ID: 1103897043

View in Genome Browser
Species Human (GRCh38)
Location 12:124279761-124279783
Sequence CAGCTCCCCGCAGGTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103897043_1103897046 -7 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897046 12:124279777-124279799 GGAGCTGCTCTCTGCAGAAACGG 0: 1
1: 0
2: 3
3: 41
4: 353
1103897043_1103897054 26 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897054 12:124279810-124279832 GGGTTGAGAGGAGCCCAACGGGG 0: 1
1: 0
2: 0
3: 12
4: 130
1103897043_1103897048 -5 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897048 12:124279779-124279801 AGCTGCTCTCTGCAGAAACGGGG 0: 1
1: 0
2: 0
3: 17
4: 183
1103897043_1103897050 6 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897050 12:124279790-124279812 GCAGAAACGGGGTAAAACATGGG 0: 1
1: 0
2: 0
3: 6
4: 131
1103897043_1103897052 24 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897052 12:124279808-124279830 ATGGGTTGAGAGGAGCCCAACGG 0: 1
1: 0
2: 1
3: 16
4: 179
1103897043_1103897049 5 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897049 12:124279789-124279811 TGCAGAAACGGGGTAAAACATGG 0: 1
1: 0
2: 0
3: 5
4: 139
1103897043_1103897047 -6 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897047 12:124279778-124279800 GAGCTGCTCTCTGCAGAAACGGG 0: 1
1: 0
2: 5
3: 26
4: 243
1103897043_1103897051 14 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897051 12:124279798-124279820 GGGGTAAAACATGGGTTGAGAGG 0: 1
1: 0
2: 2
3: 9
4: 137
1103897043_1103897053 25 Left 1103897043 12:124279761-124279783 CCCATGGCACCTGCGGGGAGCTG 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1103897053 12:124279809-124279831 TGGGTTGAGAGGAGCCCAACGGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103897043 Original CRISPR CAGCTCCCCGCAGGTGCCAT GGG (reversed) Intronic
900282389 1:1879175-1879197 CTGGTCCCCACAGGTGCCCTGGG + Intronic
902447036 1:16474137-16474159 CGGCTCCTCCCAGGAGCCATAGG - Intergenic
903581192 1:24372379-24372401 AAGCTCCCCGTGGGTGCCAGGGG - Intronic
905171616 1:36113155-36113177 CAGCTCAACGCAGGAGCCACCGG + Intronic
908838799 1:68257047-68257069 CAGCTCCCCTCACATTCCATTGG - Intergenic
909602747 1:77478083-77478105 CAGCTCACCTCTTGTGCCATGGG + Intronic
912491442 1:110064856-110064878 CAGCTTCCCCCAGCTGCCCTTGG - Exonic
915354967 1:155250514-155250536 CAGCTGCCCGCAGCTGCCACCGG - Exonic
916488308 1:165278893-165278915 CAGGACCCCGCAAGGGCCATGGG + Intronic
919902848 1:202056922-202056944 CCCCACCCCGCAGGTGGCATGGG - Intergenic
922193077 1:223336928-223336950 CAGCTCTCACCAGGTTCCATGGG - Intronic
1062906848 10:1185098-1185120 CATTTCCCCGCAGCTGCCCTTGG - Intronic
1062982215 10:1735090-1735112 TAGCTGCCGGCAGGTGCCCTGGG + Intronic
1067661769 10:48241415-48241437 CAGCTCCACTCAGGTCTCATGGG + Intronic
1070471391 10:76783661-76783683 CTGCTCCCCTCGAGTGCCATTGG + Intergenic
1071568112 10:86681820-86681842 CAGCTCTCCACAGGTGGCCTGGG + Intronic
1072021812 10:91410213-91410235 CGGCTCCCCACAGGTCCCACAGG - Intergenic
1072611100 10:97018247-97018269 CTGCTCCTGCCAGGTGCCATGGG - Intronic
1075444349 10:122503425-122503447 CAGCTCCCCACAGGAGCCACTGG - Intronic
1076869451 10:133186202-133186224 CAGCTCCCCGAGGGTGCGCTCGG - Exonic
1077191808 11:1258850-1258872 CAACTCCCTGCAGGCCCCATTGG + Intronic
1077210480 11:1368993-1369015 CAGCTCCCAGCAGGTGGGCTTGG - Intergenic
1077327597 11:1970463-1970485 CAGCCCCCTGCAGCTGCCCTCGG + Intronic
1083643513 11:64158572-64158594 AACCTCCAAGCAGGTGCCATTGG + Intronic
1084636163 11:70394324-70394346 CACCTCCCCTCATGTTCCATGGG + Intergenic
1088583269 11:111335361-111335383 CAGCTTCCAGCTGGTGCCTTTGG + Intergenic
1088751562 11:112846485-112846507 CAGCTTCCAGAAGGTGCCACTGG + Intergenic
1089657909 11:119965114-119965136 CCCCTCCCCACAGGTGCCTTGGG + Intergenic
1091219219 11:133920457-133920479 CACCTCCCTGCAGGTGCCCGCGG - Exonic
1202810579 11_KI270721v1_random:25643-25665 CAGCCCCCTGCAGCTGCCCTCGG + Intergenic
1092019795 12:5191867-5191889 GAGCTCCCTGCAGGTGCTCTAGG - Intergenic
1092144079 12:6202569-6202591 CAGCTTCCTGCATATGCCATGGG - Intronic
1103546169 12:121703201-121703223 GAGATCCAGGCAGGTGCCATGGG - Intergenic
1103897043 12:124279761-124279783 CAGCTCCCCGCAGGTGCCATGGG - Intronic
1105572276 13:21613893-21613915 CAGCTCTCCTCACATGCCATTGG - Intergenic
1107391694 13:39971678-39971700 GAGGTTCCCCCAGGTGCCATCGG - Intergenic
1107973861 13:45670666-45670688 CAGCTGGCAGCAGGTGGCATAGG - Intergenic
1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG + Intronic
1111676919 13:91399157-91399179 CAGCTCCCAGCAGCCGCCACTGG - Exonic
1121718277 14:96091546-96091568 GTGCTCCCTGCAGCTGCCATCGG + Exonic
1122552598 14:102557882-102557904 CATCTTCCCGCAGCTGCCAAAGG - Intergenic
1122946543 14:105013305-105013327 CAGCTCCCCGCAGGCGGCACTGG - Intronic
1125589120 15:40843881-40843903 CAGCTCCCCGGAGGGGCTCTCGG - Intergenic
1127966446 15:63926172-63926194 CAGCTCCCTGCAGCAGTCATGGG - Intronic
1128099760 15:64989409-64989431 CAGCTCCCCGCCAGTCCCACCGG + Intronic
1129466322 15:75726128-75726150 CAGCTGCCCGCAGGTCCCCATGG + Exonic
1130890398 15:88128587-88128609 CAGATGCCCTCAGCTGCCATGGG + Intronic
1132251819 15:100340791-100340813 CAGCTCCGCGCGGGTTCCACGGG + Intronic
1132771594 16:1566730-1566752 CAGGGTCCCGGAGGTGCCATGGG - Intronic
1133281759 16:4670744-4670766 CAGGTCCCTGCAGGTACCAGGGG + Intronic
1133829333 16:9307214-9307236 TAGCTCCTAGCAGGTGCAATAGG - Intergenic
1133838786 16:9389669-9389691 CAGTTCCCCACATATGCCATGGG - Intergenic
1134350918 16:13437083-13437105 CAGCTCCCGTAATGTGCCATGGG - Intergenic
1134540597 16:15061662-15061684 CAGCACCCAGCTTGTGCCATTGG - Exonic
1137703517 16:50517665-50517687 CAGCACCCAGCTGGTGCCAGTGG - Intergenic
1138588896 16:57988707-57988729 CAGCTGCCCACAGGTGGGATGGG - Intergenic
1140545256 16:75801750-75801772 CAGCTCCCTGCAGGTATCTTTGG - Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143576842 17:7798786-7798808 CAGCTCCCAGAATGTGCCACTGG + Intronic
1146656422 17:34637632-34637654 CGGCTTCCTGCAGGTGCCACGGG + Exonic
1148178582 17:45587078-45587100 AAGCTGCCCCCAGGTGCCATAGG - Intergenic
1148239846 17:45993065-45993087 CAGCCCGCAGCAAGTGCCATAGG - Intronic
1148270573 17:46259377-46259399 AAGCTGCCCCCAGGTGCCATAGG + Intergenic
1151445441 17:74160647-74160669 CAGCCTCCCATAGGTGCCATAGG + Intergenic
1152318861 17:79596773-79596795 CAGCTCCCAGAAAGTGCTATGGG + Intergenic
1152653675 17:81509421-81509443 TTTCTCCCCGCAGGTGCCAGGGG - Intergenic
1161061600 19:2217788-2217810 GAGCTCCCCGCTGCTGCCGTAGG - Exonic
1161345152 19:3765246-3765268 CAGCTCACCACATATGCCATGGG + Exonic
1161855709 19:6763733-6763755 GAGCTCCATGCAGGTGCCACAGG - Exonic
1162044181 19:7987836-7987858 CAGGTCGGCCCAGGTGCCATAGG + Intronic
1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG + Intronic
1163710175 19:18841848-18841870 CCGGTCCACACAGGTGCCATTGG + Intronic
1165528721 19:36378860-36378882 GAGTTCCCCGCAGTTTCCATGGG + Intronic
1166502923 19:43354380-43354402 CAGCCCCCAGCAGGTGCCTGCGG + Exonic
934165988 2:89294629-89294651 CAGCTCCTCCCAGGTGCCCCAGG + Intergenic
934201289 2:89887827-89887849 CAGCTCCTCCCAGGTGCCCCAGG - Intergenic
938079159 2:128360129-128360151 CAGCTGGGCGCTGGTGCCATGGG - Intergenic
941167949 2:162103806-162103828 CAGCTTCCCTCAGGTACCACTGG + Intergenic
947908012 2:233779831-233779853 CCGCTGCCTGCAGGTGCCAGAGG + Exonic
947912723 2:233811945-233811967 CAGCTCACCTCAGGTGCGAGAGG - Exonic
948862847 2:240761238-240761260 CAGCTCCACGCTGATGGCATTGG + Exonic
1172245366 20:33442353-33442375 CAGCCCCCAGCAGGTGCTTTGGG - Intronic
1176034562 20:63029909-63029931 CTGCTCCCAGCACGGGCCATCGG - Intergenic
1178413403 21:32384235-32384257 CAGCTCTCCGCAGGTGCATTTGG - Intronic
1179613848 21:42569252-42569274 CAGCTCCCTGCACGAGCCAGTGG - Intronic
1180956932 22:19745425-19745447 CAGCTCCCAGCAGGTGCTAGTGG - Intergenic
1182423076 22:30257900-30257922 CAGCTCCCCCCACGAGACATTGG + Intergenic
1182902341 22:33908931-33908953 CAGCTCCACGCAGCTGCTTTAGG + Intronic
1183406623 22:37633376-37633398 CAGCCCCTCGCTGGGGCCATGGG - Exonic
1184162391 22:42704837-42704859 CTGCTGCCCGCAGGTGCTTTGGG - Intronic
1184600681 22:45541627-45541649 CAGCTCCCCGTTGGTGACAAAGG + Intronic
1184667901 22:45998126-45998148 CAGCTCAGGGCAGGTGCCGTTGG - Intergenic
949928030 3:9057548-9057570 CCCCTCCCAGCAGGTGCCACGGG + Intronic
950671880 3:14532226-14532248 CTGGTCCCCGCAGGTGGCAGAGG + Intronic
954988366 3:54816074-54816096 CAGTTCCTCGCCTGTGCCATTGG + Intronic
955607717 3:60723495-60723517 CAGCTCCCAGCAGTAGCCTTGGG + Intronic
956195502 3:66650076-66650098 CAGCTTCCCACAGGGGACATTGG + Intergenic
961356360 3:126342356-126342378 CAGCTTCCCACAGGTGCTGTCGG + Intergenic
965505062 3:169506339-169506361 CACATCCCCGCTGGTGCCGTGGG + Intronic
975008666 4:69322023-69322045 CAGGTACCCTCAGTTGCCATAGG - Intronic
977557288 4:98498707-98498729 GAGCTCCCGGGAGGTGCCCTTGG - Intronic
982264786 4:153528278-153528300 GAGCTCCCAGCAGTTGGCATTGG + Intronic
984206571 4:176793109-176793131 CCGCTCCCCGCAGGGGACAGGGG - Intergenic
985649420 5:1100431-1100453 CAGCAGCCCCCAGGTGCCCTGGG + Intronic
985957251 5:3274975-3274997 CAGCTCACGGCAGGAGCCAATGG - Intergenic
986209673 5:5659155-5659177 CAGCTACTGGCAGGTGCCAAGGG + Intergenic
986212077 5:5683375-5683397 GAGCTCCCAGCAGGTGACCTAGG + Intergenic
986721306 5:10563459-10563481 CAGATCCCCGCACGTGACACAGG + Intergenic
987440061 5:17944280-17944302 CTGCTGGCCGCAGTTGCCATGGG - Intergenic
990402097 5:55448780-55448802 CAGTTCCCCACAGATACCATGGG - Intronic
995185488 5:109267019-109267041 AAGTTCCCCCCAGTTGCCATGGG + Intergenic
997821358 5:137068994-137069016 CAGCTCTTATCAGGTGCCATGGG + Intronic
998266459 5:140671122-140671144 AAGCTGCCCCCAGGTGCCATAGG + Exonic
999610386 5:153362738-153362760 CAGCTCCCAGGAGGTGCCCAAGG - Intergenic
999975774 5:156910623-156910645 CAGCTCCCCACAGGGCCCTTTGG + Intergenic
1000991397 5:167915496-167915518 CAGCTCCCTTCAGCTGGCATTGG + Intronic
1003632766 6:7802930-7802952 CTGCTCCCTGCAGGTGCTGTGGG + Intronic
1004199210 6:13532442-13532464 CAGCTCCCAGAAGGAGCCATGGG + Intergenic
1013759547 6:113500714-113500736 CAGCACCACGCAGGGGCCTTAGG + Intergenic
1013978306 6:116101192-116101214 CCGCTCCGCGCCGGTGCCGTGGG + Intronic
1018398796 6:163402041-163402063 CAGCTCCCTGGAGACGCCATAGG + Intergenic
1018681838 6:166271270-166271292 CTGCTCCCTGCAGGTGCAGTTGG + Intergenic
1019032656 6:169025592-169025614 CAGCTCCCCGCTGGTGGCTGAGG - Intergenic
1019460476 7:1155937-1155959 CAGCTCCCCTCAGTCGCCAACGG + Intronic
1019501497 7:1367045-1367067 CAGCTGCCTGCGGGTGCCCTCGG + Intergenic
1019557920 7:1641780-1641802 CAGCTTCCCGGAGGGGCCAGGGG + Intergenic
1032496641 7:132367917-132367939 CAGGTTCCCCCAGGTGCCAGCGG + Intronic
1037998263 8:23368894-23368916 CATGTCCCCGCCGTTGCCATGGG - Intronic
1043785711 8:84397166-84397188 CAGATCCCAGAAGGTGCCCTTGG - Intronic
1047523778 8:125615533-125615555 CAGCTGCCCGCGGGTGCCCCTGG - Intergenic
1049326394 8:142023649-142023671 CAGCTCCCGGCAGCTGTCACAGG + Intergenic
1053269421 9:36739956-36739978 CGTGGCCCCGCAGGTGCCATGGG - Intergenic
1053466362 9:38311541-38311563 CAGCTCCCCTCGGCTTCCATTGG + Intergenic
1053500117 9:38581034-38581056 CTGCTCCCCTCAGGTTCCCTAGG - Intergenic
1054942764 9:70761468-70761490 CAGCTCTCCTCAGGCTCCATTGG - Intronic
1057055572 9:91958040-91958062 CAGCTCACTGCAGGTTCCAGTGG - Intergenic
1057792710 9:98134660-98134682 CAGCTCCCTCCAGATGCCCTAGG - Intronic
1060359464 9:122941157-122941179 TGGCTCCCCGCAGGGGCCGTCGG - Intronic
1192223144 X:69211023-69211045 CATCTCCCCCCAGCTGCCACAGG + Intergenic
1193079420 X:77390910-77390932 CAGCTCCCAGCAGGGGCCAATGG + Intergenic
1197633560 X:128889609-128889631 CAGCTGCCAGCAGGTGGGATAGG + Intergenic
1200073976 X:153542241-153542263 GAGGTCCCGTCAGGTGCCATGGG - Intronic