ID: 1103900698

View in Genome Browser
Species Human (GRCh38)
Location 12:124302410-124302432
Sequence TGGAGAGCCATGAACTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103900698_1103900703 -2 Left 1103900698 12:124302410-124302432 CCTTGATAGTTCATGGCTCTCCA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1103900703 12:124302431-124302453 CATATGGCCTGACCCACTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 59
1103900698_1103900700 -4 Left 1103900698 12:124302410-124302432 CCTTGATAGTTCATGGCTCTCCA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1103900700 12:124302429-124302451 TCCATATGGCCTGACCCACTCGG 0: 1
1: 0
2: 0
3: 4
4: 99
1103900698_1103900702 -3 Left 1103900698 12:124302410-124302432 CCTTGATAGTTCATGGCTCTCCA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1103900702 12:124302430-124302452 CCATATGGCCTGACCCACTCGGG 0: 1
1: 0
2: 0
3: 10
4: 87
1103900698_1103900706 7 Left 1103900698 12:124302410-124302432 CCTTGATAGTTCATGGCTCTCCA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1103900706 12:124302440-124302462 TGACCCACTCGGGGTCTCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 90
1103900698_1103900705 6 Left 1103900698 12:124302410-124302432 CCTTGATAGTTCATGGCTCTCCA 0: 1
1: 0
2: 0
3: 6
4: 118
Right 1103900705 12:124302439-124302461 CTGACCCACTCGGGGTCTCCTGG 0: 1
1: 0
2: 0
3: 7
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103900698 Original CRISPR TGGAGAGCCATGAACTATCA AGG (reversed) Intronic
908047167 1:60183630-60183652 TGGAGAAACCTGAACTATAAGGG + Intergenic
912390889 1:109301972-109301994 TGGAGAGCCAAGAACCAAGATGG + Intronic
915697647 1:157760575-157760597 TGGAGTGCAATGAACAATCTTGG - Intronic
916105635 1:161428781-161428803 TGAAAAGCCATGACCCATCAGGG - Intergenic
917129649 1:171727921-171727943 GGGAGAGCAATGGATTATCAAGG + Intronic
920174859 1:204094388-204094410 TGGAGAGTCATGAGCCAGCAGGG + Intronic
1064284527 10:13981205-13981227 TGGAAAACCAAGAACTATCATGG + Intronic
1064707163 10:18085126-18085148 TGAAGAGCCAGGAACTATAGTGG - Intergenic
1072740250 10:97904821-97904843 AGGAGAGGCAGGAACTCTCAGGG + Intronic
1073716521 10:106114533-106114555 TGGAGAGCAAAGAAATAGCAGGG + Intergenic
1078940996 11:16005505-16005527 TGGAGGGCAATGAAGTTTCAGGG + Intronic
1090921597 11:131211094-131211116 TGGAGATGCTTTAACTATCAAGG + Intergenic
1094037542 12:26086884-26086906 TGGATAGGGATGAACTAACAGGG + Intergenic
1095842415 12:46707954-46707976 TGCAGAACCATGATCTATCAAGG + Intergenic
1098701693 12:73636663-73636685 TGGTGAGCTATCAAATATCAGGG - Intergenic
1101015739 12:100498304-100498326 TGGAGTGCAAAGAACTTTCAAGG + Intronic
1101305365 12:103522485-103522507 TGGAGAGCCATGAGAGATGAGGG - Intergenic
1103900698 12:124302410-124302432 TGGAGAGCCATGAACTATCAAGG - Intronic
1104007758 12:124906006-124906028 TGGAGAGGCAGGAAATAGCACGG - Intergenic
1104105528 12:125655320-125655342 TGGAGACCCAGGAAATAACATGG - Exonic
1104583905 12:130031577-130031599 TTGAGAGCCATGCATTATGATGG - Intergenic
1108494063 13:51007124-51007146 TGCAGAGCCTTGAAAAATCAAGG - Intergenic
1114283693 14:21219595-21219617 TGGAGAAGCATGAAGTATCTTGG - Intronic
1119344490 14:73911419-73911441 TGGAGAGTTATAAACAATCAGGG + Intronic
1119725913 14:76921755-76921777 TGGAATGCCATGACCTATTAGGG + Intergenic
1119921956 14:78454963-78454985 GGCATAGCCATGAACTCTCAAGG + Intronic
1120304636 14:82753070-82753092 TGGAAAGCTTTGAACTAACAGGG + Intergenic
1123830617 15:24132532-24132554 TGCAGACCCAGGGACTATCATGG - Intergenic
1128192383 15:65714808-65714830 TGGAGAGGCATGGTCTAACATGG - Intronic
1128812177 15:70580710-70580732 TGGAGAGCCCTCAACCCTCAAGG - Intergenic
1129465470 15:75722127-75722149 TGGGGAGGCCTGAGCTATCAGGG + Intergenic
1129513324 15:76140602-76140624 TGAAAAGCCCTGAAATATCACGG - Intronic
1130894795 15:88161610-88161632 TGGAGACCCATCCACTAGCATGG + Intronic
1132325062 15:100961991-100962013 TGGAGAGCAAGGAAGTCTCATGG - Intronic
1137369473 16:47891580-47891602 TGGAGATACATGAACTCTGAGGG - Intergenic
1137423357 16:48354909-48354931 TGCAGAACCATGACCTATCAAGG + Exonic
1138333877 16:56236649-56236671 TGGTGAGCCATGGACTAGCTTGG - Intronic
1140668296 16:77248288-77248310 AGGAGAGGCAAGAACAATCAAGG - Intronic
1140776798 16:78256256-78256278 AGGAGAGACATGAAGTCTCATGG - Intronic
1142939161 17:3367115-3367137 TGGGAAGCAATGACCTATCAGGG + Intergenic
1144403805 17:14933144-14933166 TGGAGAGCCTTGAATTGTCTGGG + Intergenic
1144753185 17:17664120-17664142 TGGAGAAGCATCAAGTATCAGGG + Intergenic
1153187066 18:2497985-2498007 TGGCCAGCCAGGAACTAGCAAGG - Intergenic
1157445872 18:47746740-47746762 AAGAGTGCCATGAACTTTCAAGG - Intergenic
1159013371 18:63080817-63080839 TGGAGAGACTGGCACTATCAAGG - Intergenic
1164007791 19:21167209-21167231 TGGAGTGCAATGCACTATCTTGG + Intronic
1165746883 19:38234715-38234737 TGGGGGGCCATGCAGTATCAGGG + Intergenic
928822028 2:35372979-35373001 TGGAGAGGCATAAGCTCTCATGG + Intergenic
937454122 2:122026627-122026649 TGGAGGGCCAGGAAAGATCATGG + Intergenic
938625878 2:133108615-133108637 TGGAGAGCCATTATATAGCATGG - Intronic
938656124 2:133436036-133436058 TGGAGGGGCATGAGCTGTCAAGG - Intronic
940124644 2:150310087-150310109 TGGAGAGCCCAAAACAATCAGGG + Intergenic
941740867 2:169033683-169033705 TGGAGTGCCATGAGCTCACAGGG + Intergenic
942934478 2:181538448-181538470 TGGAGAGCATTGGACAATCAAGG - Intronic
944887060 2:204073707-204073729 TTGACAGCCATGCTCTATCAAGG - Intergenic
945744965 2:213709163-213709185 TGGATTGCCATGAACTACCATGG - Intronic
946057060 2:216911653-216911675 TTGAGAGCTGTGAAATATCATGG + Intergenic
946262438 2:218505912-218505934 TGGAGTGCAGTGGACTATCATGG + Intronic
946722123 2:222620266-222620288 TGGAAAGTCATGAAATACCAAGG - Intronic
947965788 2:234280470-234280492 TGGTGAGCCCTGAAGAATCAAGG - Intergenic
948672356 2:239576569-239576591 TGGAGGGACATGAACTCCCAGGG + Intergenic
1181110495 22:20600053-20600075 TGGAGTGCAATGCACCATCATGG - Intergenic
1182998255 22:34834277-34834299 TGGAAAGCCAAGAACAATAAAGG + Intergenic
1183741938 22:39673661-39673683 GGGTGGGCCATGAACTGTCACGG - Intronic
950846635 3:16021771-16021793 TAGAGAGCCAGAAACTATAAAGG - Intergenic
950850350 3:16056367-16056389 TGGAGAGCAATGAACATTCTTGG - Intergenic
953221600 3:40976884-40976906 TGGAGATCCAGGAGATATCAAGG - Intergenic
959578552 3:107961162-107961184 TTGAGGGCCCTGAAATATCAAGG - Intergenic
968905432 4:3448535-3448557 TGGACAGCCAGGAACTGTCCGGG - Intronic
970947668 4:21714314-21714336 TAGAGAGCCGAGAAATATCAGGG - Intronic
982118460 4:152116908-152116930 GGGAGAGCCTTGAATTATGATGG - Intergenic
987193743 5:15504312-15504334 TGGAAAGACATTAACTAACAGGG + Intronic
987562869 5:19546724-19546746 TGGAGAGGCATGAACACACATGG + Intronic
988599961 5:32630752-32630774 AGGAGAGCAGTGAACTATGATGG + Intergenic
991254151 5:64596318-64596340 TTGAGACCCATGATCTCTCAAGG - Intronic
991410970 5:66345333-66345355 TGGATAGCAATGAGATATCATGG - Intergenic
995169616 5:109091726-109091748 TGGTGTGTCATGAACTTTCAGGG + Intronic
999482384 5:151960544-151960566 TGGAGAACAAAGAACAATCAAGG - Intergenic
1001563647 5:172686101-172686123 TGAAGAACCATGGACTAGCAGGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1003767167 6:9251582-9251604 TGGAGAGAAATGTACTATAAAGG + Intergenic
1004160107 6:13205466-13205488 TGGACACCCATGGACTGTCAAGG - Intronic
1005711939 6:28511635-28511657 TGGAGAGCAATGCACCATCGTGG + Intronic
1007822775 6:44573126-44573148 TTGGCAGCCATGAACTATTATGG + Intergenic
1009413136 6:63389714-63389736 AGTAGATTCATGAACTATCATGG - Intergenic
1011304003 6:85906952-85906974 TGAAGAGTCAAGACCTATCAGGG - Intergenic
1011742481 6:90376330-90376352 TGGAGAGCCAAGAACTGGGAGGG - Intergenic
1012021662 6:93928965-93928987 TAGAGGGCAATGAACTATAAAGG + Intergenic
1012424121 6:99095618-99095640 TGGAGGGCCCTGAATTCTCAGGG + Intergenic
1013857802 6:114595264-114595286 TGCAGAGCCAGCAACTCTCATGG - Intergenic
1016002115 6:139052214-139052236 TGGAGAGAAATAAATTATCAAGG - Intergenic
1018468558 6:164075983-164076005 TAGTGTGCCAAGAACTATCATGG + Intergenic
1022458587 7:30581875-30581897 TCAAGACCCAGGAACTATCATGG + Intergenic
1022925416 7:35051644-35051666 TGAAGAGTCATGAAATATCTTGG + Intergenic
1023517142 7:41012322-41012344 TGAAGAGCCGTGAACTATAATGG + Intergenic
1028848886 7:95514050-95514072 TGGAGAGCCATAAAGGACCAAGG - Intronic
1029099400 7:98115934-98115956 TGGAGTGCAGTGAACTGTCATGG + Intronic
1029823432 7:103166342-103166364 TGAAGAGTCATGAAATATCTTGG + Intergenic
1031273303 7:119683374-119683396 TGGAGAGCCACTGACTATAAAGG - Intergenic
1033535648 7:142309540-142309562 TGGAGAGGCATGAAATTCCATGG + Intergenic
1034672661 7:152870063-152870085 GGGAGAGTCAGGAACTACCATGG - Intergenic
1039900196 8:41746198-41746220 TGGGGAGCCATAAACTATCCGGG - Intronic
1040923844 8:52654551-52654573 TGGAGAACCATCAGCTTTCATGG + Intronic
1042836321 8:73081816-73081838 TGTAGACTCATGAACTATGAGGG + Intronic
1045736345 8:105300151-105300173 AGGAGAGTCAGGAACAATCATGG + Intronic
1052647253 9:31253108-31253130 TGTAGACCCTTGAACTACCATGG + Intergenic
1052999629 9:34570844-34570866 TGGAGAGCAATGAACTTCCTGGG + Intronic
1055393575 9:75849271-75849293 TGGAGACCCATTAACAGTCATGG - Intergenic
1059465647 9:114467228-114467250 TGTAGAGCCAGGGACCATCATGG - Intronic
1061494174 9:130962317-130962339 TGGAGACCCCAGAAATATCAGGG + Intergenic
1186631531 X:11354549-11354571 TGGAGACTGATGAACTCTCAGGG - Intronic
1188446851 X:30262800-30262822 TAGAAAACCATGAACTATTAAGG - Intergenic
1194743634 X:97605035-97605057 TGAAAAGGCATGAACTATCGGGG + Intergenic
1196951599 X:120930895-120930917 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196952283 X:120935756-120935778 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196952968 X:120940617-120940639 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196953653 X:120945477-120945499 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196954338 X:120950338-120950360 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196955021 X:120955198-120955220 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196955709 X:120960081-120960103 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196956390 X:120964942-120964964 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196957072 X:120969802-120969824 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196957754 X:120974662-120974684 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196958436 X:120979522-120979544 TGAAAAGCCATGAACTAAAAGGG + Intronic
1196959117 X:120984382-120984404 TGAAAAGCCATGAACTAAAAGGG + Intronic