ID: 1103899833

View in Genome Browser
Species Human (GRCh38)
Location 12:124297656-124297678
Sequence ATTAGCTGCACAGTGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103899833_1103899836 5 Left 1103899833 12:124297656-124297678 CCCCTTTTCACTGTGCAGCTAAT 0: 1
1: 0
2: 3
3: 17
4: 190
Right 1103899836 12:124297684-124297706 ACCTGTGATTTTTTTTTTATTGG 0: 1
1: 1
2: 11
3: 137
4: 1205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103899833 Original CRISPR ATTAGCTGCACAGTGAAAAG GGG (reversed) Intronic
900404942 1:2488682-2488704 ATTACCTGCACAGTGCAGAATGG - Intronic
904904765 1:33886933-33886955 ATTAGCTGCACATTTTACAGAGG + Intronic
905456461 1:38091554-38091576 AGAAGCTGCACAGTGAGGAGAGG + Intergenic
905645997 1:39625615-39625637 ATTGGGTGCACAGTGCAGAGGGG - Exonic
906070019 1:43009512-43009534 ATAAGCTGGTAAGTGAAAAGAGG + Intergenic
906952623 1:50347166-50347188 AATAGCTGCTCAGTAAATAGGGG - Intergenic
907681855 1:56571777-56571799 ATTAATTGCAAATTGAAAAGTGG + Intronic
908229677 1:62091553-62091575 ATTACCTGGACAGTGAAATGTGG + Intronic
909169469 1:72276772-72276794 GATAGATGCATAGTGAAAAGTGG - Intronic
909486180 1:76176901-76176923 TTTAGCTGCACATTTAAAACTGG + Intronic
910526226 1:88181702-88181724 ATTAGATGCAAAATGAAAAGTGG - Intergenic
911480710 1:98436608-98436630 ATTAGCTGCATATAGAAAATGGG - Intergenic
912077696 1:105896792-105896814 ATTAGAGGCACAGTGAGAATTGG + Intergenic
914967730 1:152276106-152276128 ATTAGCAGCACAGGGCTAAGTGG + Intergenic
918786164 1:188767498-188767520 ACTACCTGTATAGTGAAAAGTGG - Intergenic
919415758 1:197306924-197306946 CTTAGCAGCACACTGAAAAAAGG + Intronic
920570725 1:207015238-207015260 ACTGTCTGCACAGTGAAAGGAGG - Intronic
920688446 1:208127791-208127813 TTTAGCTGCTCAGTAAAACGGGG + Intronic
921489925 1:215762841-215762863 ACTAGCTGCAAGGTTAAAAGGGG + Intronic
922437142 1:225617557-225617579 CTTAGCTGTACAGTGCTAAGTGG + Intronic
923301500 1:232644760-232644782 CTTAGCTGCAGAGTGTGAAGAGG - Intergenic
924907169 1:248468366-248468388 ATAAGCTGTACTGGGAAAAGTGG - Intergenic
924916944 1:248579782-248579804 ATAAGCAGCACTGGGAAAAGTGG + Intergenic
1063370517 10:5518938-5518960 AATATCAACACAGTGAAAAGGGG - Intergenic
1064126025 10:12660978-12661000 ATCAACTGAACAGAGAAAAGAGG - Intronic
1065837039 10:29667870-29667892 ATAAGCTGTACACTAAAAAGAGG + Intronic
1066148671 10:32591154-32591176 ATTAGCTGCAAAGTCCAAAAAGG - Intronic
1068209128 10:53897559-53897581 ATGAACTGTACACTGAAAAGTGG - Intronic
1069847368 10:71381802-71381824 ATTAGCTGCACAGTGGGAGCAGG - Intergenic
1071127604 10:82353463-82353485 ATTAAATGCACAGTGAGAGGTGG - Intronic
1073600794 10:104844149-104844171 TTTTGCTGCTCAGTGAAAATTGG + Intronic
1073824134 10:107300905-107300927 ATTAGCTACCCAGTGAAAAATGG - Intergenic
1076524511 10:131103054-131103076 ACTAGCAGCACAGTGAAGGGTGG - Intronic
1079024853 11:16938724-16938746 ATAAACTGCACATTGAAAAATGG - Intronic
1080894503 11:36438146-36438168 ATTAGCTCTACAGAGACAAGGGG - Intronic
1081307406 11:41530441-41530463 ATGAGCTGCAAAGAGAAGAGAGG + Intergenic
1085785351 11:79443479-79443501 ATTAGCTAGACCGTGAAAGGAGG + Intergenic
1086089633 11:82992634-82992656 ATCAGCAGCACAATGAAAACTGG - Intronic
1086520476 11:87662912-87662934 ATTAACTGCACAGGGGAAAAGGG + Intergenic
1087233361 11:95691218-95691240 CTGAACTGCACACTGAAAAGCGG + Intergenic
1087340953 11:96906505-96906527 AATAGCAGCAGAGTTAAAAGGGG + Intergenic
1089229672 11:116961301-116961323 CTTAGCTGCAAACTGGAAAGTGG + Intronic
1092042842 12:5400404-5400426 ATTAACTGCACAGTGGACAACGG - Intergenic
1093844731 12:23955900-23955922 GGTAGCAGCAAAGTGAAAAGTGG + Intergenic
1095350133 12:41200540-41200562 GCAAGCTGCACAGTAAAAAGAGG - Intronic
1098641764 12:72847200-72847222 TTTTTTTGCACAGTGAAAAGGGG + Intergenic
1098900723 12:76109462-76109484 ATTAGCTACACTGAGAAAATGGG + Intergenic
1099080127 12:78167808-78167830 ATTAGAAGCTCAGTGACAAGGGG - Intronic
1101372103 12:104138899-104138921 AGTAGCTGCAGATTGACAAGCGG + Intergenic
1101579939 12:106033455-106033477 AAGACCTGAACAGTGAAAAGAGG + Intergenic
1103192269 12:119011693-119011715 CAGAGCTGCACAGTGAAAGGAGG + Intronic
1103899833 12:124297656-124297678 ATTAGCTGCACAGTGAAAAGGGG - Intronic
1104833399 12:131770719-131770741 ATAAACTGCACAGTTAAAAACGG - Intronic
1105267265 13:18831998-18832020 AATGGCTGCATAGTGAAAAAAGG + Intergenic
1108754184 13:53479972-53479994 ATTAGCTGCAAAGTGACAAATGG - Intergenic
1109635666 13:65112004-65112026 ATTTTCTACACAGTGAAAACTGG - Intergenic
1110977605 13:81860608-81860630 ATTTGCTTCAAGGTGAAAAGTGG - Intergenic
1118504762 14:66399181-66399203 TTTAGCAGCACACTCAAAAGTGG - Intergenic
1118790579 14:69088210-69088232 ATCATTTGTACAGTGAAAAGGGG + Intronic
1121590200 14:95100376-95100398 TCTAGCTGCAAAGTGAAAACTGG + Intronic
1122408725 14:101515173-101515195 ATTAGCTGCTCAGTAAATGGGGG + Intergenic
1122623463 14:103072641-103072663 CTTATCTGCACAGTGAGGAGGGG - Intergenic
1125176722 15:36831065-36831087 ATTCAGTTCACAGTGAAAAGTGG - Intergenic
1126747223 15:51838209-51838231 ATTAGCTACACAGAGAGGAGTGG - Intronic
1128008016 15:64263533-64263555 GTCAACTGCACTGTGAAAAGCGG - Intronic
1128990863 15:72259244-72259266 AGTAGCTGAGCAGTGAAAGGGGG + Intronic
1129530586 15:76261271-76261293 TTTGGCTCCACTGTGAAAAGTGG + Intronic
1129816163 15:78556375-78556397 ATTAGCTTCACAGTAAATTGGGG + Intergenic
1130616688 15:85416211-85416233 ATAAACTGCACAATGAATAGAGG - Intronic
1130721553 15:86391075-86391097 ATTGCCTGCAAAGTGAAATGAGG + Intronic
1131098601 15:89671294-89671316 TTTAGCTTCACAGGGAGAAGAGG + Intronic
1131689381 15:94810027-94810049 ATCACTTGCCCAGTGAAAAGAGG + Intergenic
1133902173 16:9987100-9987122 ATTATGTGCTCAGTGAAAAGTGG - Intronic
1134008793 16:10835805-10835827 ATTAGGTGCTCAGTAAACAGAGG + Intergenic
1140339755 16:74146181-74146203 ATTAGGAGCACAGTCAGAAGAGG + Intergenic
1141848737 16:86629684-86629706 AGTAGCTGCTCAGTGAATATTGG - Intergenic
1147500263 17:40956354-40956376 ATAAGCTGCACAGTAAAGAGGGG - Intergenic
1149559165 17:57595908-57595930 AGTAGATGCACAGTGAGAAGTGG + Intronic
1151758019 17:76085793-76085815 TTTACCTGCACAGGGAAAAATGG + Exonic
1153264693 18:3258584-3258606 ATTTGCTACAAAGTGAAAAGAGG + Intergenic
1154421146 18:14229431-14229453 AATGGCTGCATAGTGAAAAAAGG - Intergenic
1155581101 18:27307148-27307170 ATATGCTGCACTATGAAAAGTGG + Intergenic
1157494803 18:48149051-48149073 ATAAGCAGCAAAGGGAAAAGTGG - Intronic
1158756521 18:60332060-60332082 ATCAGCTGCACAGTGTGGAGAGG - Intergenic
1161453166 19:4357780-4357802 ATTGGCTGCTCAGTACAAAGAGG + Intronic
1165995731 19:39842581-39842603 ATTAGCTGCTGTGTGAAAAGTGG - Intronic
925321740 2:2975630-2975652 GTTAGCTGCAGCATGAAAAGAGG + Intergenic
932090203 2:68799627-68799649 ATTAGCTGCTAAGTAAAAGGAGG + Intronic
937347286 2:121133827-121133849 AGTAGGTGCACAATGAACAGAGG + Intergenic
938531578 2:132192839-132192861 ATTAGCAGCACTGGGAACAGTGG + Intronic
940106097 2:150102055-150102077 ATTAGATGCATAGTGATCAGAGG - Intergenic
941055801 2:160786518-160786540 GTTAGCTGCACAGCAAAAAGTGG + Intergenic
942349303 2:175036299-175036321 TTTTGCTTCACAGAGAAAAGGGG - Intergenic
942616390 2:177795614-177795636 ATTCCCTGCCCAGTGGAAAGAGG - Intronic
944565029 2:200981283-200981305 ATTAGCTGCATATTGAAACTTGG + Exonic
945400016 2:209370238-209370260 ATTACCTGCAAAGTGAAAAGTGG + Intergenic
946108632 2:217394411-217394433 TATAGCTGCACTGTCAAAAGAGG - Intronic
948127940 2:235578433-235578455 CTGAGCTGCACACTTAAAAGTGG + Intronic
1171113102 20:22502048-22502070 ATGAGCTGGACACTGAACAGAGG - Intergenic
1171241152 20:23568151-23568173 ATGTGCTGCTCAGTGAAAAATGG - Intronic
1173329052 20:42059068-42059090 TTTTGCTGCAGAGTGAGAAGTGG + Intergenic
1173886904 20:46467629-46467651 ATTAACTGCACAGTGCATTGTGG + Intergenic
1175601244 20:60275074-60275096 TTTAGCTGGATATTGAAAAGGGG + Intergenic
1176808741 21:13516321-13516343 GTTAGCGGCAAAGGGAAAAGAGG + Intergenic
1180178180 21:46100431-46100453 ACTAGCTGCACACTTAAAAATGG - Intronic
1182094991 22:27620060-27620082 GTCAGCTGCACAGTAACAAGAGG - Intergenic
1185256684 22:49837548-49837570 AATAGCTGAAAAGTGAAAACAGG + Intergenic
951155409 3:19347002-19347024 ATCAGCTGCACAGTGAACATTGG + Intronic
951365215 3:21773169-21773191 TTGAACTGTACAGTGAAAAGTGG + Intronic
951518523 3:23588939-23588961 CTGAGCTGGACAGTCAAAAGAGG - Intronic
951602902 3:24396500-24396522 ATTAGCATCACAGTGAAAACTGG - Intronic
952882882 3:37996251-37996273 GTTAGCAGCACAGTGAGAGGTGG + Intronic
953515522 3:43587374-43587396 AGGAGCTGCACAGAGAAACGGGG + Intronic
953787105 3:45919606-45919628 ATTAGCTACTCAGTGAATGGTGG + Exonic
953929146 3:46997312-46997334 AGTAGCTGCACAGCCCAAAGAGG + Exonic
956171938 3:66439899-66439921 ATTAAATCAACAGTGAAAAGAGG + Intronic
957178296 3:76841556-76841578 ATTACGTGTACAGTAAAAAGAGG - Intronic
959133031 3:102381690-102381712 ATTAGGGGCACATTGAAATGTGG + Intronic
959212059 3:103397958-103397980 CTGAACTGTACAGTGAAAAGTGG + Intergenic
959457987 3:106587990-106588012 ATAACTTGCATAGTGAAAAGGGG + Intergenic
961744793 3:129057625-129057647 AGTAGCAGCACAGGGAGAAGTGG + Intergenic
962596290 3:136947842-136947864 GTTAGCTACACATTGAAAAGGGG + Intronic
963559388 3:146843019-146843041 ATTAGCTTTACGGTGTAAAGAGG + Intergenic
964156754 3:153594993-153595015 CTTATCTGCACAGAGAAAAAAGG - Intergenic
964401129 3:156299812-156299834 AGTTGCTGCACAGTGCAAATTGG - Intronic
964551548 3:157890380-157890402 TTTAGCAGAACAGTGAGAAGAGG + Intergenic
965423309 3:168489795-168489817 CTTAGGAGCACACTGAAAAGTGG - Intergenic
966838795 3:184071131-184071153 CTTAGCTGCACACTTAAAAATGG + Intergenic
966989179 3:185211270-185211292 ATTGGCTGCCCAGGGAAATGGGG + Intronic
971290810 4:25337438-25337460 CTTAACTGCCCAGTGGAAAGAGG + Intronic
971445556 4:26743227-26743249 AATAGCTGCACAGAGAAGACAGG - Intronic
974873325 4:67671861-67671883 ATTAGGTGCACAGTGACATTGGG - Intronic
975343523 4:73268077-73268099 ATTAGCTGTAAAATGAAATGTGG - Intergenic
977135390 4:93297504-93297526 TTTGGCTGCACAGTGAAATTCGG + Intronic
978829763 4:113070032-113070054 AGTTGGTCCACAGTGAAAAGTGG + Intronic
981308472 4:143271144-143271166 ATTAGCTCAGCAGTGAGAAGAGG + Intergenic
981878753 4:149581684-149581706 TTTAGTAGCACAGTGTAAAGTGG - Intergenic
982166458 4:152617899-152617921 GCTGGCTGCACAGTGAACAGGGG - Intergenic
983526704 4:168767356-168767378 ATTAATTGTATAGTGAAAAGGGG - Intronic
986068373 5:4258061-4258083 AGAAGCTGCCAAGTGAAAAGAGG + Intergenic
987039756 5:14051295-14051317 ATTAGCTGCATAGACAAAAAGGG + Intergenic
987391894 5:17384401-17384423 GTTGGCTGCTCAGTGGAAAGAGG + Intergenic
989562903 5:42871835-42871857 ATTGGCTGCCCAGTGAAAGTGGG - Intronic
990933515 5:61120785-61120807 TTTAGATCCAGAGTGAAAAGGGG + Intronic
991223259 5:64240530-64240552 TTTAGCTTCACAGTGGAAATTGG + Intronic
992246285 5:74827193-74827215 ATTAACTGCAAAGGGAAAAATGG - Intronic
994190082 5:96859545-96859567 ACAAGCTGCACAGTGCAATGTGG + Intronic
995012184 5:107268951-107268973 CTCATATGCACAGTGAAAAGTGG + Intergenic
996051889 5:118943983-118944005 ATTAGCTGCATAATGAAGAGGGG - Intronic
998636742 5:143963630-143963652 ACTAGATGCACAGTGTAAAATGG - Intergenic
1000030303 5:157396034-157396056 ATTAGATGCTCAGTGAAAAAAGG + Intronic
1000176594 5:158762315-158762337 ATTAGCTGCAGTTGGAAAAGGGG + Intronic
1000989696 5:167899137-167899159 ATTTGCTGAAAAGAGAAAAGAGG + Intronic
1003797239 6:9618712-9618734 ATCACACGCACAGTGAAAAGTGG - Intronic
1006928555 6:37673436-37673458 ATTAGCTGCTCAGAGAATGGCGG + Intronic
1006973988 6:38079671-38079693 ATGAGCTGCACAGTGCACAAGGG - Intronic
1008162965 6:48101589-48101611 TTTACCTGAACAGGGAAAAGGGG - Intergenic
1008680703 6:53868839-53868861 ATTTGATGCACAGTGATGAGAGG - Intronic
1009943152 6:70312974-70312996 ATTAGATGCAGAGTGAAGCGGGG - Intergenic
1012119339 6:95344636-95344658 ATGGGCTGCAGAGTGATAAGAGG + Intergenic
1012843629 6:104362040-104362062 CTAAGATGCTCAGTGAAAAGAGG - Intergenic
1013185495 6:107754137-107754159 ATTGGCTGCACAGTGCTAAATGG + Intronic
1014254879 6:119150905-119150927 TTAAGCATCACAGTGAAAAGTGG - Intergenic
1015258705 6:131210061-131210083 ATTAACTGCATAGTGAAAGAAGG + Intronic
1015678317 6:135775979-135776001 AATTGCTGCACAGAGAACAGGGG - Intergenic
1017810110 6:157978328-157978350 ATGAGCTGCACAAAGGAAAGTGG - Intergenic
1021597065 7:22328523-22328545 TTTACCTGGACAGTGACAAGTGG + Intronic
1022833705 7:34093954-34093976 ATTAGCTACACGGTAAAATGAGG - Intronic
1022995623 7:35752350-35752372 ATCCCCTGCACAGAGAAAAGCGG - Intergenic
1023387328 7:39672820-39672842 ATTATCTGCAAAGGGACAAGAGG + Intronic
1024041649 7:45560561-45560583 ATCAGCAGCAGAGAGAAAAGGGG - Intergenic
1027647512 7:80821859-80821881 AAAAGCTGCACAGTGGAGAGTGG - Intronic
1028393737 7:90344856-90344878 TTTAGCTGCACATTTTAAAGGGG + Intronic
1028398012 7:90393344-90393366 ATTAGTTGAGAAGTGAAAAGGGG - Intronic
1028636057 7:92990484-92990506 ACTAGGTGCTCAGTGAATAGTGG - Intergenic
1029293868 7:99523692-99523714 ATTAGCTGCATAGTTAAATGAGG + Intronic
1030648764 7:112094295-112094317 ATAAGCTACACAGAAAAAAGTGG + Intronic
1031035165 7:116780880-116780902 ATCAGAAGCACAGTGAATAGAGG - Intronic
1031278986 7:119771435-119771457 ATTATCGGCTCAGTGACAAGTGG + Intergenic
1033809530 7:144994955-144994977 ATTAGTTGCACAGTTATCAGTGG + Intergenic
1035416272 7:158690240-158690262 AGTAGCTCTACAGTGAAATGTGG - Intronic
1037235341 8:16713782-16713804 TTGAGCTGCACAGTGGAAGGAGG - Intergenic
1041766777 8:61427224-61427246 ATAGGCTGCAGAGTAAAAAGGGG - Intronic
1042555723 8:70032749-70032771 TTTATCTGCACACTGAAATGGGG - Intergenic
1043665331 8:82803603-82803625 ATTAACTCTATAGTGAAAAGAGG - Intergenic
1044175739 8:89119574-89119596 ATTACTTAAACAGTGAAAAGTGG + Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1048317307 8:133371723-133371745 ATAAAATGCACAGTGAAAACAGG + Intergenic
1048742570 8:137578328-137578350 ATTATATGCCTAGTGAAAAGAGG - Intergenic
1049418825 8:142507827-142507849 ATCAGCTGCACAGGGAAAAGCGG + Intronic
1053660147 9:40268772-40268794 AATGGCTGCATAGTGAAAAAAGG - Intronic
1053910523 9:42898127-42898149 AATGGCTGCATAGTGAAAAAAGG - Intergenic
1054372281 9:64415076-64415098 AATGGCTGCATAGTGAAAAAAGG - Intergenic
1054524451 9:66107445-66107467 AATGGCTGCATAGTGAAAAAAGG + Intronic
1054679898 9:67904773-67904795 AATGGCTGCATAGTGAAAAAAGG - Intergenic
1055373430 9:75624558-75624580 AGAAGATGCCCAGTGAAAAGTGG + Intergenic
1055738351 9:79357739-79357761 ATTAGTTGCGCTGTGAAAAGGGG + Intergenic
1058035945 9:100253045-100253067 ATATGCTGCACACTGCAAAGGGG - Exonic
1061316018 9:129796315-129796337 AGTAGCTGCACAGTTGAAATGGG - Intergenic
1061799514 9:133106204-133106226 AATAGCTGCTCAGTGGAAACGGG - Intronic
1186366306 X:8897751-8897773 ATTAGCATCACAGTGACAAAGGG + Intergenic
1188515272 X:30979145-30979167 ATGATCTGCACTGTAAAAAGTGG - Intergenic
1189721924 X:43928695-43928717 ATTAGCAGCACAGCACAAAGTGG - Intergenic
1192103255 X:68288286-68288308 GCTAGCTGAACAGTCAAAAGAGG + Intronic
1194038680 X:88913690-88913712 TTTAGCTGCACTTTGAAAGGTGG + Intergenic
1194662792 X:96645247-96645269 GTTTGCGGCACAGTGGAAAGAGG - Intergenic
1195154304 X:102107947-102107969 AATAGCTAAAGAGTGAAAAGGGG + Intergenic
1196178091 X:112662311-112662333 CTCAACTGGACAGTGAAAAGCGG + Intronic
1196460100 X:115920735-115920757 ATCAGCTGCTTAGTGGAAAGAGG - Intergenic
1197275410 X:124473587-124473609 AATAGCTGCAAAGTGGGAAGAGG - Intronic
1201619171 Y:15936233-15936255 TTTAGCTGCACAGTGAGAAGAGG + Intergenic