ID: 1103906850

View in Genome Browser
Species Human (GRCh38)
Location 12:124332220-124332242
Sequence GCACCGTGGGTTTCTGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 71}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1103906843_1103906850 20 Left 1103906843 12:124332177-124332199 CCTGGGGGGAGGTGGTCAGCAGG 0: 1
1: 0
2: 3
3: 28
4: 397
Right 1103906850 12:124332220-124332242 GCACCGTGGGTTTCTGCCACTGG 0: 1
1: 0
2: 0
3: 7
4: 71
1103906847_1103906850 -4 Left 1103906847 12:124332201-124332223 CCACTTAGCTTTCGAAGGTGCAC 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1103906850 12:124332220-124332242 GCACCGTGGGTTTCTGCCACTGG 0: 1
1: 0
2: 0
3: 7
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1103906850 Original CRISPR GCACCGTGGGTTTCTGCCAC TGG Intronic
901017225 1:6238861-6238883 GCACAGTGGGTTTTGGCCCCAGG - Intergenic
901138423 1:7012406-7012428 GCCTCCTGGGTTTCTGGCACCGG + Intronic
901459356 1:9382517-9382539 GCACCGTGACTTTCTGCTAAAGG + Intergenic
901666054 1:10826885-10826907 GGACCGAGGGTTTCTGCCCACGG - Intergenic
903810514 1:26032601-26032623 ACACAGTAGGTTTCAGCCACAGG + Intronic
921604175 1:217136521-217136543 GCTCCGTGGGGTTTTGCCATGGG + Intronic
924854704 1:247864752-247864774 GCATCGTGGCTTTCTGGCCCAGG + Exonic
1063583953 10:7334237-7334259 GCACGGTGGGTTTCTGAGCCTGG - Intronic
1063759807 10:9060551-9060573 GCACTGTGCGTGTTTGCCACAGG - Intergenic
1064464139 10:15562703-15562725 CCTCCCAGGGTTTCTGCCACTGG - Intronic
1067969610 10:50954622-50954644 TCAGTGTGGATTTCTGCCACTGG + Intergenic
1068644825 10:59454355-59454377 GAACCTTGGCTTTCTGCCTCCGG + Intergenic
1068647001 10:59479284-59479306 ACAACTTGGCTTTCTGCCACCGG + Intergenic
1071479698 10:86055888-86055910 GCACTGTTGGTTTCTGGCAAGGG - Intronic
1078369660 11:10734455-10734477 GTAACGTGGGCTTCTGGCACGGG + Intergenic
1084351134 11:68600370-68600392 GCACCGTGGGTTGTTTCCATTGG - Exonic
1085029080 11:73258709-73258731 GGACCCTGGGTTTCTGCCCTGGG + Intergenic
1091123097 11:133073243-133073265 GCACCTTGCTTTTCTGCCCCAGG - Intronic
1101660314 12:106759550-106759572 GCACAGTGGGATTCTAGCACAGG - Intronic
1103906850 12:124332220-124332242 GCACCGTGGGTTTCTGCCACTGG + Intronic
1104422665 12:128650145-128650167 GCACTCTGAGTTTCTGCCAGAGG - Intronic
1109415294 13:62031527-62031549 GCACAGTGGGTGTTTGCAACAGG + Intergenic
1121216489 14:92252428-92252450 ACACCGTGGGCTTCTGCCAATGG - Intergenic
1123123950 14:105931137-105931159 GAACCGTGGGCTTCTGCCTCCGG + Intronic
1123668059 15:22625285-22625307 TCACCGTGTGTTACTGGCACAGG - Intergenic
1133423149 16:5664573-5664595 GCTCCCAGAGTTTCTGCCACAGG + Intergenic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135526162 16:23215211-23215233 ACTCCTTGGCTTTCTGCCACTGG - Exonic
1141859651 16:86707807-86707829 GCAGCCTGGGTTTCCGTCACGGG - Intergenic
1142714073 17:1738439-1738461 GCACCTCGGGTCTCTGCCAGAGG + Exonic
1152161663 17:78672547-78672569 ACACTGTAGCTTTCTGCCACTGG + Intergenic
1152788684 17:82266148-82266170 GCACCGTGGAGCTCTACCACAGG - Intronic
1160887505 19:1357609-1357631 GCTCCGTGAGTGTCTGGCACTGG + Intronic
1165865581 19:38935144-38935166 GCACTCTGGGATCCTGCCACGGG - Intronic
1167670567 19:50850694-50850716 GCACACGGGGTTTGTGCCACTGG + Intergenic
1168511184 19:56974712-56974734 ACTCCGTGTGTTTCTGCCCCAGG - Intergenic
934251773 2:90360843-90360865 CCACCGCGGCTTTCTGCCCCCGG - Intergenic
935208102 2:100914138-100914160 ACCCCTTGGGTTTCTCCCACAGG - Intronic
937458690 2:122066837-122066859 GCACTGAGGGTGTCTGCCATTGG + Intergenic
940236630 2:151518016-151518038 GCCCCATGGGTTTGTGCCCCAGG - Intronic
945192167 2:207200184-207200206 GGTCCGTGGGTTACTGCCACTGG - Intergenic
1170445934 20:16427689-16427711 TCACCTTGGGTTTCTGCTCCTGG - Intronic
1170481128 20:16765962-16765984 GCACAGTGCCTTTCTGCCACAGG + Intronic
1171987528 20:31670937-31670959 GCACCTTGGGTGGCTCCCACTGG + Intronic
1175109124 20:56633833-56633855 GCACCCTGGGTTTGTTCCCCAGG + Intronic
954711385 3:52506670-52506692 GCTCAGTGGGTCTCTGCCGCAGG + Exonic
955852963 3:63240874-63240896 GCACAGTGGGATTCTACCACAGG - Intronic
958982162 3:100734486-100734508 ACACTGTGGTTTTCTGCCATTGG + Intronic
960721967 3:120633254-120633276 GCAAGGTGGGTTCCTGCCAGGGG - Exonic
961204947 3:125074583-125074605 GCACAGTGGGGTTCTGCTTCAGG - Intergenic
966988542 3:185204635-185204657 GCACCCTGGGTGTCTTGCACAGG - Exonic
967260640 3:187638424-187638446 GCACAATGGGTTTCTGCCCAGGG - Intergenic
969518192 4:7660397-7660419 ACACCGTAGGTTTGTCCCACTGG + Intronic
979745354 4:124206026-124206048 GCGCTGTGGGTTTCAGCCAGAGG + Intergenic
986025014 5:3842709-3842731 GCACAGTGGGTGTTTCCCACGGG + Intergenic
987962164 5:24824261-24824283 GCAGCTTGGGCTTCTGCTACAGG + Intergenic
996831629 5:127746857-127746879 GAACCTTGAGTCTCTGCCACTGG - Intergenic
1001090516 5:168736803-168736825 GGGACCTGGGTTTCTGCCACAGG + Intronic
1004197202 6:13515733-13515755 GCCCCGTGGTTCTCAGCCACGGG - Intergenic
1023368688 7:39490540-39490562 CCACCATGGGTTTCTCCCAGTGG - Intronic
1024492452 7:50001055-50001077 GCAGGGTTGGTTTCTGCCAAGGG - Intronic
1025553700 7:62276979-62277001 CCGCCGTGGCTTTCTGCCCCCGG - Intergenic
1029495489 7:100893989-100894011 ACCCCGTCGCTTTCTGCCACCGG - Exonic
1029797670 7:102912012-102912034 GCAGCATGGGTTTCTCCCCCAGG - Intronic
1032371403 7:131356792-131356814 GTAACTTGGGTATCTGCCACCGG - Intronic
1036767088 8:11556065-11556087 GCACCGTGGGCATCAGCCCCAGG - Intronic
1038138549 8:24817223-24817245 ACACCTTGGCTTTCTGCCATGGG - Intergenic
1038411111 8:27360591-27360613 TCGCCATGGGGTTCTGCCACCGG - Intronic
1041391817 8:57353678-57353700 GCAGAGTAGGTTTCTTCCACAGG + Intergenic
1045795282 8:106036716-106036738 GCACCGTGGTTTCCTGCCTCAGG - Intergenic
1192502069 X:71660888-71660910 CCAGCTTGGGTTTTTGCCACCGG - Intergenic
1192509228 X:71712247-71712269 CCAGCTTGGGTTTTTGCCACCGG - Intergenic
1192511491 X:71722916-71722938 CCAGCTTGGGTTTTTGCCACCGG + Intergenic
1192515206 X:71758589-71758611 CCAGCTTGGGTTTTTGCCACCGG - Intergenic
1192517469 X:71769306-71769328 CCAGCTTGGGTTTTTGCCACCGG + Intergenic
1192528434 X:71867481-71867503 CCAGCTTGGGTTTTTGCCACTGG - Intergenic
1196207929 X:112962208-112962230 GCACCTTGGGTGTCTGCCAGTGG + Intergenic
1200167509 X:154047396-154047418 GCACCTTGGGATTCTTCCAAGGG + Intronic
1200802297 Y:7397922-7397944 TCACCCTGGGTTTCTTCCCCTGG - Intergenic