ID: 1103897899

View in Genome Browser
Species Human (GRCh38)
Location 12:124286101-124286123
Sequence CTCTGCAAAGAGCCTGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 436}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103897899_1103897911 27 Left 1103897899 12:124286101-124286123 CCTTTCTCAGGCTCTTTGCAGAG 0: 1
1: 0
2: 2
3: 34
4: 436
Right 1103897911 12:124286151-124286173 GGTTCAAAAGCCACTTCTGAAGG 0: 1
1: 0
2: 2
3: 13
4: 159
1103897899_1103897901 -1 Left 1103897899 12:124286101-124286123 CCTTTCTCAGGCTCTTTGCAGAG 0: 1
1: 0
2: 2
3: 34
4: 436
Right 1103897901 12:124286123-124286145 GCCGGCCCCTTTTCCCCACCAGG 0: 1
1: 0
2: 5
3: 85
4: 344
1103897899_1103897906 6 Left 1103897899 12:124286101-124286123 CCTTTCTCAGGCTCTTTGCAGAG 0: 1
1: 0
2: 2
3: 34
4: 436
Right 1103897906 12:124286130-124286152 CCTTTTCCCCACCAGGCTCTCGG 0: 1
1: 0
2: 3
3: 51
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103897899 Original CRISPR CTCTGCAAAGAGCCTGAGAA AGG (reversed) Intronic
901417045 1:9124406-9124428 CCCTGCAGAGAGCCTATGAATGG + Intronic
901673648 1:10870116-10870138 CTCAGCACAGAGCAGGAGAATGG - Intergenic
902804788 1:18854324-18854346 CTCCCCAGAGAGCCTGAGAATGG + Exonic
902954878 1:19918760-19918782 CTGTGCACAGGCCCTGAGAAGGG + Intergenic
904922059 1:34015551-34015573 ATCTGCAGAGTGCCTGGGAAGGG - Intronic
904925351 1:34043248-34043270 ATCTGCAAAGGCCCTGAGATGGG - Intronic
905415169 1:37799089-37799111 CTCTGCAAAGATCCGGAGGCAGG + Intronic
905677662 1:39839601-39839623 AGCAGCAAAGAGCCTGGGAAAGG - Intergenic
905684479 1:39898975-39898997 ATATGCAAAGAAGCTGAGAACGG - Intronic
906560981 1:46756658-46756680 CCCTGCAGAGAGCCTATGAATGG + Intergenic
906789068 1:48642870-48642892 ACCTGCACCGAGCCTGAGAATGG + Intronic
906831002 1:49031937-49031959 CTCTTCAACTAGTCTGAGAAAGG + Intronic
906898133 1:49802125-49802147 CCCTGCAGAGAGCCTATGAATGG + Intronic
907174336 1:52504290-52504312 CTGTGAAAGAAGCCTGAGAAGGG - Intronic
909049506 1:70751746-70751768 CCCTGCAGAGAGCCTATGAACGG + Intergenic
909078830 1:71085225-71085247 TTCAGCAAAGAGACAGAGAAAGG - Intergenic
910599722 1:89018249-89018271 CCCTGCAGAGAGCCTATGAATGG + Intronic
910831544 1:91466556-91466578 CCCTGCAGAGAGCCTATGAATGG + Intergenic
911038963 1:93577533-93577555 CTTTGCAAAGTCCTTGAGAAAGG - Intronic
911052451 1:93682044-93682066 CTCTGGAGAGAGCTTCAGAAAGG - Intronic
911317331 1:96370913-96370935 ATCTGCAAAAAGCCTGGGAGTGG + Intergenic
911755809 1:101555630-101555652 TCCTGCAGAGAGCCTGTGAATGG + Intergenic
911768713 1:101711711-101711733 ATGTGCAAAGGTCCTGAGAAAGG - Intergenic
912653608 1:111464690-111464712 TTGTGCAAAGCGCCTGAGATAGG + Intergenic
913077152 1:115350316-115350338 GTTTGCAAAAAGCCAGAGAAGGG + Intergenic
913537488 1:119786949-119786971 CCCTGCAGAGAGCCTATGAATGG - Intergenic
913956474 1:143301997-143302019 CTCTGCAGATGGCCTGAGATGGG + Intergenic
913980967 1:143513670-143513692 CTCTGCAGATGGCCTGAGATGGG - Intergenic
914075331 1:144340098-144340120 CTCTGCAGATGGCCTGAGATGGG - Intergenic
914103847 1:144626398-144626420 CTCTGCAGATGGCCTGAGATGGG + Intergenic
916160831 1:161912074-161912096 CACTGCATAGTGCCTGACAACGG + Intronic
916174820 1:162029360-162029382 CTCTGCAGCGAGCCAGGGAAAGG - Intergenic
916929842 1:169565076-169565098 ATCTGCAAAGACCCTGAGGTAGG - Intronic
916957719 1:169856784-169856806 GGCTGCAAAGAGCTTGAAAAGGG - Intronic
916980799 1:170134907-170134929 CTCTTAAAAGAACCTGACAAGGG - Intergenic
917394369 1:174576459-174576481 CCCTGCAGAGAGCCTATGAATGG - Intronic
918255606 1:182743637-182743659 CAATGCAAAGACCCTGAGACAGG - Intergenic
919232213 1:194788697-194788719 GTCTTCAAAGTGCCTGAAAAGGG - Intergenic
919663200 1:200268252-200268274 CTCTGCAGAGGCCCTGAGATGGG - Intergenic
920062486 1:203237138-203237160 CTGTGCCAAGACCCTGAGATTGG - Intronic
920121423 1:203661575-203661597 CTTTTCAAAGAGCAGGAGAAAGG - Intronic
920645494 1:207800624-207800646 CTGTGCAAAAAGCCTGATCAAGG + Intergenic
920854244 1:209650617-209650639 CTCTGGAACCAGCTTGAGAAAGG + Intronic
921671761 1:217933025-217933047 CTCAGCATGGAGACTGAGAATGG + Intergenic
921805476 1:219449232-219449254 CTCTGAAAAGAAGCAGAGAATGG + Intergenic
921975413 1:221197272-221197294 CCCTGCAGAGAGCCTATGAATGG - Intergenic
922189431 1:223304244-223304266 CCCTGCAGAGAGCCTGTGAACGG - Intronic
924606144 1:245537233-245537255 CTGTGCAAAGGCCCTGAGATGGG + Intronic
924950936 1:248882756-248882778 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1063548938 10:7010204-7010226 ATGTGCAAAGACCCTGAGACAGG + Intergenic
1063668107 10:8078173-8078195 CTTTGCAAAGAGCCCAGGAAGGG + Intergenic
1064739153 10:18414297-18414319 CTCAGAAAAGAGCCTGTGAGAGG - Intronic
1066592314 10:37008677-37008699 CCCTGCAGAGAGCCTATGAACGG - Intergenic
1066781699 10:38955264-38955286 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1067042755 10:42963771-42963793 CTCTGCAAAGAGCCTTCAATGGG - Intergenic
1067316885 10:45176093-45176115 CCCTGCAGAGAGCCTATGAACGG - Intergenic
1068326908 10:55502322-55502344 CTGGGCAAAGAGGATGAGAAGGG - Intronic
1068491931 10:57735260-57735282 CTCTACAGGGAGCCTGAGGAAGG - Intergenic
1069120082 10:64558643-64558665 CTATGCAAAAGTCCTGAGAAAGG - Intergenic
1069840815 10:71338158-71338180 CCCTGCAAAGAGCCCCAGAGTGG - Intronic
1070395872 10:76010831-76010853 CTCTGCAGAGGGCCTGAGACAGG - Intronic
1070948210 10:80410234-80410256 CTCTGCACAGAACCTCAGGATGG - Intronic
1071003978 10:80860927-80860949 CTCTTGGCAGAGCCTGAGAAAGG + Intergenic
1072175136 10:92912990-92913012 CCCTGCAGAGAGCCTATGAATGG - Intronic
1072386895 10:94939890-94939912 CCCTGCAGAGAGCCTATGAATGG - Intronic
1073062500 10:100741046-100741068 CTCCTCAAAGGGCCTGTGAAGGG + Intronic
1073686244 10:105757223-105757245 CTCTACAAAGAGCCTTGGCAGGG - Intergenic
1076193396 10:128498521-128498543 CTCTGCAAAGACCCAGCAAAGGG + Intergenic
1076328020 10:129643538-129643560 CGCTGGAAAGAGCCTGAAGAAGG - Intronic
1076698543 10:132258432-132258454 CTTTGCAAAGAGCCCTGGAAGGG - Intronic
1076834787 10:133015592-133015614 CGCTGCAGAGACCCTGCGAAAGG + Intergenic
1077116827 11:888988-889010 CTCAGCACAAAGCCTGAGCAGGG - Intronic
1077728681 11:4704496-4704518 CTTTGCATAGAGCCAGAGTAAGG - Intergenic
1078184811 11:9042565-9042587 CTCTTGAGAGAGCATGAGAAAGG - Intronic
1078267384 11:9765482-9765504 CTCTGCCATGACCCTGAGCAGGG - Intergenic
1079069394 11:17329700-17329722 ACCTGCAAAGACACTGAGAAGGG - Intronic
1079911572 11:26316821-26316843 CCCTGCAGAGAGCCTATGAACGG - Intronic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1080958968 11:37135578-37135600 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1081084661 11:38785114-38785136 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1084345982 11:68549206-68549228 TTCTGCAAAGCTTCTGAGAAAGG - Intronic
1086118609 11:83282631-83282653 CTAGGCAAAGGCCCTGAGAAGGG - Intronic
1086775584 11:90828520-90828542 CACTGCAACTAGCTTGAGAAAGG + Intergenic
1086930181 11:92684079-92684101 CTGTGCATTGAGCCTGAGAGTGG - Intronic
1086957085 11:92944297-92944319 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1086957640 11:92949963-92949985 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1087013977 11:93538590-93538612 CTCTGCTAACAGCTAGAGAAAGG - Intronic
1088351302 11:108891343-108891365 CCCTGCACAGCGCCTGTGAAGGG - Intronic
1088878134 11:113952587-113952609 CTCTTCAAAGAGGATGAGCAGGG - Intergenic
1089370441 11:117951863-117951885 CCCTGCACAGAGCCTGCGAGTGG + Intergenic
1089635921 11:119811758-119811780 CTGTGCACAGGGCCTGAGAAGGG - Intergenic
1089636100 11:119812915-119812937 CTCTTTAAAGAGCCAAAGAAAGG + Intergenic
1089874766 11:121709398-121709420 TTCAGCAAAGAGCTTTAGAAAGG + Intergenic
1090086003 11:123651758-123651780 GTTTGCAAAGAAACTGAGAATGG + Intronic
1091146761 11:133286872-133286894 CTCTGCACAGTGCCTCAGATAGG - Intronic
1091501608 12:1023106-1023128 TTCTACATAGAGCTTGAGAATGG + Intronic
1091996702 12:4999525-4999547 CCTTTCAAAAAGCCTGAGAATGG - Intergenic
1094494748 12:30982327-30982349 TTCAGCAATGAGTCTGAGAAGGG + Intronic
1094808185 12:34110358-34110380 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1095648273 12:44576057-44576079 ATGTGCAAAGAGCCTGTGATGGG - Intronic
1096672025 12:53205780-53205802 CTCTGCACAGAGTGTGGGAAAGG + Intronic
1096934455 12:55256131-55256153 CCCTGCAGAGAGCCTACGAACGG + Intergenic
1098094772 12:66943281-66943303 CTCTCCAGAGAGCCAGAGATGGG + Intergenic
1098747605 12:74260120-74260142 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1099810767 12:87579508-87579530 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1100731673 12:97477720-97477742 CTCTGCAATGAGGAAGAGAAAGG + Intergenic
1102843598 12:116153288-116153310 CTTGGCAAATAGACTGAGAAAGG - Intronic
1102928655 12:116845865-116845887 CTGTGCAAAGCTCCTGAGATAGG - Intronic
1103260460 12:119584037-119584059 CTCCACAAAGAGCATGAGCAAGG + Intergenic
1103448648 12:121012216-121012238 ATCTGCAAAGGCCCTGAGACTGG + Intronic
1103897899 12:124286101-124286123 CTCTGCAAAGAGCCTGAGAAAGG - Intronic
1104011292 12:124932140-124932162 CACTGCAGAGAGGCTTAGAATGG - Intergenic
1104089053 12:125499469-125499491 CCCTGCAGAGAGCCTATGAATGG + Intronic
1104134141 12:125921483-125921505 CTCTGCACAGAGGATGAGACAGG - Intergenic
1104148512 12:126058771-126058793 CTCTGCATTGAGGCGGAGAAAGG + Intergenic
1105708662 13:22984295-22984317 CCCTGCAGAGAGCCTGTGAATGG - Intergenic
1107826572 13:44333735-44333757 TTCTGTAAAGAGACTGTGAAAGG - Intergenic
1108251950 13:48576539-48576561 CACAGCAAATAACCTGAGAAAGG - Intergenic
1109105184 13:58241247-58241269 CCCTGCAGAGAGCCTATGAACGG + Intergenic
1110454193 13:75671763-75671785 CTTGGCAAAGCACCTGAGAAGGG - Intronic
1110475861 13:75912539-75912561 CTAGGCAAAGAGCTTCAGAAAGG + Intergenic
1112028113 13:95431026-95431048 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1112456644 13:99569216-99569238 CCCTGCAGAGAGCCTATGAACGG - Intergenic
1112619244 13:101037720-101037742 CTCTGCAAGGAAGCTGGGAAAGG - Intergenic
1112716851 13:102196848-102196870 CTCTGAAAAGGGCCTGACAAAGG - Intronic
1113581886 13:111435779-111435801 CTCAGGAAAGAGCCTGAGTTTGG - Intergenic
1113976737 13:114233297-114233319 TTGAGCACAGAGCCTGAGAATGG + Intergenic
1114599738 14:23944777-23944799 CTCTGCAGAGAGCCTATGAATGG - Intergenic
1115452756 14:33566923-33566945 CTCTGCAAAGAGGCTGCCACTGG - Intronic
1118906891 14:70029786-70029808 CTCAGCAAACAACCTGAAAATGG - Intronic
1118961713 14:70539307-70539329 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1120749893 14:88187589-88187611 TTCTGCACAGACCCTGAGACCGG + Intronic
1121420512 14:93809975-93809997 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1121758429 14:96422624-96422646 CCCTGCAGAGAGCCTATGAATGG - Intronic
1123065909 14:105619082-105619104 CTCAGCAGACACCCTGAGAAAGG - Intergenic
1123070066 14:105638328-105638350 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123074658 14:105661990-105662012 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123089305 14:105735115-105735137 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123095092 14:105763272-105763294 CTCAGCAGATACCCTGAGAAAGG - Intergenic
1123208071 14:106732979-106733001 CCCTGCAGAGAGCCTGTGAATGG + Intergenic
1123223329 14:106876787-106876809 GTCTTCAAAATGCCTGAGAAGGG - Intergenic
1202938889 14_KI270725v1_random:123673-123695 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1123394249 15:19912604-19912626 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1124985439 15:34606005-34606027 CTCTACTAAGACCCAGAGAAAGG + Intergenic
1125530498 15:40410180-40410202 GTCTGCAAAAGGCCTGAGGAAGG - Intronic
1126215577 15:46150522-46150544 ATCTGAATAGTGCCTGAGAAAGG - Intergenic
1126867745 15:52954702-52954724 CTCTGGAAAGAGACTGGGGAAGG - Intergenic
1127251700 15:57245416-57245438 CTGTGCAAAGAGGGTGAGTAGGG - Intronic
1127288053 15:57547588-57547610 CTGTGCAAAGAGGCTGTGATTGG - Exonic
1127609527 15:60623194-60623216 CTCTGCAAAGTCCCTGAAAGAGG + Intronic
1128095953 15:64955707-64955729 TTCTGCATTGAGCCTGAGACTGG + Intronic
1128666730 15:69543732-69543754 CTCTGCATAAAGCCCTAGAAGGG + Intergenic
1128865319 15:71110726-71110748 CTTTGCAAAGACCCTGAGGAAGG - Exonic
1128886537 15:71293424-71293446 CTCTTCAGAGAAACTGAGAAGGG - Intronic
1128910407 15:71508538-71508560 CTCTGCAAAGGGCCTGCGGCAGG + Intronic
1129567667 15:76640863-76640885 CCCTGCAGAGAGCCTATGAATGG + Intronic
1130815338 15:87426103-87426125 TTCTGAAATGAGCATGAGAATGG - Intergenic
1131268346 15:90932017-90932039 CTCTGCCAGGAGCCTGGGATGGG - Intronic
1133897242 16:9941579-9941601 TTCTGCAGAGAGGCTGCGAATGG - Intronic
1135323166 16:21510203-21510225 CTCTGCAGAAGGCCTGAGCAGGG - Intergenic
1135630882 16:24034914-24034936 CCCTGGAAAGAGTCTGAGACGGG - Intronic
1135980371 16:27142418-27142440 CTCTGGTTAGAGCCAGAGAAAGG - Intergenic
1136103334 16:28011215-28011237 CTCAGCAAAGAGCCTGGGCCTGG + Intronic
1136334650 16:29603390-29603412 CTCTGCAGAAGGCCTGAGCAGGG - Intergenic
1136700269 16:32130493-32130515 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1136767383 16:32796971-32796993 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1136800765 16:33073730-33073752 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1136863641 16:33722137-33722159 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1139517523 16:67460574-67460596 GTTTGCAGAGAGCCTGCGAAGGG - Intronic
1140072454 16:71663030-71663052 CACTGCACAGAGCCTGGGGATGG - Intronic
1140094790 16:71865654-71865676 CACTGCAAAGTGCCTGAGGTTGG - Intronic
1140144763 16:72295824-72295846 GTGTGCAAAGGCCCTGAGAAAGG - Intergenic
1140405086 16:74704260-74704282 CTCTGCAAAGACCCTTTTAAGGG + Intergenic
1140653751 16:77118063-77118085 CTCTGCAAAGAAACTCTGAAAGG + Intergenic
1140962895 16:79933897-79933919 CTCTGCAAGGAGCCTGGTGAGGG + Intergenic
1142035363 16:87859226-87859248 CTCTGCAGAAGGCCTGAGCAGGG - Intronic
1203069776 16_KI270728v1_random:1058993-1059015 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1142543715 17:682623-682645 CTTGGAAAAGAGCCTGAGAGTGG - Intronic
1143304601 17:5936251-5936273 GCCTGCATAGAGCCTGTGAATGG + Intronic
1145297189 17:21601114-21601136 CTCTGCTAAAAGCCTTACAATGG + Intergenic
1145324476 17:21791382-21791404 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1145326128 17:21827427-21827449 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1145366761 17:22271786-22271808 CTCTGCTAAAAGCCTTACAAAGG - Intergenic
1145689182 17:26716911-26716933 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1145710957 17:26975702-26975724 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1146728655 17:35175531-35175553 ATCTGCAAAGACACTGAGGATGG + Intronic
1148990099 17:51658567-51658589 CAATGCAAAGAGCCTGAGATAGG + Intronic
1150319690 17:64202225-64202247 TTCTGGAAAGAGCCTTAGATAGG - Intronic
1150987051 17:70210588-70210610 CATGGCCAAGAGCCTGAGAAGGG - Intergenic
1150988509 17:70227559-70227581 CTCAGCAAGGAGAATGAGAAGGG + Intergenic
1203182372 17_KI270729v1_random:72558-72580 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1154478919 18:14797328-14797350 CCCTGCAGAGAACCTGTGAATGG - Intronic
1154479070 18:14798765-14798787 CCCTGCAGAGAGCCTGTGAATGG - Intronic
1154479865 18:14809654-14809676 CCCTGCAGAGAGCCTGTGAATGG - Intronic
1154516873 18:15179755-15179777 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1155103029 18:22632565-22632587 CTTGGCAAAGTGTCTGAGAATGG + Intergenic
1155499641 18:26473801-26473823 CCCTGGAATGAGCCTGAGGAAGG - Intronic
1156883222 18:42105037-42105059 CTATGCAAAAAGCCAGGGAAGGG - Intergenic
1157976112 18:52328828-52328850 TTGTGCAAAGACCCTGAGATGGG + Intergenic
1158970772 18:62664298-62664320 CTCTGCAAAATGCTTGAGCAAGG - Intergenic
1160251929 18:77210429-77210451 CCCTGCTAAGAGCCTGGGGATGG + Intergenic
1161893637 19:7063426-7063448 CCCTGCAGAGAGCCACAGAAGGG - Intergenic
1162153636 19:8662454-8662476 CTGTGCAAAGACCCTGAGGCAGG + Intergenic
1162288938 19:9764015-9764037 CCCTGCACAGAGCCTATGAATGG + Intronic
1164082951 19:21876301-21876323 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1164190931 19:22916418-22916440 CTGTGCATAGAGAGTGAGAAGGG - Intergenic
1165096323 19:33411748-33411770 CACTGCAAAGAGCCGGGGGAGGG + Exonic
1165241705 19:34473836-34473858 CTCCCCATATAGCCTGAGAAAGG - Intergenic
1165566753 19:36736175-36736197 CTCTGCAGAGAGCCTATAAACGG + Intronic
1165829348 19:38722800-38722822 CTTTGCCCAGGGCCTGAGAAGGG - Intronic
1166443222 19:42834348-42834370 CCCTGCAGAGAGCCTATGAACGG - Intronic
1166451011 19:42900751-42900773 CCCTGCAGAGAGCCTATGAATGG - Intronic
1166462918 19:43005096-43005118 CCCTGCAGAGAGCCTATGAACGG - Intronic
1166480187 19:43165074-43165096 CCCTGCAGAGAGCCTATGAACGG - Intronic
1166490017 19:43250621-43250643 CCCTGCAGAGAGCCTATGAACGG - Intronic
1167255223 19:48423606-48423628 GTGTGCAAAGGGCCTGAGGAAGG + Intronic
1167639127 19:50670697-50670719 CTCTGCAAAGGTCCTGAGGTCGG - Intronic
1167678968 19:50907694-50907716 CTCTACAAAGAGGCTGGGCAGGG - Intronic
1168697904 19:58415861-58415883 CTCTGCACAGATACAGAGAAGGG - Intronic
1202668558 1_KI270709v1_random:24480-24502 CTCTGCAGATGGCCTGAGATGGG - Intergenic
925530057 2:4849471-4849493 CTCTGTAAAGAGCCTAAGAATGG + Intergenic
925738254 2:6983003-6983025 ATCTGCAGAGAGCCTAGGAAAGG + Intronic
927646530 2:24880541-24880563 TTCTGCTAAGAGCTTGACAAGGG - Intronic
928106800 2:28475748-28475770 CTGTGCAAAGAGCCTAGGAGAGG + Intronic
931464426 2:62474104-62474126 GTCCTCAAAGAGCCTAAGAAGGG + Intergenic
934252746 2:90375416-90375438 CTCTGCAGATGGCCTGAGATGGG + Intergenic
934256694 2:91427531-91427553 CTCTGCAGATGGCCTGAGATGGG - Intergenic
935248914 2:101244372-101244394 CCCTGCAGAGAGCCTATGAACGG + Intronic
935639839 2:105280314-105280336 CCCAGCAAAGAGCCTCAGTAAGG + Intronic
936758028 2:115737904-115737926 CTCTGCATAGAGGTAGAGAAAGG - Intronic
936800586 2:116260420-116260442 CCCTGCAGAGAGCCTATGAATGG + Intergenic
936802902 2:116288320-116288342 CCCTGCAGAGAGCCTATGAATGG + Intergenic
937259419 2:120576144-120576166 CTCTGCAGAGACACAGAGAAGGG + Intergenic
937309692 2:120894493-120894515 CTCTAGAAAGAGAGTGAGAAGGG - Intronic
937710013 2:124969680-124969702 TTCCCCAAGGAGCCTGAGAATGG - Intergenic
938517197 2:132024725-132024747 CTCTGCAGATGGCCTGAGATGGG + Intergenic
938994639 2:136665119-136665141 CTCTGCAGGGAATCTGAGAACGG + Intergenic
939268998 2:139913348-139913370 CCCTGCAGAGAGCCTATGAATGG - Intergenic
941894603 2:170616389-170616411 CCCTGCAGAGAGCCTATGAATGG - Intronic
941894887 2:170619282-170619304 CCCTGCAGAGAGCCTATGAATGG - Intronic
941936993 2:170989979-170990001 ATTTGCAGAGAGCCAGAGAATGG - Intergenic
943232713 2:185275930-185275952 CTCTGCAGAGAGCCTATGAATGG + Intergenic
944243934 2:197512766-197512788 GTTTGCAAAGAGCATGTGAAAGG + Intronic
944742730 2:202628131-202628153 AGCTGCATAGAGCCTGAGAAAGG - Intergenic
945155121 2:206830096-206830118 GTCTGCAAAGAGGCTGAGAAGGG + Intergenic
945325995 2:208482921-208482943 CCCTGCAGAGAGCCTATGAATGG - Intronic
946071760 2:217040102-217040124 CTCAGCAGAGAGTCTAAGAAAGG - Intergenic
946726794 2:222669745-222669767 CTCTGCAGAGTGCCTGACATAGG + Intergenic
947355328 2:229288874-229288896 CCCTGCAGAGAGCCTATGAATGG + Intergenic
947614806 2:231548964-231548986 CTGGGCAAAGAGCCAGGGAAAGG - Intergenic
948503520 2:238411680-238411702 ACCAGCAAAGAGCCTGAGAACGG + Intergenic
948911800 2:241008638-241008660 CTTTGCAAAGAACAAGAGAATGG - Intronic
1169153872 20:3312667-3312689 CTCTTCTTAGAGCCTTAGAAGGG - Intronic
1169239029 20:3958968-3958990 CCCTTAAAAGAGACTGAGAAGGG - Intronic
1170172284 20:13428688-13428710 CTCTGCAAATAGCCTTGTAAAGG - Intronic
1170831857 20:19849758-19849780 GTCTGCCAAGAGCCAGATAATGG + Intergenic
1170956648 20:20986379-20986401 CTCTGCACAAAGGCTGAGGAAGG - Intergenic
1171241040 20:23567097-23567119 CTCTGGAAAGACCCTGTGCAAGG - Intronic
1172570698 20:35968091-35968113 CTCAGCCAAAAGGCTGAGAAGGG - Intronic
1172873004 20:38147423-38147445 CTGTGCAAAGGCCCTGAGAAGGG - Intronic
1173576043 20:44113502-44113524 CTCTGCAAAGAGACAGCAAAAGG + Exonic
1174116560 20:48230444-48230466 CTGTGCAAACAGCCTGATGATGG - Intergenic
1174281397 20:49442086-49442108 CTCTGGAAAGACACTGACAAAGG + Intronic
1175663262 20:60836038-60836060 CTCTGCTGAGAGCGTGAGATGGG - Intergenic
1176584366 21:8563856-8563878 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1176800675 21:13426651-13426673 CCCTGCAGAGAGCCTGTGAATGG + Intergenic
1177666141 21:24162114-24162136 CTCTGAAAAGAGTCTTAAAATGG - Intergenic
1180267178 22:10540760-10540782 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1181537442 22:23553879-23553901 CTCTCCAGAGAGCCTGACCAGGG + Intergenic
1183173280 22:36203756-36203778 CCCTGCAGAGAGCCTATGAATGG - Intronic
1183331209 22:37222638-37222660 CTCTGCAAATTGGCTGAGGATGG - Intergenic
1184127556 22:42499007-42499029 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1203288253 22_KI270735v1_random:4988-5010 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1203326082 22_KI270738v1_random:20893-20915 CTCTGCAGATGGCCTGAGATGGG + Intergenic
949663362 3:6307641-6307663 CCCTGCAGAGAGCCTATGAATGG - Intergenic
950236611 3:11327055-11327077 CTCTGCAAAGATCTTGAGCAGGG - Intronic
950527964 3:13535733-13535755 CTCTGCAGCAAGCCCGAGAATGG - Intergenic
950779515 3:15379348-15379370 CTTTGCGAAGTACCTGAGAATGG - Intergenic
951678060 3:25264470-25264492 ATCTTCAAGTAGCCTGAGAAAGG + Intronic
952608033 3:35173227-35173249 CCCTGCAGAGAGCCTATGAATGG + Intergenic
954321161 3:49832869-49832891 CTCTGAAAAGTTCCTGAGGAAGG - Intronic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
955034095 3:55249506-55249528 CCCTGCAGAGAGCCTATGAATGG - Intergenic
956905642 3:73762469-73762491 GTCTGCAAAGAACTGGAGAATGG - Intergenic
957171065 3:76737022-76737044 CTCTGCAAAGTTATTGAGAATGG + Intronic
957979107 3:87485616-87485638 CCCTGCAGAGAGCCTATGAATGG + Intergenic
958173943 3:89971565-89971587 CTCTTCATACAGCCTCAGAATGG - Intergenic
958481123 3:94647327-94647349 CCCTGCAGAGAGCCTATGAATGG + Intergenic
959439815 3:106361345-106361367 CCCTGCAGAGAGCCTCTGAACGG - Intergenic
959567088 3:107843465-107843487 GTCTACATACAGCCTGAGAATGG + Intergenic
960346040 3:116534621-116534643 CTCTTAAAAGAACCTGAGGAAGG - Intronic
961567952 3:127776874-127776896 CTATGCAAAGATGATGAGAAGGG + Intronic
962264400 3:133935057-133935079 CTCTGGAAAGAGCCAGTGGAGGG - Intronic
962526671 3:136243579-136243601 CTCTGAATGGAGTCTGAGAATGG + Intergenic
963681593 3:148384722-148384744 CTCTGCAAAGATCCTTTAAAAGG - Intergenic
964987783 3:162766034-162766056 CTCTGCCTACAGCCTGATAATGG + Intergenic
965192360 3:165548200-165548222 CCCTGCAGAGAGTCTAAGAATGG + Intergenic
965281502 3:166759819-166759841 TACTGCAAATACCCTGAGAAAGG - Intergenic
967091355 3:186137464-186137486 CTCAGGAAAGAGAATGAGAATGG + Intronic
968714119 4:2141793-2141815 CTCTCCAAGGAGCCTGAGAGGGG - Intronic
968765408 4:2465721-2465743 CTCTGTAAAGAGCCTATGCAGGG - Intronic
969985849 4:11209891-11209913 CTCTGCAAACAGCCAGAAACAGG - Intergenic
972090329 4:35273377-35273399 CCTTGCAGAGAGCCGGAGAAAGG - Intergenic
972484505 4:39528248-39528270 CTCTGCAAAGAGCGCCAGGAGGG - Intronic
973634573 4:52850162-52850184 CTCTGCAAGGTGCTTAAGAAAGG - Intergenic
973794448 4:54409723-54409745 CCCTGCAGAGAGCCTATGAATGG - Intergenic
974396151 4:61337500-61337522 CTCTGCAAGACCCCTGAGAAGGG - Intronic
975586434 4:75954737-75954759 CCCTGCAGAGAGCCTATGAACGG + Intronic
975811195 4:78171645-78171667 CTAGGCAAAGAACCTGAGGATGG - Intronic
975936935 4:79592653-79592675 CCCTGCAGAGAGCCTATGAATGG - Intergenic
976636513 4:87291738-87291760 CCCTGCAGAGAGCCTATGAATGG - Intergenic
977058011 4:92217897-92217919 CCCTGCAGAGAGCCTATGAATGG + Intergenic
977511557 4:97968891-97968913 CCCTGCAGAGAGCCTATGAACGG + Intronic
977554999 4:98479443-98479465 CCCTGCAGAGAGCCTATGAATGG + Intronic
977629968 4:99231756-99231778 CCCTGCAGAGAGCCTATGAATGG + Intergenic
978003056 4:103580411-103580433 GTTTTCAAATAGCCTGAGAATGG - Intergenic
978119889 4:105065714-105065736 CTCTGCACAGAGCTTGAGCTGGG - Intergenic
978281716 4:107024691-107024713 CTTTGCAAAGAGATGGAGAAAGG + Intronic
978544476 4:109856113-109856135 CCCTGCAGAGAGCCTATGAATGG - Intronic
978544837 4:109859770-109859792 CCCTGCAGAGAGCCTATGAATGG - Intronic
981159973 4:141486154-141486176 TCCTGCAAAGAGCCTTGGAAGGG - Intergenic
981420340 4:144542696-144542718 TCCTGCAGAGAGCCTGTGAACGG + Intergenic
981733118 4:147920858-147920880 CTCAGCAAAGATACAGAGAAAGG + Intronic
982846270 4:160256534-160256556 CCCTGCAGAGAGCCTATGAAGGG - Intergenic
983183978 4:164679897-164679919 CTGTGCAGTGAGCCTGGGAAAGG - Intergenic
986258168 5:6119174-6119196 CTCTGCATTCTGCCTGAGAAAGG + Intergenic
987041642 5:14068506-14068528 CTTTTCTAAGAACCTGAGAAGGG + Intergenic
987609187 5:20180106-20180128 CCCTGCAGAGAGCCTATGAATGG + Intronic
988769919 5:34422071-34422093 CCCTGCAGAGAGCCTATGAATGG - Intergenic
989210687 5:38856020-38856042 CTCTGCAAAGACCCTGAGGTTGG - Intronic
989482243 5:41945558-41945580 CCCTGCAGAGAGCCTATGAATGG + Intergenic
990598447 5:57333752-57333774 CTATGCAAAGGGACTGAGGAGGG + Intergenic
990753010 5:59038970-59038992 CTCTGCGAAGAGACAGGGAAAGG + Exonic
992818625 5:80470996-80471018 CCCTGCAGAGAGCCTATGAATGG + Intronic
993806083 5:92411566-92411588 CTTTTCAAAGAGGCTGAGAAAGG + Intergenic
993856898 5:93087545-93087567 CACTCCAAAGAGGCTGGGAATGG + Intergenic
995076250 5:107987593-107987615 ATATGCAAAGAGCATGAGCAGGG - Intronic
995631950 5:114143658-114143680 CACTGCAAAAAGCCTATGAATGG - Intergenic
995632593 5:114150059-114150081 CCCTGCAGAGAGCCTATGAACGG - Intergenic
995647055 5:114324826-114324848 TTCTGCTAACAGCCTGTGAAAGG - Intergenic
996201569 5:120682188-120682210 CTCAGAAAAGAGCCTGATAAAGG - Intronic
998508153 5:142688875-142688897 CTCTCCTAAGAGCTTTAGAAGGG + Intronic
999451240 5:151679713-151679735 CTCTGGAAAGACTCTGAGGATGG + Intronic
999530790 5:152461459-152461481 ATCTGCAAAGAGCCTTTGTAGGG - Intergenic
999682565 5:154073716-154073738 CCCTGCAGAGAGCCTAAGAATGG - Intronic
999876500 5:155812342-155812364 CTCTGCGGAGAGCCTATGAATGG - Intergenic
1000137249 5:158364796-158364818 GACTGGAAAGAGCCTGATAATGG - Intergenic
1000708692 5:164544221-164544243 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1007114791 6:39335820-39335842 CTCTGCTGAGAGCTTGAGAGAGG - Exonic
1007245677 6:40460460-40460482 CTCTGAAATGAGCATTAGAATGG + Intronic
1008272754 6:49508675-49508697 CCCTGCAGAGAGCCTATGAAGGG - Intronic
1008276856 6:49551915-49551937 CTCTGCAAAGAGGGTGGGAGTGG + Exonic
1008473038 6:51905488-51905510 TTGTGCAAAGACCCTGAGGAAGG + Intronic
1008493713 6:52111873-52111895 AAGTGCAAAGACCCTGAGAAAGG + Intergenic
1009651607 6:66483088-66483110 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1010222444 6:73459540-73459562 CCCTGCAGAGAGCCTATGAACGG + Intergenic
1010902105 6:81440888-81440910 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1011914085 6:92480481-92480503 CTCTGAAAATATCCTTAGAAGGG - Intergenic
1014405136 6:121042231-121042253 CCCTGCAGAGAGCCTATGAACGG + Intergenic
1015512569 6:134052833-134052855 CTTTGAAAAGAGGCAGAGAAAGG + Intergenic
1015863365 6:137703234-137703256 CCATGCAAAGAGCCTGAGGAAGG - Intergenic
1017100001 6:150840147-150840169 CTCTGCACAGAGCCTGGCAGAGG - Exonic
1017801605 6:157901110-157901132 CCCTGCAGAGAGCCTATGAATGG - Intronic
1018706568 6:166467858-166467880 CCCTGGAAAGTGCCTGAGACTGG + Intronic
1018764030 6:166915813-166915835 CCCTGCAGAGAGCCTATGAATGG - Intronic
1019693200 7:2429091-2429113 CCCTGCAGAGAGCCTATGAACGG - Intronic
1021210969 7:17851995-17852017 CACAGCAAAAAGACTGAGAAAGG + Intronic
1022524191 7:31027022-31027044 CCCTGCAGAGAGCCTGGGCAGGG + Intergenic
1024631950 7:51256351-51256373 CTTTCCAAAGAGCCTGAGAGTGG - Intronic
1024687226 7:51759234-51759256 CTCTGCCAAGACCCTCAGAGTGG - Intergenic
1025306288 7:57861630-57861652 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1025319069 7:58072009-58072031 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025477479 7:60942489-60942511 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025554649 7:62291175-62291197 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1025560132 7:62362101-62362123 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025562991 7:62393672-62393694 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1025735682 7:64144669-64144691 CCCTGCAGAGAGCCTGTGAATGG - Intronic
1025770840 7:64504686-64504708 CTCTGCAAAGACACAGAAAAAGG + Intergenic
1025877314 7:65494965-65494987 CTCTGCAGATGGCCTGAGATGGG + Intergenic
1026065523 7:67068723-67068745 CTCAGAAAAGAGACTGAGACTGG - Intronic
1026842650 7:73679040-73679062 CTGTGCAAACAGGCTGAGAGAGG - Intergenic
1026925464 7:74189375-74189397 CTCTGCAGATGGCCTGAGAAAGG + Intronic
1027491462 7:78832811-78832833 CCCTGCAGAGAGCCTATGAATGG + Intronic
1028180422 7:87714892-87714914 CCCTGCAGAGAGCCTATGAATGG - Intronic
1028181813 7:87733252-87733274 CCCTGCAGAGAGCCTATGAATGG - Intronic
1028327570 7:89545829-89545851 CCCTGTAGAGAGCCTGTGAATGG - Intergenic
1028480729 7:91301709-91301731 CAATGCAAAGGGCCTGAGAGGGG - Intergenic
1028916117 7:96261062-96261084 AGGTGCAAAGAGCCTGAGAGGGG - Intronic
1029043065 7:97597890-97597912 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1029626866 7:101725335-101725357 CTATGCAAAAGGCATGAGAAGGG + Intergenic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1030252767 7:107465792-107465814 TTATATAAAGAGCCTGAGAATGG - Intronic
1031069969 7:117151381-117151403 CTGTGCAAAGGTCCTAAGAAAGG - Intronic
1031947897 7:127860223-127860245 CTCTACCAAGAACCTGAGAAGGG - Intronic
1032264747 7:130363076-130363098 TTCTGCAAAGAGGCTCTGAAGGG - Intronic
1032513312 7:132489108-132489130 CTCAGCACAGAGGCAGAGAAAGG + Intronic
1032887156 7:136153061-136153083 CTCAGCAAGGAGCCTGTGAAGGG - Intergenic
1032974384 7:137205710-137205732 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1033502133 7:141962499-141962521 CCCTGCAGAGAGCCTATGAATGG + Intronic
1035232551 7:157474959-157474981 TTCTGGAAGGAGACTGAGAAGGG - Intergenic
1036115767 8:5959300-5959322 TTCTGTAAAGAGGCAGAGAACGG - Intergenic
1036693525 8:10959842-10959864 CTCTGGGAGGAGTCTGAGAATGG + Intronic
1036845611 8:12168001-12168023 CTTTCCAAAGAGACAGAGAATGG + Intergenic
1036866977 8:12410320-12410342 CTTTCCAAAGAGACAGAGAATGG + Intergenic
1036938925 8:13032483-13032505 CTATGTAACCAGCCTGAGAAAGG + Intergenic
1037947968 8:23000978-23001000 CTCTGCAAAGAGTGTGTGTAGGG + Intronic
1040277183 8:46019746-46019768 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1041066754 8:54090023-54090045 CCCTGCAAAGAGCCTATGAATGG + Intronic
1041296291 8:56360708-56360730 CCCTGCAGAGAGCCTATGAACGG + Intergenic
1041753749 8:61290016-61290038 CTCTTAAAAGTCCCTGAGAAAGG + Intronic
1042672134 8:71275954-71275976 TTCTCCAAAGAGACTGATAAGGG - Intronic
1045376847 8:101582712-101582734 CTCTGCAAAGACGCTGAGGTGGG - Intronic
1045494064 8:102693517-102693539 CTCTGAATAGAGACTGAGAGGGG + Intergenic
1045535418 8:103022712-103022734 ATCTGAAAAGAGACTGAAAAGGG + Intronic
1046232485 8:111375245-111375267 CTCTGGCAAGAGACTGGGAAAGG - Intergenic
1048432005 8:134379208-134379230 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1048800525 8:138190029-138190051 GTCTGCAAAGAGTCAGAGACTGG - Intronic
1049547160 8:143238140-143238162 CCTTGCAATGATCCTGAGAAAGG + Intergenic
1049605727 8:143528395-143528417 TGCTGCACAGAGCCTGAGGATGG - Intronic
1049813080 8:144584996-144585018 CTCTGCAAGGAGCCTGTGGATGG + Intronic
1050198229 9:3111052-3111074 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1050637364 9:7626466-7626488 CAAAGCAAAGAGCCAGAGAAGGG + Intergenic
1052860709 9:33436271-33436293 CACTGAAGAGAGCCTGAGGAGGG + Intergenic
1054922447 9:70555605-70555627 TTCTGGAAAGAACCTAAGAAAGG - Intronic
1055397793 9:75892196-75892218 CTCTGCCAAAAGCCCGAGAGCGG - Intronic
1056717058 9:89040386-89040408 ATGTGAAAAGAGCCTTAGAAAGG - Intronic
1058120353 9:101131674-101131696 CTTTCCACAGAGTCTGAGAAAGG + Intronic
1058231590 9:102433490-102433512 CTCTGCAAATAGGATGGGAATGG - Intergenic
1058382689 9:104395225-104395247 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1058407735 9:104695878-104695900 CACTTCAAAGTGACTGAGAAAGG - Intergenic
1059206271 9:112469270-112469292 CTCTGCAAAGAACCTGTGTGGGG + Intronic
1059465182 9:114464672-114464694 CTTTGCAATAACCCTGAGAAAGG + Intronic
1059499830 9:114742555-114742577 ATCTGCAAAGAGACTTGGAAAGG + Intergenic
1059832836 9:118117550-118117572 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1060098105 9:120811997-120812019 ATCTTGAAAGAGCCTGAGAGGGG - Intergenic
1061201601 9:129141398-129141420 CTCTGCAAAGAGGCTGAATCTGG - Intronic
1061244549 9:129394715-129394737 CTCTCCAGAGAGCCTGACCAGGG - Intergenic
1061994076 9:134175296-134175318 CTCTGCAAAGGCCCTGAGGCTGG + Intergenic
1062272018 9:135714138-135714160 CTCGGCAAAGACCCTGGGGACGG + Intronic
1062393829 9:136344722-136344744 CTGTGCAAAGGGCCTGAGGCAGG + Intronic
1062674382 9:137731868-137731890 CTCTGCACAGAGCCAGAGCCTGG - Intronic
1203614270 Un_KI270749v1:41386-41408 CTCTGCAGATGGCCTGAGATGGG - Intergenic
1186108326 X:6228829-6228851 CTGTGCTAAGAGACAGAGAAGGG + Exonic
1186120503 X:6355948-6355970 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1186140596 X:6567819-6567841 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1186171432 X:6881439-6881461 CTCTGCAAACACCCTGAGCTTGG - Intergenic
1186274201 X:7922252-7922274 CCTTGCAAAGGGCCTGAGAGTGG - Intronic
1186296416 X:8153933-8153955 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1186337262 X:8603786-8603808 CTTTGCAAAGAGTCAGGGAATGG + Intronic
1186943711 X:14541226-14541248 CTCTGCATAGACCTTGAGAAAGG + Intronic
1188898900 X:35704378-35704400 ATCTGCACAGAGGCTGACAAGGG + Intergenic
1188974966 X:36662186-36662208 CCCTGCAGAGAGCCTAAGAACGG + Intergenic
1188980382 X:36721774-36721796 CTCTGCAGAGAGCTTGAAACAGG - Intergenic
1190169789 X:48102916-48102938 TTCTTCCTAGAGCCTGAGAAGGG + Intergenic
1190503262 X:51099870-51099892 ATCTGCTAAGGGCCAGAGAAGGG + Intergenic
1191238120 X:58152881-58152903 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1191992105 X:67049768-67049790 GTCTGCAAAGAGGCGGTGAAAGG - Intergenic
1192157851 X:68759606-68759628 CTCTGCCCAGAGCCTCAGAAAGG - Intergenic
1192420957 X:71029983-71030005 ATCTGCAAGGAGCCTGGAAAGGG - Intergenic
1192586019 X:72318767-72318789 AAATGCAAAGAGCCTGAGACAGG - Intergenic
1192632119 X:72785226-72785248 TTCTGCAAAGAGTCAGGGAAGGG + Intronic
1192649590 X:72935575-72935597 TTCTGCAAAGAGTCAGGGAAGGG - Intronic
1193023902 X:76822883-76822905 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1193442539 X:81560826-81560848 CCCTGCAGAGAGCCTATGAACGG + Intergenic
1193565434 X:83070580-83070602 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1195883894 X:109620524-109620546 GTCAGCCAAGATCCTGAGAATGG + Intergenic
1197045739 X:121995965-121995987 CTCTCCATAGAGCCAAAGAAAGG - Intergenic
1197863880 X:130997804-130997826 CTCTGAAAAGCCCCTGAGGATGG + Intergenic
1198267626 X:135023998-135024020 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1199602864 X:149553210-149553232 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1199647525 X:149926265-149926287 CCCTGCAGAGAGCCTATGAATGG + Intergenic
1201622358 Y:15974081-15974103 CCCTGCAGAGAGCCTATGAATGG - Intergenic
1201623189 Y:15982520-15982542 CCCTGCAGAGAGCCTATGAATGG - Intergenic