949 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005988858 6:30891153-30891175 CTGAGCAGGGGACTGGAGGGTGG + Intronic
1006185026 6:32176641-32176663 CAGAGAAGGCAGGTGGAGGGGGG - Exonic
1006518831 6:34559859-34559881 CAGCCCAGGGAGCTGGAGGCAGG - Intergenic
1007626323 6:43248202-43248224 TGGAGCAGGGAGCTGGGGGGAGG + Intronic
1008274108 6:49523544-49523566 GAGAACATGGATCTGGAGGGGGG - Intronic
1008300444 6:49831487-49831509 CAGAGGACGTAGATGGAGGAGGG + Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1009882997 6:69592481-69592503 CAGAGGAGGGATCTGGTGGGAGG + Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010294720 6:74182715-74182737 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1010408491 6:75533801-75533823 GAGAGAATGGAGCTGGGGGGAGG + Intergenic
1011219653 6:85040830-85040852 AAGAGCACGAAGCTGGAGTCTGG - Intergenic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1013601864 6:111712557-111712579 CAGAGCACAGAGCTGGCAGGTGG - Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017267041 6:152459440-152459462 CAAAGCATGGAGCTGGTGGGAGG - Intronic
1018063191 6:160106255-160106277 CACAGCATGGAGGAGGAGGGAGG + Exonic
1018432185 6:163730988-163731010 CACAGCAGGAAGCAGGAGGGAGG + Intergenic
1018438230 6:163782636-163782658 CACAGCACGGTGCTCCAGGGCGG + Intergenic
1018654775 6:166024764-166024786 CAGAGAGGGGAGCTGGAGAGGGG + Intergenic
1018995154 6:168704842-168704864 CAGGGCACTGGACTGGAGGGTGG + Intergenic
1019023143 6:168935826-168935848 CAGGGCCTGGAGCAGGAGGGAGG - Intergenic
1019032332 6:169024200-169024222 CAGTGCACGGAGGAGCAGGGGGG + Intergenic
1019257708 7:62382-62404 CCCAGAAAGGAGCTGGAGGGGGG - Intergenic
1019722629 7:2582457-2582479 GAGAGCACAGCGCTGGAGGGAGG + Intronic
1019732642 7:2636393-2636415 AAGAGCATAGAGCTGTAGGGTGG + Intronic
1020904459 7:14048102-14048124 CAGAGGAGGGATCTGGTGGGAGG + Intergenic
1021917912 7:25454340-25454362 CAGAACACAGTGCTGGATGGAGG - Intergenic
1021965538 7:25914817-25914839 CAGTGGAGGGAACTGGAGGGAGG + Intergenic
1022302071 7:29111295-29111317 CAGGGCACAGAGCGGGATGGAGG - Intronic
1023366399 7:39468284-39468306 CGGAGCAGGCAGCAGGAGGGAGG + Intronic
1023607430 7:41943143-41943165 CAGAGAACGGAGGTGGAGATGGG + Intergenic
1023727786 7:43162422-43162444 CAGACCATGGAGATGGAGGTTGG - Intronic
1024092735 7:45959469-45959491 GAAAGCACGGATCTGCAGGGAGG - Intergenic
1024208193 7:47181741-47181763 CTGAGCAGGGAGCTGGATTGAGG - Intergenic
1024377341 7:48654699-48654721 AAGTGCACTGAGCTGGAGGATGG - Intergenic
1026012113 7:66644652-66644674 CAGGGGAGGGACCTGGAGGGAGG - Intronic
1026493714 7:70884970-70884992 GAGAGGAAGGAGCTGGAGAGAGG + Intergenic
1027555935 7:79664882-79664904 CAGAGCACAGGGCTGGAGTATGG - Intergenic
1027944166 7:84723710-84723732 TAGAGCACGGAACTGGACAGAGG + Intergenic
1028633494 7:92961709-92961731 CTGAGAATGGAGCTGGAGGTGGG + Intergenic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1033487572 7:141805883-141805905 CATGGGACGGACCTGGAGGGAGG + Intergenic
1034038371 7:147848988-147849010 CAGAGTACGTAGCTGGAGCCTGG - Intronic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1035076512 7:156181101-156181123 CAGAGCAAGGAGCTGGCCGCGGG - Intergenic
1035076518 7:156181142-156181164 CAGAGCAAGGAGCTGGCTGCAGG - Intergenic
1035127181 7:156616873-156616895 CAGAGCGCTGCGCTGCAGGGAGG - Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1037548689 8:19948782-19948804 CACAGCACAGAGCTGGAGAATGG - Intronic
1037911566 8:22746735-22746757 GACAGCACCGATCTGGAGGGAGG - Intronic
1038613680 8:29074345-29074367 CAAAGCAGGGAGCAGGATGGTGG + Intronic
1039890441 8:41682190-41682212 CACAGGACGGGGCTGGAGGCGGG - Intronic
1040655500 8:49502887-49502909 TAGGGCATGGAGCTGGTGGGAGG + Intergenic
1041746284 8:61212175-61212197 TAGAGCATGGAACTGGAGGGCGG - Intronic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1045909880 8:107394523-107394545 CAGAATAAGGAGCTGGGGGGAGG + Intronic
1046759348 8:118005074-118005096 GAGATCACAGAGCTGGAGAGTGG + Intronic
1047270384 8:123352158-123352180 CAGAGCAAGGAGGTGAGGGGAGG - Intronic
1047381135 8:124364354-124364376 GAGAGCACTGAGGAGGAGGGAGG + Intronic
1048276958 8:133073813-133073835 CAAGTCACGGAGCTGGTGGGAGG - Intronic
1048470539 8:134700522-134700544 CCGAGCACTGGGGTGGAGGGAGG - Intronic
1048733468 8:137470860-137470882 CAGGGCACAGAGCTGGAAAGGGG + Intergenic
1049254218 8:141605284-141605306 CAGAGCCCGGAGGCGCAGGGAGG + Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049329914 8:142044906-142044928 CAGGGCACGGTGCTCGAGGGTGG + Intergenic
1049462420 8:142736257-142736279 CAGAGCATGGCCCTGGTGGGCGG - Exonic
1049509378 8:143019705-143019727 CAGAGAACAGATCTGGAGAGGGG - Intronic
1049667601 8:143853433-143853455 CAGAGCAGCGACCTGGAGGAGGG + Intergenic
1049706646 8:144046197-144046219 CAGAGCACGGAGCCAGGAGGAGG + Intronic
1049744818 8:144258835-144258857 CAGCGCATGGACCTGGAGGGAGG + Exonic
1049773151 8:144392995-144393017 CAGAGCACGAGCCAGGAGGGCGG - Exonic
1050394002 9:5176308-5176330 CAGAGCAAGGAGTTGAAAGGTGG - Intronic
1050730539 9:8704238-8704260 CAGAGGATGGAGTGGGAGGGGGG - Intronic
1050939708 9:11443336-11443358 CAGAGAGGGGAGCTGGAGAGAGG - Intergenic
1051355665 9:16237900-16237922 CAGAGGACGGCGGTGGCGGGGGG + Intronic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052854831 9:33400852-33400874 GAGAGCAGGGGGCTGGAGTGGGG + Intronic
1053682849 9:40497171-40497193 GAGAGCAGGGGGCTGGAGTGGGG + Intergenic
1053932831 9:43125485-43125507 GAGAGCAGGGGGCTGGAGTGGGG + Intergenic
1054280865 9:63127757-63127779 GAGAGCAGGGGGCTGGAGTGGGG - Intergenic
1054295949 9:63332671-63332693 GAGAGCAGGGGGCTGGAGTGGGG + Intergenic
1054393965 9:64637166-64637188 GAGAGCAGGGGGCTGGAGTGGGG + Intergenic
1054428614 9:65142378-65142400 GAGAGCAGGGGGCTGGAGTGGGG + Intergenic
1054501765 9:65879164-65879186 GAGAGCAGGGGGCTGGAGTGGGG - Intronic
1056429827 9:86516364-86516386 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1056827025 9:89883598-89883620 CAGGGCAGGGAGGTGGAGGGAGG - Intergenic
1057292552 9:93815909-93815931 CAGAGCACCGAGGTGTAGAGAGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058317459 9:103586529-103586551 CAGAGAGGGGAGCTGGAGAGGGG - Intergenic
1059308052 9:113370041-113370063 CAGAGCACTGTGCCGGAGGCTGG - Exonic
1059433845 9:114265005-114265027 CAAAGCACGGAGCAGGGAGGGGG - Intronic
1060417172 9:123439126-123439148 CTGAGCCTGGAGCTGGGGGGAGG + Intronic
1060822779 9:126671204-126671226 CCGAGCTCTGAGCTGGGGGGAGG + Intronic
1060892463 9:127197492-127197514 CAGAGCATGGGGGTGGGGGGCGG + Intronic
1060939816 9:127536785-127536807 CAGAGCTAGGACCAGGAGGGTGG - Intronic
1060974322 9:127755404-127755426 GAGCGCGCGGAACTGGAGGGCGG - Intronic
1061754335 9:132802310-132802332 CAGGGCAGGGGGCGGGAGGGGGG + Intronic
1061793352 9:133070383-133070405 CAGAGACCGGACTTGGAGGGAGG - Intronic
1061795959 9:133086180-133086202 CAGAGACCGGACTTGGAGGGAGG - Intronic
1062411758 9:136429301-136429323 CAGAGCACGGGGGTGTTGGGGGG + Exonic
1185506541 X:635474-635496 CAGAGGACAGGGCTGGAGAGGGG - Intronic
1185754570 X:2643141-2643163 GTGAGCACAGGGCTGGAGGGGGG + Intergenic
1186326688 X:8485504-8485526 CACAGAACGGAGCAGGAGTGTGG + Intergenic
1186445170 X:9621010-9621032 GTGAGCACGGAGTGGGAGGGAGG + Intronic
1186657796 X:11633843-11633865 CAGAGCTGGGAGCTGGAGACAGG - Intronic
1186940605 X:14503234-14503256 CAGAGGACAGAGCAGTAGGGTGG + Intergenic
1187246144 X:17554391-17554413 CACAGGCCAGAGCTGGAGGGGGG + Intronic
1187501245 X:19840869-19840891 CACAGCACACAGCTGGAGGGTGG - Intronic
1188242956 X:27810990-27811012 CAGAGTATGCAGTTGGAGGGAGG - Intronic
1190128690 X:47726811-47726833 CAGAGCAGGGTGGTGGGGGGAGG - Intergenic
1190330070 X:49230428-49230450 CCGAGGTCGGAGGTGGAGGGTGG - Intronic
1191853350 X:65602523-65602545 GAGAGCGTGGAGCTGGAGAGTGG - Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1193911147 X:87308743-87308765 CAGGGCTGGGACCTGGAGGGAGG - Intergenic
1199017518 X:142836022-142836044 AAGATAACAGAGCTGGAGGGTGG + Intergenic
1199660917 X:150050265-150050287 CAGAGCACTAAGCTGGAGTCAGG + Intergenic
1199721867 X:150547936-150547958 CAGAGCAGGCGGCTGGACGGCGG - Intergenic
1200087186 X:153613001-153613023 CTGCACACGGAGCTGGTGGGTGG + Intergenic
1200089805 X:153629271-153629293 CAGAGGAGGGAGCTGTGGGGAGG - Intergenic