ID: 1103898555

View in Genome Browser
Species Human (GRCh38)
Location 12:124291085-124291107
Sequence GGTCCCAGTGGACCGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103898555_1103898565 23 Left 1103898555 12:124291085-124291107 CCATGTCACGGTCCACTGGGACC 0: 1
1: 0
2: 3
3: 9
4: 108
Right 1103898565 12:124291131-124291153 CACCCTAGCAGCCTCCAGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103898555 Original CRISPR GGTCCCAGTGGACCGTGACA TGG (reversed) Intronic
900391427 1:2435616-2435638 GGCCCGAGTGCAGCGTGACACGG + Intronic
902946155 1:19841223-19841245 GGCCCCCGTGGACAGTGATAAGG - Intergenic
905354185 1:37369609-37369631 GGTCCCAGTGGGCGATGGCAGGG - Intergenic
906050598 1:42868237-42868259 GGGCCCATTGGACAATGACAGGG - Intergenic
906279201 1:44542158-44542180 AGACCCAGTGGACCCTCACAAGG + Intronic
908114059 1:60924175-60924197 GGTCCCAGTGAACTGCGACTTGG - Intronic
909172493 1:72314638-72314660 GGTCCCATTGGGCAATGACAGGG + Intergenic
910637756 1:89428309-89428331 GGTCCCAGTGGCAGGTGACCTGG + Intergenic
912050586 1:105524123-105524145 GGGCCCATTGAACGGTGACAAGG + Intergenic
917462814 1:175246984-175247006 GGGCCCATTGGGCCATGACAGGG - Intergenic
920203143 1:204273022-204273044 GGTCACAGGGGACCCTGACAAGG - Intronic
921266484 1:213424928-213424950 TGTCCCAGGGCACTGTGACAAGG + Intergenic
1063889871 10:10618262-10618284 GGTCCCTGTGCACCTTGAAATGG - Intergenic
1067375041 10:45720112-45720134 GGTGTCAGTGGACTGTGCCAGGG - Intergenic
1067378689 10:45752409-45752431 GGTGTCAGTGGACTGTGCCAGGG + Intronic
1067882859 10:50061753-50061775 GGTGTCAGTGGACTGTGCCAGGG - Intergenic
1067886386 10:50093089-50093111 GGTGTCAGTGGACTGTGCCAGGG + Intronic
1069906236 10:71734257-71734279 GGGCCTGGTGGACCGTGAGAAGG + Intronic
1072253600 10:93600792-93600814 GGTCCCAGAGAACTGTGAGAAGG + Exonic
1081938538 11:46921132-46921154 TGTCCCAGAGGACAGTGAAAGGG - Intergenic
1084087084 11:66859714-66859736 GGGCCCAGCGGCCGGTGACAAGG - Exonic
1094472805 12:30818970-30818992 GGTCTCACTGGACAGTGGCATGG - Intergenic
1096571464 12:52525773-52525795 GGTCCAAGTGGACAGTGAGCAGG - Intergenic
1098148968 12:67526806-67526828 TCTCCCAATGGACAGTGACAGGG - Intergenic
1101319849 12:103663900-103663922 GGTCCCAGATGACAGGGACAGGG - Intronic
1103354934 12:120312663-120312685 GGACACAGTGAACCCTGACAAGG + Exonic
1103898555 12:124291085-124291107 GGTCCCAGTGGACCGTGACATGG - Intronic
1104686299 12:130787305-130787327 GGTCCCATGGGACCAAGACATGG - Intergenic
1104924223 12:132305754-132305776 GGTCTCAGTGGGCCCTGAGAGGG + Intronic
1113812037 13:113148908-113148930 TGTCCCAGGGGACCGGAACACGG + Exonic
1119104445 14:71910878-71910900 GGTCTGCGTGGACAGTGACAGGG + Intergenic
1122143105 14:99674068-99674090 GGGCCCAGAGCACCATGACATGG - Intronic
1122540569 14:102495732-102495754 AGTCCCAGTGGATCAGGACATGG - Intronic
1202935374 14_KI270725v1_random:82896-82918 GGTCTCATTGGACAATGACAGGG + Intergenic
1126690064 15:51282063-51282085 GGTCCCTGTGGACTGTGACAAGG - Intronic
1126840796 15:52715559-52715581 AGTCCCAGTGAATGGTGACAGGG + Intergenic
1129267534 15:74401959-74401981 GCTCCCAGTTGCCAGTGACAGGG + Intergenic
1129467811 15:75733694-75733716 GGTCACAGTGGACTGTCATATGG - Intergenic
1129719406 15:77869892-77869914 GGTCACAGTGGACTGTCATATGG + Intergenic
1130459518 15:84150859-84150881 GGTCACAGTGGACTGTCATATGG - Intergenic
1135723792 16:24838956-24838978 CCTCCCCGTGGACCGAGACATGG - Intergenic
1141697497 16:85627001-85627023 AGTCCCAGTGGAGAGGGACAAGG - Intronic
1142278108 16:89133492-89133514 GGCCCCAGTGCCCCATGACAAGG + Intronic
1144419186 17:15080530-15080552 GGTCCCTGGGGCCCTTGACAAGG + Intergenic
1146662220 17:34672436-34672458 GGTTCCAGGGGACCCTGAGAAGG + Intergenic
1146851042 17:36221836-36221858 GGGCCCATTGGGCGGTGACAGGG - Intronic
1150354271 17:64469857-64469879 GGTCTCAGTAGAGCCTGACAGGG - Intergenic
1152759645 17:82101201-82101223 GATCCCAGTGAACCGGGCCAAGG - Intergenic
1155199078 18:23502082-23502104 GGTTGCAGTGAACCGAGACAGGG + Intergenic
1161977968 19:7616556-7616578 GGCCACAGTGGACAGTGACAGGG - Exonic
1163566065 19:18052051-18052073 GGTCCCAGTGGTCGGGGCCACGG - Intergenic
1168701698 19:58443743-58443765 AGTCCCAGTGGGCACTGACATGG + Intergenic
925499303 2:4486130-4486152 GGGCCCATTGGACAGTGACAGGG + Intergenic
927702615 2:25277448-25277470 GGTCCCGGCGGACCCTGACGCGG + Intronic
928213238 2:29339484-29339506 GGACCCTGTGGGCCGTGGCAAGG + Intronic
930798797 2:55420750-55420772 GGTCCCAGTCGTACGTGGCATGG - Intergenic
932321087 2:70822497-70822519 CATCCCAGTGGACAGTGCCATGG + Intergenic
935281461 2:101521508-101521530 GGCCCTAGAGGGCCGTGACAGGG + Intergenic
936119213 2:109726846-109726868 GATCCCAGTGGACAGAGGCAGGG + Intergenic
937625277 2:124036421-124036443 AGTCCCAGGTGACCGTAACAGGG - Intronic
946415870 2:219539352-219539374 TGTCCCCGTGGGCCGTGGCATGG - Exonic
947151525 2:227121135-227121157 GGTCCTGGTGGACCCTGAGAAGG + Exonic
1171377357 20:24702608-24702630 GGTCCCAGTGGCCCTGGTCAGGG - Intergenic
1176138910 20:63536729-63536751 GGGCCCGGTGGCCAGTGACAAGG - Intronic
1179326705 21:40353568-40353590 GGTTCCAGAAGACCGTGACGGGG - Exonic
1179983233 21:44907221-44907243 AGTCCCTGTGGACAGAGACAGGG + Intronic
1180060443 21:45382319-45382341 GATGCCAGTGCACCGTGACAAGG + Intergenic
1180825014 22:18855928-18855950 GGTCTCAGTGGCCCAGGACAAGG + Intronic
1181187717 22:21118620-21118642 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1181211481 22:21291873-21291895 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181398022 22:22635014-22635036 GGTCTCAGTGGCCCGGGACAAGG - Intergenic
1181500764 22:23314385-23314407 GGTCTCAGTGGCCCAGGACAAGG - Intronic
1181568045 22:23751515-23751537 GGTGCCTGTGGACAGTGACAGGG - Intergenic
1181651385 22:24261046-24261068 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
1181705993 22:24649693-24649715 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1183333636 22:37234563-37234585 GGTCTCAGTGGACCAGGTCAGGG - Intronic
1203215467 22_KI270731v1_random:3558-3580 GGTCTCAGTGGCCCAGGACAAGG - Intergenic
1203275159 22_KI270734v1_random:81833-81855 GGTCTCAGTGGCCCAGGACAAGG + Intergenic
949169928 3:985801-985823 GGGCCCATTGGACAATGACAGGG + Intergenic
953853760 3:46485229-46485251 CTTCCCAGTGGACGGTGACGTGG - Intronic
954691280 3:52396906-52396928 GGTCCCAGTCATCAGTGACACGG - Exonic
956509772 3:69981165-69981187 GGGCCCATTGGGCGGTGACAGGG - Intergenic
961134391 3:124496392-124496414 GAACACAGTGGACAGTGACAAGG + Exonic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
968771895 4:2512813-2512835 AGTCCCAGTGGCCCCAGACAGGG + Intronic
969052836 4:4385568-4385590 GGTCCCCGAGGCCCGTGGCAGGG + Intronic
974564889 4:63569110-63569132 GGGCCCATTGGACAATGACAGGG - Intergenic
974727328 4:65813337-65813359 GGGCCCACTGGACGATGACAAGG - Intergenic
977031754 4:91892609-91892631 GGACCCATTGGACAATGACAAGG - Intergenic
979898304 4:126188267-126188289 GGGCCCATTGGGCGGTGACAGGG + Intergenic
982597669 4:157406244-157406266 GGGCCCATTGGACGATGACAGGG + Intergenic
984935227 4:184883877-184883899 GGTCCCAGTGGACCTTTTCCGGG - Intergenic
987072940 5:14354854-14354876 GGTCCCATTGGACAGTGACAAGG + Intronic
992089868 5:73307306-73307328 GGTGCAAGTGGATCTTGACAGGG - Intergenic
998155177 5:139782076-139782098 GCTCCCAGTGGCCCTTCACAGGG + Intergenic
1004455536 6:15788320-15788342 GGCCCCTGTGGACAGTGACGGGG - Intergenic
1007417566 6:41700920-41700942 GGTCCCAGTGGGACAGGACAGGG - Intronic
1011978046 6:93332213-93332235 GGACCCGGTGGAAGGTGACAAGG + Intronic
1018008046 6:159641622-159641644 GGTACCAGAGGACCGTTACTGGG - Intergenic
1020022206 7:4875842-4875864 GGGACCACTGGATCGTGACATGG + Intronic
1022078995 7:27001130-27001152 GGGCCCACTGGACGATGACAGGG - Intergenic
1025782439 7:64613779-64613801 GTTCCCAGTGGGCAGTGCCAAGG - Intergenic
1030191726 7:106817225-106817247 GGTGCCAGTTCACAGTGACATGG + Intergenic
1035828336 8:2668330-2668352 GGTCCCAGAGGACCGGGAGCAGG + Intergenic
1036078090 8:5523241-5523263 GGTCCCAGGGGACCTTGACATGG - Intergenic
1042000953 8:64123195-64123217 GGGCCCATTGGGCAGTGACAGGG + Intergenic
1042187561 8:66152224-66152246 GGTCCAAGTGTGCCGTGCCAGGG - Intronic
1049619499 8:143591679-143591701 GGCCCCAGGGCACCGTGACTGGG + Intronic
1052423079 9:28269241-28269263 GGTCCCAGAGGACTGAGATATGG + Intronic
1054985917 9:71261960-71261982 GGTCCCTGTGGCTCCTGACAGGG - Intronic
1055233764 9:74093693-74093715 GGTCCCAGTGCATGGTGACCAGG - Intergenic
1055673581 9:78632161-78632183 GTTCCCAGGAGACCGTGGCAGGG + Intergenic
1056929256 9:90861146-90861168 GGTCCCAGTGGAGGCTGAAAAGG - Intronic
1057122549 9:92589218-92589240 AGTCCCAGTGCACCGTCACTAGG + Intronic
1061251714 9:129430231-129430253 GATCCCAGTGGACCCTGAGAGGG - Intergenic
1061429885 9:130524156-130524178 GATCGCAGTGGTCAGTGACACGG + Intergenic
1186383988 X:9090963-9090985 GGGCCCATTGGGCCATGACAGGG + Intronic
1194076862 X:89405702-89405724 GGTCAGAGTGGACGGTGACATGG - Intergenic
1197259622 X:124304404-124304426 GGCCACAGTGGACTGTGCCAAGG - Intronic
1198379128 X:136067788-136067810 GGTCCCACTGGACCTTTCCAAGG + Intergenic
1200429506 Y:3061231-3061253 GGTCAGAGTGGACGGTGACATGG - Intergenic